Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Mar 8;103(5):103637. doi: 10.1016/j.psj.2024.103637

Intermittent mild cold acclimation ameliorates intestinal inflammation and immune dysfunction in acute cold-stressed broilers by regulating the TLR4/MyD88/NF-κB pathway

Yanju Bi *,1, Haidong Wei †,1, Yiwen Chai †, Hongyu Wang †, Qiang Xue †, Jianhong Li †,‡,2
PMCID: PMC10978541  PMID: 38518665

Abstract

To investigate the potential protective effect of prior cold stimulation on broiler intestine induced by acute cold stress (ACS). A total of 384 one-day-old broilers were divided into control (CON), ACS, cold stimulation Ⅰ (CS3+ACS), and cold stimulation Ⅱ (CS9+ACS) groups. Broilers in CON and ACS groups were reared normally, and birds in CS3+ACS and CS9+ACS groups were reared at 3℃ and 9℃ below CON group for 5 h, respectively, on alternate days from d 15 to 35. Broilers in ACS, CS3+ACS, and CS9+ACS groups were subjected to 10℃ for 24 h on d 43. Eventually, small intestine tissues were collected for histopathological observation and indexes detection. The results showed that intestinal tissues in all ACS-broilers exhibited inflammatory cell infiltrates, microvilli disruption, reduced villus length in jejunum and increased crypt depth in jejunum and ileum. Whereas these phenomena were relatively light in CS3+ACS group. Compared to CON group, mRNA expression of the TLR4/MyD88/NF-κB pathway-related genes (TLR4, MyD88, NF-κBp65, COX-2, iNOS, PTGEs, TNF-α), Th1/Th17-derived cytokines (IL-1β, IL-2, IL-8, IL-12, IFN-γ, IL-17), and HSPs (HSP40, HSP60, HSP70, HSP90) was upregulated (P < 0.05), and that of Th2-deviated cytokines (IL-4, IL-6, IL-10, IL-13) and IκBα was downregulated (P < 0.05) in small intestine in almost all ACS-broilers. Compared to ACS group, mRNA expression of most of the TLR4/MyD88/NF-κB pathway-related genes, Th1/Th17-derived cytokines, and HSPs was downregulated and that of Th2-derived cytokines was upregulated in CS3+ACS group (P < 0.05). Protein expression levels of TLR4, MyD88, p-p65/p65, p-IκBα/IκBα, IKK, TNF-α, IL-1β, IL-10, and HSPs were similar to their mRNA expression. The concentration of sIgA and activities of CAT, SOD, and GSH-px were decreased and MDA and H2O2 were increased in ACS and CS9+ACS groups compared to CON group (P < 0.05). Therefore, cold stress caused oxidative stress and inflammation, leading to gut immune dysfunction; while mild cold stimulation at 3℃ below normal rearing temperature alleviated cold stress-induced intestinal injure and dysfunction by modulating the TLR4/MyD88/NF-κB pathway in broilers.

Key words: cold stimulation, oxidative stress, inflammation, intestinal immunity, broiler

INTRODUCTION

Cold climate is a prevalent environmental stressor affecting the welfare and health of livestock and poultry in the northern regions of the globe. Cold stress usually occurs when the ambient temperature drops below 18℃ in poultry, which reduces growth performance and egg production (Ipek and Sahan, 2006; Qureshi et al., 2018), disrupts redox homeostasis, and causes oxidative stress and tissue damage (Zhao et al., 2014; Bahadoran et al., 2021), impairing physiological function and health of chickens (Hangalapura et al., 2004; Aminoroaya et al., 2016). Cold stress also causes ascites and increases the morbidity and mortality of chickens (Nemati et al., 2017).

The small intestine, including duodenum, jejunum, and ileum, is the main site of food digestion and absorption, and the intestinal mucosa plays an important immune function. Environmental factors such as heat, cold, harmful gas, and heavy metals, affect the morphology and structure of small intestine, impairing intestinal health and function (Goel et al., 2021; Zhou et al., 2021). Studies reported that cold stress causes inflammatory response and immune dysfunction of small intestine, and impairs intestinal barrier stability in broilers by altering the mRNA expression of nuclear factor-kappa B (NF-κB), tumor necrosis factor-α (TNF-α), immunoglobulin A, interleukin (IL)-2, IL-4, IL-10, IL-17, Claudin-1, E-cadherin, and tight junction proteins (Zhao et al., 2013; Zhou et al., 2021; Xing et al., 2023). Additionally, the villus length, crypt depth, and villus length/crypt depth ratio are often used to assess intestinal digestion, absorption and mechanical barrier function (Zhang et al., 2021). A small number of studies showed that cold stress at 13 ± 2℃ decreases the villus length of small intestine and villus height/crypt depth ratio of duodenum and ileum in broilers (Rahmani et al., 2018; Abdullah et al., 2022). Therefore, cold stress negatively influences the health and function of small intestine in broilers.

Inflammation and heat shock response are a series of protective responses to tissue damage induced by adverse factors. Some studies demonstrated that cold stress at 7℃ or 10℃ upregulates the expression of NF-κB, TNF-α, IL-1β, cyclooxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS), prostaglandin E synthases (PTGE), and heat shock proteins (HSP) in the intestines of broilers, leading to inflammation and stress response (Su et al., 2018; Liu et al., 2022a). Accumulating evidence suggested that the toll-like receptor 4 (TLR4)/myeloid differentiation factor 88 (MyD88)/NF-κB pathway is involved in the regulation of cell growth, oxidative stress, immune inflammation, and other pathological processes in various tissues and organs, and the inhibition of this pathway can reduce stress-caused inflammatory response in animals (Xu et al., 2021; Liu et al., 2022b).

There is mounting evidence suggests that appropriate cold acclimation improves the anti-resistance of animals to cold stress. For example, Golozoubova et al. (2001) reported that the mice exposed to 18℃ or 24℃ for cold acclimation develops the tolerance to cold stress at 4℃, and maintains normal body temperature through the uncoupling protein 1-mediated adaptive thermogenesis. Similarly, in broilers, a long-term cold acclimation at 3℃ lower than normal rearing temperature enhances the resistance of liver and trachea to cold stress at 7℃ by improving heat shock protective response and antioxidant defense function (Wei et al., 2018; Su et al., 2019). Meanwhile, our recent studies found that intermittent mild cold stimulation training of 3℃ below normal rearing temperature for 5 h at 1-d interval, which could improve anti-cold stress ability of liver, heart and thymus tissues in broilers via regulating energy metabolism, inflammatory immune response, and antioxidant function (Fu et al., 2022, Gong et al., 2023, Wei et al., 2023). Therefore, pre‐cold acclimation is beneficial to enhance the cold resistance of broilers.

Although our previous studies have suggested that intermittent mild cold stimulation at 3℃ below normal rearing temperature enhances immune function of intestines by modulating the expression of gut barrier-related genes in cold stressed-broilers (Liu et al., 2022a; Xing et al., 2023; Zhang et al., 2023), whether cold relevant oxidative stress and inflammation are involved in regulating intestinal immunity in this process remains unclear. Therefore, this study aimed to investigate the potential protective effect of per-appropriate cold stimulation training on cold stress-induced intestinal damage in broilers. We hypothesized that intermittent mild cold stimulation enhances immune function and anti-cold ability of small intestine via improving antioxidant defense function and heat shock protective response and inhibiting inflammation-relevant TLR4/MyD88/NF-κB pathway. The results of the present study reveal the underlying mechanism of appropriate cold stimulation alleviates cold stress-induced intestinal inflammatory injure in broilers, and it also provides a practical method to reduce adverse impact of cold stress on the intestine.

MATERILAS AND METHODS

Ethics Statement

All experiments were approved by and conducted according to the guidelines of the Institutional Animal Care and Use Committee of Northeast Agriculture University (NEAU-[2011]-9).

Animals and Experimental Design

A total of 384 one-day-old female Arbor Acres broilers were purchased from a local farm industry (Harbin, China) and studied. All broilers were reared in cage system throughout the experimental period from d 1 to d 44, and equally divided into 4 treatment groups, including control (CON) group, acute cold stress (ACS) group, cold stimulation treatment Ⅰ + ACS (CS3+ACS) group, and cold stimulation treatment Ⅱ + ACS (CS9+ACS) group. Broilers in each group (n = 96) were housed in a controlled ambient temperature chicken house, and reared in 6 cages with 16 birds pre cage (180 cm length × 80 cm width × 60 cm height). The rearing temperature of broilers in each group was consistent to our previous report (Wei et al., 2024).

Briefly, animals in CON group were reared following the normal rearing temperature, namely, 35℃ of ambient temperature from d 1 to d 3, and then gradually reduced the temperature of 1℃ by every 2 d until it dropped to 20℃ on d 32, and keep this temperature to d 44. The rearing temperature of broilers in ACS group was same with that in CON group from d 1 to d 42. Meanwhile, broilers in CS3+ACS and CS9+ACS groups were reared at the ambient temperature of 3℃ and 9℃ below that used for CON group, respectively, on alternate days starting at 09:30 am for 5 h from d 15 to d 35. Finally, broilers in ACS, CS3+ACS, and CS9+ACS groups were exposed to acute cold stress at 10℃ for 24 h starting at 08:00 on d 43. All broilers had free to access feed and water during the experimental period. The commercial diet (Baisicheng Animal Husbandry Corporation Ltd., Harbin, China) fed to broilers with 12.1 MJ/kg metabolic energy and 21.0% crude protein from d 1 to d 21 and with 12.6 MJ/kg metabolic energy and 19.0% crude protein from d 22 to d 44.

Sample Collection

Following the ACS for 24 h, 24 broilers (n = 6 each group) were sacrificed by cervical dislocation on d 44. The duodenum, jejunum, and ileum tissues were removed from the body, and tissues were cleaned with ice normal saline to flush out the intestinal contents. Each intestinal tissue was cut into 2 parts, one for histopathologic examination and the other was stored at -80℃ used for gene and protein expression determination.

Hematoxylin and Eosin Staining

A piece (about 3 mm in length) of fresh duodenum, jejunum, and ileum tissues from midden section of each intestinal segment were cut, respectively, and fixed with 4% paraformaldehyde solution for 1 wk. These fixed tissues were gradual dewaxing and dehydration with graded xylene and ethanol, and then embedded in paraffin. Afterward, the embedded tissues were cut into the sections of 5-μm thickness by a microtome. The sections were stained using hematoxylin and eosin dye liquor, and then these prepared sections were observed and analyzed by an optical microscope (Eclipse E100, Nikon, Japan) (Wei et al., 2023). The histopathologic examination of stained sections was performed under a 50X of amplification with a visual field of 20 μm using the CaseViewer 2.4 (3DHISTECH, Hungary) software, and corresponding pictures were also taken. Additionally, the villus length and crypt depth of stained sections from each intestinal tissue were measured at a 5X of amplification with a visual field of 200 μm by the CaseViewer 2.4 (3DHISTECH, Hungary) software, and the ratio of villus length and crypt depth was also calculated.

Determination of Secretory Immunoglobulin A and Cytokines in Intestinal Tissues

A piece of fresh duodenum, jejunum, and ileum tissues (weighting 0.5 g each) from the middle of each intestinal segment was cut and homogenized, respectively, in 9.5 mL of ice normal saline at 4℃. The homogenates were centrifuged at 10,000 revolutions per minute for 10 min at 4℃, and the supernatants were collected for the determination of secretory immunoglobulin A (sIgA), IL-4, and interferon-γ (INF-γ) concentrations using the ELISA assay kits (Shanghai Jinma Laboratory Equipment Corporation Ltd., China) followed as the manufacturer's instructions. 50 μL of supernatants for each experimental sample were added into the micropore to measure the concentrations of physiological indicators. Meanwhile, a standard curve was done with the standard solutions of different concentrations for each indicator to quantify the levels of these indicators in testing samples. The optical density values of experimental and standard samples were measured at the wavelength of 450 nm using a microplate reader (Biotek Instrument Inc., Winooski, VT, USA). Eventually, the concentrations of sIgA, IL-4, and INF-γ in experimental samples were calculated following their optical density values and corresponding standard curve.

Determination of Oxidative and Antioxidative Indexes in Small Intestine

The homogenates of intestinal tissues were also used to measure the concentrations of oxidative stress indexes malondialdehyde (MDA) and hydrogen peroxide (H2O2) and activities of antioxidant enzymes catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GSH-px) using the corresponding kits (Jiancheng Biotechnology Research Institute, Nanjing, China) according to our previous description (Wei et al., 2023).

Total RNA Extraction, cDNA Synthesis, and Quantitative Real-Time Polymerase Chain Reaction Analysis

Total RAN from 100 mg tissue was extracted using 1 mL RNAiso Plus Kit (Takara, China), and concentration and purity of each total RNA were measured at the wavelength of 260 nm and 260/280 nm ratio, respectively. cDNA was synthesized from 1 μg of total RNA according to the manufacturer's instructions of reverse transcription kit (TOYOBO, Japan). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on the Light Cycler 96 qPCR system (Roche, Switzerland). The reaction mixture system of qRT-PCR was 10 μL, including 0.3 μL of forward and reverse primer (10 μM) each (Table 1), 3.4 μL of PCR-grade water, 5 μL of THUNDERBIRD Next SYBR qPCR Mix (TOYOBO, Japan), and 1 μL of cNDA sample (Wei et al., 2023). The running conditions of qRT-PCR followed as: degeneration at 90℃ for 1 min, and followed by 40 cycles of 95℃ for 15s and 60℃ for 1 min. The PCR amplification was replicated in triplicate for each target genes, and their average threshold cycle value was used to calculate the expression level of genes. House-keeping gene β-actin was used as internal reference, and the method of 2−∆∆Ct was applied to calculate the relative expression level of each target gene.

Table 1.

Primer sequences of target genes used in this study for qRT-PCR.

Gene Refence sequence Primer sequence (5′→3′)
TLR4 NM_001030693.1 Forward: AGTCTGAAATTGCTGAGCTCAAAT
Reverse: GCGACGTTAAGCCATGGAAG
MyD88 NM_001030962.5 Forward: ATTCCGGTCAAGTGCAAGAC
Reverse: ATCACGGCAGCAAGAGAGAT
NF-κBp65 NM_205134 Forward: TCAACGCAGGACCTAAAGACAT
Reverse: GCAGATAGCCAAGTTCAGGATG
IκBα NM_001001472.2 Forward: CAGCACTACACTTGGCCGTA
Reverse: GGAGTAGCCCTGGTAGGTCA
TNF-α NM_204267 Forward: GCCCTTCCTGTAACCAGATG
Reverse: ACACGACAGCCAAGTCAACG
COX-2 NM_001167718 Forward: TGTCCTTTCACTGCTTTCCAT
Reverse: TTCCATTGCTGTGTTTGAGGT
iNOS NM_204961.1 Forward: CCTGGAGGTCCTGGAAGAGT
Reverse: CCTGGGTTTCAGAAGTGGC
PTGEs NM_001194983.1 Forward: GTTCCTGTCATTCGCCTTCTAC
Reverse: CGCATCCTCTGGGTTAGCA
INF-γ NM_205149.1 Forward: GCTGACGGTGGACCTATTATTGTAGAG
Reverse: TTCTTCACGCCATCAGGAAGGTTG
IL-1β NM_204524.1 Forward: ACTGGGCATCAAGGGCTACA
Reverse: GCTGTCCAGGCGGTAGAAGA
IL-2 NM_204153.1 Forward: CTGTATTTCGGTAGCAATG
Reverse: ACTCCTGGGTCTCAGTTG
IL-4 NM_001007079.1 Forward: GTGCCCACGCTGTGCTTAC
Reverse: AGGAAACCTCTCCCTGGATGTC
IL-6 NM_204628.1 Forward: AAATCCCTCCTCGCCAATCT
Reverse: CCCTCACGGTCTTCTCCATAAA
IL-8 NM_205498.2 Forward: GGCTTGCTAGGGGAAATGA
Reverse: AGCTGACTCTGACTAGGAAACTGT
IL-10 NM_001004414.4 Forward: GCTGAGGGTGAAGTTTG
Reverse: GGTGAAGAAGCGGTGA
IL-12 NM_001398447.1 Forward: TCAGTTTCATCGGGCAGAGG
Reverse: GGAGCAGTTGAGTCCCTTGG
IL-13 AJ621250.1 Forward: ATGACACCAGAGTGGCACAA
Reverse: GTGATGAGGGGCTCGTAGTC
IL-17 AY744450.1 Forward: GCCATTCCAGGTGCGTGAACTC
Reverse: CGGCGGAGGACGAGGATCTC
HSP40 NM_001199325.1 Forward: GGGCATTCAACAGCATAGA
Reverse: TTCACATCCCCAAGTTTAGG
HSP60 NM_001012916.1 Forward: AGCCAAAGGGCAGAAATG
Reverse: TACAGCAACAACCTGAAGACC
HSP70 NM_001006685.1 Forward: CGGGCAAGTTTGACCTAA
Reverse: TTGGCTCCCACCCTATCTCT
HSP90 NM_001109785.1 Forward: TCCTGTCCTGGCTTTAGTTT
Reverse: AGGTGGCATCTCCTCGGT
β-actin NM_205518.1 Forward: CCGCTCTATGAAGGCTACGC
Reverse: CTCTCGGCTGTGGTGGTGAA
Open in a new tab

Protein Extraction and Western Blot Analysis

Total proteins were extracted, respectively, from 100 mg of each intestinal tissue using 1 mL of western lysis buffer with 10 μL of PMSF. The concentration of total proteins from each intestinal tissue sample was measured by an enhanced BCA Protein Assay Kit (Beyotime, China) following as the manufacturer's instructions. For western blotting, 30 μg of total proteins for each sample were separated by 10% or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) to isolate target proteins. The target proteins were transferred to nitrocellulose membranes, which were then blocked with 5% of skim milk for 1 h at the room temperature. Afterward, the membranes were incubated overnight at 4℃ with the corresponding primary antibodies, including β-actin (ab8227, 1:7,000, Abcam, UK), TLR4 (WL00196, 1:1,000, Wanleibio, China), MyD88 (WL02494, 1:500, Wanleibio, China), NF-κBp65 (WL01980, 1:1,500, Wanleibio, China), p-NF-κBp65 (WL02169, 1:500, Wanleibio, China), inhibitor of κB kinase (IKK, 1:500, Wanleibio, China), IκBα (WL01936, 1:500, Wanleibio, China), p-IκBα (WL02495, 1:500, Wanleibio, China), TNF-α (WL01581, 1:1,500, Wanleibio, China), IL-1β (WL00891, 1:500, Wanleibio, China), IL-10 (WL03088, 1:1,000, Wanleibio, China), HSP40 (A23957, 1:600, ABclonal, China), HSP60 (A0564, 1:400, ABclonal, China), HSP70 (ab31010, 1:1,000, Abcam, UK), and HSP90 (13171-1-AP, 1:7,000, Proteintech, USA). The membranes were incubated with a horseradish peroxidase conjugated goat anti-rabbit IgG antibody (1:20,000, Bioss Antibodies, China) for 1 h. Finally, the protein bands were detected using an enhanced chemiluminescence kit (Beyotime, China) under a gray scale scanner (Gene-Gnome XRQ, Cambridge, UK). The protein expression level was calculated based on the ratio of optical density of each target protein to that of β-actin.

Statistical Analysis

The statistical analysis of data was performed on the SPSS 22.0 (SPSS Inc., Chicago, IL) software. Normal distribution was tested with the Kolmogorov–Smirnov test before statistical analysis, and all data displayed the homogeneity of variance. The difference in each indicator among the groups was analyzed by one-way analysis of variance with Duncan's multiple comparison. The results were expressed as “mean ± SEM,” and the inter-group difference was recognized statistically significant at P ≤ 0.05.

RESULTS

Histopathological and Morphological Observations of Small Intestine

The results of histopathological evaluation of duodenum, jejunum, and ileum tissues in each group are shown in Figure 1. There were more inflammatory cell infiltration and intestinal microvilli disruption appeared in duodenum, jejunum, and ileum tissues of ACS and CS9+ACS groups. In CS3+ACS group, a small amount of inflammatory cell infiltration in duodenum, jejunum, and ileum tissues, and a few microvilli disruption in duodenum and jejunum tissues were observed. The morphology and structure of the intestinal villi in CON group were relatively regular and normal.

Figure 1.

Figure 1

Open in a new tab

Histopathological changes of small intestine in broilers. (A) H&E staining results of duodenum in each group. (B) H&E staining results of jejunum in each group. (C) H&E staining results of ileum in each group. Red arrows reflect inflammatory cell infiltration; Blue arrows reflect intestinal microvilli disruption.

Figure 2 displayed the results of the intestinal morphology. Compared to CON group, the villus length and crypt depth of duodenum were significantly increased in CS3+ACS group (P < 0.05), whereas the villus length and villus length/crypt depth ratio were significantly decreased in CS3+ACS group (P < 0.05, Figure 2A and B). The villus length and crypt depth of duodenum in CS3+ACS group were significantly higher than those in ACS group (P < 0.05, Figure 2A and B). Besides, compared to CON group, the villus length of jejunum in ACS and CS9+ACS groups and that of ileum in CS9+ACS group were significantly reduced (P < 0.05, Figure 2D and F). The increased crypt depth and decreased ratio of villus length/crypt depth in jejunum and ileum of ACS, CS3+ACS, and CS9+ACS groups were measured when compared to CON group (P < 0.05, Figures 2C, 2D, 2E, and 2F). Additionally, compared to ACS group, the villus length and villus length/crypt depth ratio of jejunum in CS3+ACS group were significantly increased (P < 0.05), and the villus length and crypt depth of jejunum in CS9+ACS group were significantly reduced (P < 0.05, Figures 2C and 2D).

Figure 2.

Figure 2

Open in a new tab

Results of intestinal morphology reflected by H&E staining. (A, B) Villus height, crypt depth, and their ratio of duodenum in each group. (C, D) Villus height, crypt depth, and their ratio of jejunum in each group. (E, F) Villus height, crypt depth, and their ratio of ileum in each group. Bars with different small letters (a, b, c) represent significant difference between groups (P < 0.05), and no letters or same small letters represent the difference is not significant (P > 0.05).

Determination of Redox-Related Indexes in Small Intestine

The results of oxidative and antioxidative indexes in small intestine of broilers from each group are shown in Table 2. Compared to CON group, the concentrations of MDA and H2O2 were significantly elevated (P < 0.05), whereas the activities of SOD, CAT, and GSH-px were significantly reduced (P < 0.05) in duodenum, jejunum, and ileum in ACS, CS3+ACS, and CS9+ACS groups. Compared to ACS group, the concentrations of MDA and H2O2 were decreased (P < 0.05) and the activities of SOD, CAT, and GSH-px were increased (P < 0.05) in duodenum, jejunum, and ileum in CS3+ACS group except SOD in duodenum and CAT in jejunum were not differential (P > 0.05).

Table 2.

Measurement of oxidant and antioxidant indexes in small intestine of broilers.

Intestine Index (unit) Group
CON ACS CS3+ACS CS9+ACS
Duodenum MDA (nmol/mg prot) 8.56c ± 0.54 20.83a ± 1.00 15.39b ± 0.92 22.34a ± 1.66
H2O2 (mmol/g prot) 18.66b ± 1.51 32.67a ± 2.32 19.23b ± 1.35 29.52a ± 0.68
SOD (U/mg prot) 53.83a ± 4.30 40.30b ± 1.66 39.58b ± 2.33 35.90b ± 1.93
CAT (U/mg prot) 330.97a ± 14.01 206.79c ± 14.45 268.12b ± 19.96 172.65c ± 14.06
GSH-px (U/mg prot) 583.75a ± 34.29 443.51c ± 16.06 490.33b ± 16.17 438.03c ± 27.14
Jejunum MDA (nmol/mg prot) 6.82c ± 0.38 13.08a ± 0.43 9.79b ± 0.79 13.65a ± 0.94
H2O2 (mmol/g prot) 7.80c ± 0.36 19.84a ± 1.25 14.94b ± 1.07 19.27a ± 1.45
SOD (U/mg prot) 61.21a ± 2.05 47.11c ± 2.17 52.49b ± 3.38 45.29c ± 3.36
CAT (U/mg prot) 60.44a ± 2.21 36.08b ± 1.89 41.76b ± 2.71 34.74b ± 3.22
GSH-px (U/mg prot) 586.63a ± 54.48 388.48c ± 34.78 501.58b ± 25.89 380.62c ± 20.61
Ileum MDA (nmol/mg prot) 4.99c ± 0.49 10.72ab ± 0.79 9.90b ± 0.52 12.01a ± 0.43
H2O2 (mmol/g prot) 12.86c ± 0.46 19.38a ± 1.45 16.42b ± 1.13 20.65a ± 1.10
SOD (U/mg prot) 94.30a ± 6.08 79.55c ± 3.67 89.21b ± 1.86 67.80d ± 4.23
CAT (U/mg prot) 81.88a ± 3.00 64.23c ± 5.08 75.11b ± 3.90 50.11d ± 3.66
GSH-px (U/mg prot) 519.86a ± 25.61 407.48c ± 19.03 468.21b ± 14.85 389.23c ± 19.13
Open in a new tab
a,b,c,d

Means with different superscripts in the same index are significantly different at P < 0.05. Means with same or no superscripts represent no significant differences at P > 0.05.

mRNA and Protein Expression Levels of the TLR4/MyD88/NF-κB Pathway-Related Genes in Small Intestine

The mRNA expression levels of the TLR4/MyD88/NF-κB pathway-related genes in small intestine of broilers are shown in Figure 3. Compared to CON group, the mRNA expression of TLR4, MyD88, and NF-κBp65 was upregulated (P < 0.05) and that of IκBα was downregulated (P < 0.05) in small intestine (duodenum, jejunum, and ileum) in ACS, CS3+ACS, and CS9+ACS groups. The mRNA expression of COX-2, iNOS, PTGEs, and TNF-α in small intestine in ACS group was higher than CON group (P < 0.05) except iNOS in jejunum was not differential (P > 0.05). Compared to CON group, in duodenum, the mRNA expression of COX-2 in CS9+ACS group and that of iNOS in CS3+ACS and CS9+ACS groups were upregulated (P < 0.05); in jejunum, the mRNA expression of COX-2, iNOS, TNF-α in CS9+ACS group and that of PTGEs in CS3+ACS and CS9+ACS groups were upregulated (P < 0.05); and in ileum, the mRNA expression of COX-2, iNOS, PTGEs, and TNF-α in CS9+ACS group and that of COX-2 and PTGEs in CS3+ACS group were upregulated (P < 0.05), and TNF-α in CA3+ACS group was downregulated (P < 0.05).

Figure 3.

Figure 3

Open in a new tab

Relative mRNA expression of the TLR4/MyD88/NF-κB signaling pathway-related genes in (A) duodenum, (B) jejunum, and (C) ileum of broilers in each group. The results are expressed as “mean ± SEM”, n = 6. Bars with different small letters (a, b, c, d) represent significant difference between groups (P < 0.05), and no letters or same small letters represent the difference is not significant (P > 0.05).

Besides, compared to ACS group, the mRNA expression of TLR4, MyD88, NF-κBp65, COX-2, iNOS, PTGEs, and TNF-α was downregulated and IκBα was upregulated in small intestine in CS3+ACS group (P < 0.05). In CS9+ACS group, the mRNA expression levels of TLR4, MyD88, NF-κBp65, PTGEs, and TNF-α in duodenum, TLR4, IκBα, and TNF-α in jejunum, and NF-κBp65 in ileum were downregulated (P < 0.05), whereas those of NF-κBp65, COX-2, iNOS, and PTGEs in jejunum and TLR4, COX-2, and TNF-α in ileum were upregulated (P < 0.05) when compared to CON group.

The protein expression levels of the TLR4/MyD88/NF-κB pathway are shown in Figure 4. Compared to CON group, the protein expression levels of MyD88 and TLR4 were increased in small intestine in ACS and CS9+ACS groups (P < 0.05) except MyD88 in jejunum in CS9+ACS group was not differential (P > 0.05), whereas protein levels of TLR4 and MyD88 in duodenum and MyD88 in ileum in CS3+ACS group were decreased (P < 0.05), but TLR4 and MyD88 in jejunum and TLR4 in ileum in CS3+ACS were increased (P < 0.05). The protein levels of p-p65/p65, p-IκBα/IκBα, IKK, and TNF-α in small intestine in ACS, CS3+ACS, and CS9+ACS groups were increased (P < 0.05) except IKK and TNF-α in duodenum were reduced (P < 0.05) and p-p65/p65 and p-IκBα/IκBα in jejunum in CS3+ACS group were not differential (P > 0.05).

Figure 4.

Figure 4

Open in a new tab

Protein levels of the TLR4/MyD88/NF-κB signaling pathway-related genes in (A) duodenum, (B) jejunum, and (C) ileum of broilers in each group. The results are expressed as “mean ± SEM.” Bars with different small letters (a, b, c, d) represent significant difference between groups (P < 0.05), and no letters or same small letters represent the difference is not significant (P > 0.05).

Additionally, compared to ACS group, the protein expression levels of TLR4, MyD88, IKK, and TNF-α and protein ratio of p-p65/p65 and p-IκBα/IκBα in small intestine in CS3+ACS group were decreased (P < 0.05), whereas protein levels of p-p65/p65 and TNF-α in duodenum, p-IκBα/IκBα in jejunum, and MyD88 in ileum in CS9+ACS group were increased (P < 0.05).

Determination of Th1-Derived Cytokines in Small Intestine

The measured results of Th (helper T cell) 1-derived inflammatory cytokines are shown in Figure 5. The mRNA and protein expression levels of IL-1β in duodenum in ACS and CS9+ACS groups and that in jejunum in ACS, CS3+CS3, and CS9+ACS groups were increased compared to CON group (P < 0.05). Compared to CON group, the protein level of IL-1β in ileum in ACS group was increased and that in CS3+ACS and CS9+ACS groups was decreased (P < 0.05), whereas mRNA expression of IL-1β in ACS, CS3+ACS, and CS9+ACS groups was upregulated (P < 0.05). The mRNA expression levels of IL-2 and IFN-γ in duodenum, IFN-γ in jejunum, and IL-8 and IFN-γ in ileum in ACS, CS3+ACS, and CS9+ACS groups, and IL-8 in duodenum and IL-2 and IL-12 in jejunum and ileum in ACS and CS9+ACS groups, as well as IL-12 in duodenum in CS9+ACS group were upregulated (P < 0.05), while the mRNA expression of IL-8 in jejunum in CS3+ACS group was downregulated (P < 0.05) compared to CON group.

Figure 5.

Figure 5

Open in a new tab

Relative mRNA and protein expression levels of Th1-derived cytokines in (A) duodenum, (B) jejunum, and (C) ileum of broilers in each group. The results are expressed as “mean ± SEM”, n = 6. Bars with different small letters (a, b, c, d) represent significant difference between groups (P < 0.05), and no letters or same small letters represent the difference is not significant (P > 0.05).

Compared to ACS group, the protein level of IL-1β and mRNA expression of all Th1-derived cytokines in small intestine in CS3+ACS were reduced (P < 0.05) except IL-2 and IL-12 in duodenum and IL-2 in ileum were not differential (P > 0.05). The mRNA expression of these Th1-derived cytokines was upregulated (P < 0.05) except IL-1β and IFN-γ in duodenum, IL-1β in jejunum, and IL-8 and IL-12 in ileum were downregulated (P < 0.05) in CS9+ACS group compared to ACS group.

Additionally, the concentration of IFN-γ in small intestine in ACS, CS3+ACS, and CS9+ACS groups was increased (P < 0.05) except it was not differential in CS3+ACS group (P > 0.05) when compared to CON group. Compared to ACS group, the concentration of IFN-γ in small intestine in CS3+ACS group was reduced (P < 0.05) and that was increased in ileum in CS9+ACS group (P < 0.05).

Determination of Th2-Derived Cytokines in Small Intestine

The measured results of Th2-derived cytokines in small intestine of broilers are shown in Figure 6. Compared to CON group, the protein levels of IL-10 in duodenum and jejunum in ACS, CS3+ACS, and CS9+ACS groups and in ileum in CS3+ACS and CS9+ACS group were increased (P < 0.05), but that in ACS group was decreased (P < 0.05). Compared to ACS group, the protein levels of IL-10 in small intestine in CS3+ACS and CS9+ACS group were increased (P < 0.05). Compared to CON group, the mRNA expression of Th2-derived cytokines (IL-4, IL-6, IL-10, and IL-13) in duodenum and that of IL-10 in jejunum and ileum in ACS group were downregulated (P < 0.05). Compared to ACS group, the mRNA expression of Th2-derived cytokines in small intestine in CS3+ACS and CS9+ACS groups was upregulated (P < 0.05) except IL-4 and IL-6 in CS3+ACS group were not differential (P > 0.05).

Figure 6.

Figure 6

Open in a new tab

Relative mRNA and protein expression levels of Th2-derived cytokines in (A) duodenum, (B) jejunum, and (C) ileum of broilers in each group. The results are expressed as “mean ± SEM”, n = 6. Bars with different small letters (a, b, c, d) represent significant difference between groups (P < 0.05), and no letters or same small letters represent the difference is not significant (P > 0.05).

The concentration of IL-4 in duodenum and jejunum in ACS, CS3+ACS, CS9+ACS groups was reduced (P < 0.05) but it in ileum in CS3+ACS and CS9+ACS groups was increased (P < 0.05) compared to CON group. Compared to ACS group, the concentration of IL-4 in small intestine in CS3+ACS and CS9+ACS groups was increased (P < 0.05) except that in jejunum in CS9+ACS group was not differential (P > 0.05).

Determination of Th17-Derived Cytokines in Small Intestine

The relative mRNA expression of IL-17 in small intestine of broilers is shown in Figure 7. Compared to CON group, the mRNA expression of IL-17 in duodenum and ileum in ACS, CS3+ACS, and CS9+ACS groups and that in jejunum in ACS and CS9+ACS groups were upregulated (P < 0.05). Compared to ACS group, the mRNA expression levels of IL-17 in small intestine in CS3+ACS and CS9+ACS groups were increased (P < 0.05) except its level in jejunum in CS9+ACS group was not differential (P > 0.05).

Figure 7.

Figure 7

Open in a new tab

Relative mRNA expression of IL-17 in small intestine of broilers in each group. The results are expressed as “mean ± SEM,” n = 6. Bars with different small letters (a, b, c, d) represent significant difference between groups (P < 0.05), and no letters or same small letters represent the difference is not significant (P > 0.05).

Determination of sIgA Concentration in Small Intestine

The measured results of sIgA concentration are shown in Figure 8. The concentration of sIgA in duodenum in ACS, CS3+ACS, and CS9+ACS groups were lower than CON group (P < 0.05). Compared to CON group, the concentration of sIgA in jejunum and ileum in CS3+ACS group was increased (P < 0.05) but it was decreased in ACS and CS9+ACS group (P < 0.05). Compared to ACS group, the concentration of sIgA in small intestine of CS3+ACS group was increased (P < 0.05), and sIgA in duodenum was reduced and that in ileum was increased in CS9+ACS group (P < 0.05).

Figure 8.

Figure 8

Open in a new tab

Concentrations of sIgA in small intestine of broilers in each group. The results are expressed as “mean ± SEM”, n = 6. Bars with different small letters (a, b, c, d) represent significant difference between groups (P < 0.05), and no letters or same small letters represent the difference is not significant (P > 0.05).

mRNA and Protein Expression Levels of HSPs in Small Intestine

The relative mRNA expression levels of HSPs in small intestine of broilers are shown in Figure 9. Compared to CON group, the mRNA expression levels of HSP40, HSP60, HSP70, and HSP90 in duodenum, jejunum, and ileum of broilers in ACS, CS3+ACS, and CS9+ACS groups were upregulated (P < 0.05). Meanwhile, compared to ACS group, the mRNA expression levels of HSP40 in duodenum and jejunum were upregulated and those of HSP60, HSP70, and HSP90 in duodenum and jejunum and HSP40 and HSP60 in ileum were downregulated in CS3+ACS group (P < 0.05). The mRNA expression levels of HSP40, HSP70, and HSP90 in duodenum were upregulated and those of HSP90 in jejunum and HSP60 and HSP70 in ileum were downregulated in CS9+ACS group compared to ACS group (P < 0.05).

Figure 9.

Figure 9

Open in a new tab

Relative mRNA expression of HSPs in (A) duodenum, (B) jejunum, and (C) ileum of broilers in each group. The results are expressed as “mean ± SEM,” n = 6. Bars with different small letters (a, b, c, d) represent significant difference between groups (P < 0.05), and no letters or same small letters represent the difference is not significant (P > 0.05).

The protein expression levels of HSPs in small intestine of broilers are shown in Figure 10. Compared to CON group, the protein levels of HSP70 and HSP90 in duodenum, HSP40, HSP60, and HSP70 in jejunum, and HSP90 in ileum of ACS, CS3+ACS, and CS9+ACS group, and those of HSP60 in duodenum and HSP90 in jejunum of ACS and CS9+ACS groups were increased (P < 0.05). The protein levels of HSP40 in duodenum and ileum in CS9+ACS group, HSP60 in ileum in ACS group, and HSP70 in ileum in ACS and CS3+ACS groups were increased (P < 0.05), while the protein levels of HSP40 and HSP60 in duodenum in CS3+ACS group, HSP60 in ileum in CS3+ACS and CS9+ACS groups, and HSP70 in ileum in CS9+ACS group were decreased (P < 0.05) compared to CON group. Additionally, compared to ACS group, the protein levels of all tested HSPs in small intestine in CS3+ACS group were decreased (P < 0.05) except HSP40 in jejunum and ileum and HSP90 in ileum were not differential (P > 0.05), while the protein levels of almost all HSPs in CS9+ACS group were increased (P < 0.05) except HSP60 in ileum and HSP70 in jejunum and ileum were reduced (P < 0.05).

Figure 10.

Figure 10

Open in a new tab

Protein levels of HSPs in small intestine of broilers in each group. The results are expressed as “mean ± SEM.” Bars with different small letters (a, b, c, d) represent significant difference between groups (P < 0.05), and no letters or same small letters represent the difference is not significant (P > 0.05).

DISCUSSION

Cold is a common stressor affecting growth, health, and welfare of livestock and poultry living in the northern regions of the globe. Ambient temperature below 18℃ causes cold stress response, and severe cold stress can result in tissue damage and even the death in poultry (Zhao et al., 2013; Wei et al., 2018). A growing number of studies reported that cold stress at 7℃ or 10℃ disrupts redox state and induces ROS overproduction, which causes oxidative stress and inflammatory responses, thereby leading to tissue injure in broilers (Su et al., 2019; Wei et al., 2023, 2024). Small intestine is a key intestinal segment for the digestion and absorption of nutrients and also plays an important role in the regulation of immune function in humans and animals. Previous studies have found that cold stress at 7℃ or 12℃ causes the imbalance of oxidative and antioxidative systems with increased the concentrations of MDA and H2O2 and decreased the activities of antioxidizes such as CAT, SOD, and GSH-px, and induces inflammatory injure reflected by many inflammatory cell infiltrates and upregulated expression of inflammatory factors in intestinal tissues of chickens (Zhang et al., 2011; Zhao et al., 2014; Su et al., 2018). In the present study, the concentrations of oxidative stress indicators MDA and H2O2 were increased and the activities of antioxidizes CAT, SOD, and GSH-px were reduced in small intestine in all ACS-broilers, indicating that cold stress caused oxidative stress in intestine of broilers.

Oxidative stress is a major event contributes to inflammatory response through the activation of NF-κB signaling pathway and various proinflammatory cytokines (Bi et al., 2023; Li et al., 2023). TLRs are a family of receptors mainly mediating the release of some cytokines, including TNF-α and IL-1β (Akira et al., 2001). Among TLRs, TLR4 is widely distinguished and studied, it can be activated by stimuli and endogenous molecules during tissue injure and induces inflammatory cascade by stimulating its downstream coupled gene MyD88. Subsequently, activated MyD88 mediates the expression of NF-κB, leading to the release of proinflammatory cytokines such as TNF-α, IL-6, and IL-1β (Rashidian et al., 2016). As a key nuclear transcription factor, NF-κB is generally located in the cytoplasm in an inactive state and formed a tightly bound complex with its inhibitor IκB under normal condition (Thoma and Lightfoot, 2018). When encountering with TLR4, the phosphorylation and degradation of IκB mediated by upstream regulator IKK can activate and enable NF-κB translocation from the cytoplasm to the nucleus, which promotes the transcript of NF-κB pathway downstream proinflammatory cytokines and chemokines, including TNF-α, COX-2, IL-1β, IL-2, IL-6, and so on, leading to inflammatory response through the TLR4/MyD88/NF-κB pathway (Ge et al., 2021; Liu et al., 2021; Li et al., 2023). Meanwhile, inflammation is also regulated by some cytokines. For example, the expression of TNF-α in turn can exacerbate inflammatory damage to tissues by activating the NF-κB signaling pathway (Kuwano and Hara, 2000). Therefore, the TLR4/MyD88/NF-κB signaling pathway is closely associated with inflammatory response. Many studies reported that external stimuli-caused oxidative stress results in tissue damage by activating the TLR4/MyD88/NF-κB signaling pathway, and the reduction of oxidative stress can positively feedback inhibit the TLR4/MyD88/NF-κB pathway to reduce stimuli-caused inflammatory response (Xu et al., 2021; Hussein et al., 2023; Lei et al., 2023). Besides, some studies showed that cold stress-induced oxidative stress promotes the expression of NF-κBp65, TNF-α, COX-2, iNOS, and PTGEs in heart, liver, and ileum tissues of rats and broilers, with a large amount of inflammatory cell infiltrations (Venditti et al., 2004; Su et al., 2018; Wei et al., 2023), indicating that cold stress causes inflammatory injure. In this study, overall, the mRNA and protein levels of TLR4, MyD88, and NF-κBp65, mRNA expression of TNF-α, COX-2, iNOS, and PTGEs, and protein levels of p-IκBα/IκBα, IKK, and TNF-α were increased in small intestine of all ACS-broilers, whereas their levels in CS3+ACS group were evidently lower than those in ACS group, suggesting that cold stress caused inflammatory response in small intestine of broilers via activating the TLR4/MyD88/NF-κB signaling pathway, and mild cold stimulation at 3℃ below normal rearing temperature can reduce ACS-induced inflammation by inhibiting this pathway.

Additionally, previous studies found that the activation of the TLR4/MyD88/NF-κB signaling pathway causes the imbalance of Th1/Th2 immune and promotes the development of inflammation (Kawai and Akira, 2011; Liu et al., 2021). In this pathway, activated NF-κB signal mainly performs its function in innate and adaptive immunity by mediating T-cell functional divergence and development, such as Th1 and Th2 cells (Wang et al., 2018; Hong et al., 2021). Some cytokines secreted by Th1 such as IL-1β, IL-2, IL-8, IFN-γ, and TNF-α, are proinflammatory, and Th2-secreted cytokines, including IL-4 and IL-10, play an anti-inflammatory function (Kasama et al., 2005). The imbalanced levels of Th1/Th2-derived cytokines can contribute to immunosuppression state, which causes inflammatory diseases. Studies reported that expose chickens to pollutants hydrogen sulfide, copper, and arsenic can cause the upregulation of Th1-derived cytokines IL-1β, IL-2, IL-8, IL-12, and IFN-γ and the downregulation of Th2-devived cytokines IL-4, IL6, and IL-10, leading to inflammatory immune response through the disturbance of Th1/Th2 balance with activated NF-κB signaling (Wang et al., 2018; Liu et al., 2021). Additionally, as an inflammation mediator, IL-17 produced by Th17 cells plays special roles in intestinal immunoregulation and chronic inflammation (Hundorfean et al., 2012). In this study, the expression of Th1- and Th17-secerated cytokines (IL-1β, IL-2, IL-8, IL-12, IFN-γ, and IL-17) was upregulated and that of Th2-ceserected cytokines (IL-4, IL-10, and IL-13) was downregulated in small intestine of all ACS-broilers, revealing that cold stress causes proinflammatory response and promotes a bias towards a Th1/Th17 cells-mediated immune response, which might lead to inflammation and tissue injure. However, the results of this study also showed that the expression levels of Th1/Th17-secreted cytokines were decreased and Th2-secreted cytokines were increased in CS3+ACS group in comparison to ACS group, indicating that cold stress-induced intestinal inflammatory immune response could be improved by intermittent mild cold stimulation at 3℃ below normal rearing temperature, and this mitigative effect is likely related to the inhibition of NF-κB signaling in small intestine of broilers.

Intestinal mucosal immunity provides the first defense line of the body's adaptive anti-inflammatory response, in which intestinal epithelial cells as a vital part of intestinal mucosal immunity system are the first point for communicating with foreign microorganisms and antigens (Corthesy, 2013). Mucosal immunity against foreign events is mainly due to the action of sIgA. Secretory immunoglobulin A is produced by IgA plasma cells in intestinal mucosa and it can protect intestinal function by preventing bacterial adherence and colonization on the surface of intestinal mucosa and inhibiting the entry of antigen into intestinal mucous membrane (Corthesy, 2013). Meanwhile, sIgA stimulates goblet cells to secrete mucus, thereby enhancing immune barrier function of intestinal mucosa. Thus, the levels of sIgA reflect intestinal immune function. Several studies showed that heat stress or dietary selenium deficiency affects mucosal immunity by reducing the levels of sIgA in small intestine in chickens (Chen et al., 2014; He et al., 2020). This study found that the level of sIgA was significantly reduced in small intestine in all ACS-broilers compared to CON group, whereas its level in CS3+ACS group was significantly higher than ACS and CS9+ACS groups, suggesting that acute cold stress resulted in intestinal immunosuppression, and mild cold stimulation lower 3℃ than normal rearing temperature can improve intestinal immunity via stimulating the secretion of sIgA to an extent.

HSPs are highly conserved molecular chaperones that maintain cellular functions by preventing misfolding and aggregation of nascent polypeptides and by facilitating protein folding when the organisms exposed to various stimuli (Fehrenbach and Northoff, 2001). The expression of HSPs is generally low under normal conditions, while their expression is rapidly elevated under stressful conditions. Extensive researches have showed that cold stress upregulates the expression of HSPs, including HSP40, HSP60, HSP70, and HSP90, in liver, heart, and intestine tissues of broilers, which plays a protective function on tissue damage (Wei et al., 2018; Liu et al., 2022a; Gong et al., 2023). HSPs also exert an inflammatory immune activating signal for host defense against infection or an anti-inflammatory immunosuppressive signal to prevent excessive inflammation (Muralidharan and Mandrekar, 2013). For example, the expression of HSP70 in macrophages will block LPS-caused the activation of NF-κB signal and the expression of IL-1β and TNF-α, due to HSP70 can inhibit the degradation of IκB and restrain nuclear translocation of NF-κB complex, thereby preventing inflammatory cascade through the inhibition of NF-κB signaling pathway (Dokladny et al., 2010). HSP60 is another immunomodulatory stress protein, it also can inhibit the activation of NF-κB and the secretion of TNF-α and IFN-γ in a TLRs-dependent manner, which indicates its immunosuppressive function (Zanin-Zhorov et al., 2005). Additionally, the expression of HSP40 can directly suppress the activation of IKK, culminating the inhibition of NF-κB signaling by TLR4-mediated Myd88-dependent pathway (Muralidharan and Mandrekar, 2013). In this study, the expression of HSPs (including HSP40, HSP60, HSP70, and HSP90) was evidently upregulated in small intestine of broilers exposed to ACS and cold stimulation, indicating that high expression of HSPs paly a protective role in preventing cold stress-induced intestinal inflammatory injure, and this protective effect might be associated with the inhibition of TLRs-mediated NF-κB signaling pathway.

CONCLUSIONS

This study suggests that cold stress caused oxidative stress by destroying the balance of oxidative and antioxidative defense systems, and induced inflammatory response by activating the TLR4/MyD88/NF-κB signaling pathway, thereby resulting in immune dysfunction of small intestine in broilers. However, intermittent mild cold stimulation at 3℃ below normal rearing temperature could enhance antioxidant capacity and heat shock protective response, reduce inflammation by inhibiting oxidative stress-mediated the TLR4/MyD88/NF-κB pathway, and improve intestinal immunity in cold stressed-broilers by maintaining the Th1/Th2/Th17 balance. Therefore, intermittent mild cold stimulation can alleviate cold stress-caused inflammation and immune dysfunction in small intestine of broilers via regulating the TLR4/MyD88/NF-κB signaling pathway. The results of this study reveal the underlying mechanism of intestinal inflamate-immune response in broilers induced by cold stress and alleviated effect of mild cold stimulation, which will provide the insights considering how to reduce cold stress-induced intestinal injure by other effective ways in further studies.

ACKNOWLEDGMENTS

This study was supported by the National Natural Science Foundation of China (grant number 32172785).

DISCLOSURES

The authors confirm that there are no conflicts of interest.

REFERENCES

  1. Abdullah S.S., Masood S., Zaneb H., Rabban I., Akba J., Kuthu Z.H. Effects of Copper nanoparticle supplementation on growth, intestinal morphology and antioxidant status in broilers exposed to cyclic cold stress. Emir. J. Food Agric. 2022;34:436–445. [Google Scholar]
  2. Akira S., Takeda K., Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2001;2:675–680. doi: 10.1038/90609. [DOI] [PubMed] [Google Scholar]
  3. Aminoroaya K., Sadeghi A.A., Ansari-Pirsaraei Z., Kashan N. Effect of cyclical cold stress during embryonic development on aspects of physiological responses and HSP70 gene expression of chicks. J. Therm. Biol. 2016;61:50–54. doi: 10.1016/j.jtherbio.2016.08.008. [DOI] [PubMed] [Google Scholar]
  4. Bahadoran S., Hassanpour H., Arab S., Abbasnia S., Kiani A. Changes in the expression of cardiac genes responsive to thyroid hormones in the chickens with cold-induced pulmonary hypertension. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bi Y., Li X., Wei H., Xu S. Resveratrol improves emamectin benzoate-induced pyroptosis and inflammation of Ctenopharyngodon idellus hepatic cells by alleviating oxidative stress/endoplasmic reticulum stress. Fish Shellfish Immunol. 2023;142 doi: 10.1016/j.fsi.2023.109148. [DOI] [PubMed] [Google Scholar]
  6. Chen Z., Xie J., Wang B., Tang J. Effect of γ-aminobutyric acid on digestive enzymes, absorption function, and immune function of intestinal mucosa in heat-stressed chicken. Poult. Sci. 2014;93:2490–2500. doi: 10.3382/ps.2013-03398. [DOI] [PubMed] [Google Scholar]
  7. Corthesy B. Role of secretory IgA in infection and maintenance of homeostasis. Autoimmun. Rev. 2013;12:661–665. doi: 10.1016/j.autrev.2012.10.012. [DOI] [PubMed] [Google Scholar]
  8. Dokladny K., Lobb R., Wharton W., Ma T.Y., Moseley P.L. LPS-induced cytokine levels are repressed by elevated expression of HSP70 in rats: possible role of NF-κB. Cell Stress Chaperones. 2010;15:153–163. doi: 10.1007/s12192-009-0129-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Fehrenbach E., Northoff H. Free radicals, exercise, apoptosis, and heat shock proteins. Exerc. Immunol. Rev. 2001;7:66–89. [PubMed] [Google Scholar]
  10. Fu Y., Zhang S., Zhao N., Xing L., Li T., Liu X., Bao J., Li J. Effect of mild intermittent cold stimulation on thymus immune function in broilers. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.102073. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ge J., Guo K., Zhang C., Talukder M., Lv M.W., Li J.Y., Li J.L. Comparison of nanoparticle-selenium, selenium-enriched yeast and sodium selenite on the alleviation of cadmium-induced inflammation via NF-kB/IκB pathway in heart. Sci. Total Environ. 2021;773 doi: 10.1016/j.scitotenv.2021.145442. [DOI] [PubMed] [Google Scholar]
  12. Goel A., Ncho C.M., Choi Y.H. Regulation of gene expression in chickens by heat stress. J. Anim. Sci. Biotechnol. 2021;12:1–13. doi: 10.1186/s40104-020-00523-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Golozoubova V., Hohtola E.S.A., Matthias A., Jacobsson A., Cannon B., Nedergaard J.A.N. Only UCP1 can mediate adaptive nonshivering thermogenesis in the cold. FASEB J. 2001;15:2048–2050. doi: 10.1096/fj.00-0536fje. [DOI] [PubMed] [Google Scholar]
  14. Gong R., Xing L., Yin J., Ding Y., Liu X., Bao J., Li J. Appropriate cold stimulation changes energy distribution to improve stress resistance in broilers. J. Anim. Sci. 2023;101:skad185. doi: 10.1093/jas/skad185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hangalapura B.N., Nieuwland M.G.B., Buyse J., Kemp B., Parmentier H.K. Effect of duration of cold stress on plasma adrenal and thyroid hormone levels and immune responses in chicken lines divergently selected for antibody responses. Poult. Sci. 2004;83:1644–1649. doi: 10.1093/ps/83.10.1644. [DOI] [PubMed] [Google Scholar]
  16. He X., Lin Y., Lian S., Sun D., Guo D., Wang J., Wu R. Selenium deficiency in chickens induces intestinal mucosal injury by affecting the mucosa morphology, SIgA secretion, and GSH-Px activity. Biol. Trace Elem. Res. 2020;197:660–666. doi: 10.1007/s12011-019-02017-6. [DOI] [PubMed] [Google Scholar]
  17. Hong Y., Lee J., Vu T.H., Lee S., Lillehoj H.S., Hong Y.H. Exosomes of lipopolysaccharide-stimulated chicken macrophages modulate immune response through the MyD88/NF-κB signaling pathway. Dev. Comp. Immunol. 2021;115 doi: 10.1016/j.dci.2020.103908. [DOI] [PubMed] [Google Scholar]
  18. Hundorfean G., Neurath M.F., Mudter J. Functional relevance of T helper 17 (Th17) cells and the IL-17 cytokine family in inflammatory bowel disease. Inflamm. Bowel Dis. 2012;18:180–186. doi: 10.1002/ibd.21677. [DOI] [PubMed] [Google Scholar]
  19. Hussein S., Kamel G.A.M. Pioglitazone ameliorates cisplatin-induced testicular toxicity by attenuating oxidative stress and inflammation via TLR4/MyD88/NF-κB signaling pathway. J. Trace Elem. Med. Biol. 2023;80 doi: 10.1016/j.jtemb.2023.127287. [DOI] [PubMed] [Google Scholar]
  20. Ipek A., Sahan U. Effects of cold stress on broiler performance and ascites susceptibility. Asian-Australas. J. Anim. Sci. 2006;19:734–738. [Google Scholar]
  21. Kasama T., Miwa Y., Isozaki T., Odai T., Adachi M., Kunkel S.L. Neutrophil-derived cytokines: potential therapeutic targets in inflammation. Curr. Drug Targets Inflamm. Allergy. 2005;4:273–279. doi: 10.2174/1568010054022114. [DOI] [PubMed] [Google Scholar]
  22. Kawai T., Akira S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity. Immunity. 2011;34:637–650. doi: 10.1016/j.immuni.2011.05.006. [DOI] [PubMed] [Google Scholar]
  23. Kuwano K., Hara N. Signal transduction pathways of apoptosis and inflammation induced by the tumor necrosis factor receptor family. Am. J. Respir. Cell Mol. Biol. 2000;22:147–149. doi: 10.1165/ajrcmb.22.2.f178. [DOI] [PubMed] [Google Scholar]
  24. Lei Y., Xu T., Sun W., Wang X., Gao M., Lin H. Evodiamine alleviates DEHP-induced hepatocyte pyroptosis, necroptosis and immunosuppression in grass carp through ROS-regulated TLR4/MyD88/NF-κB pathway. Fish Shellfish Immunol. 2023;140 doi: 10.1016/j.fsi.2023.108995. [DOI] [PubMed] [Google Scholar]
  25. Li X., Bai Y., Bi Y., Wu Q., Xu S. Baicalin suppressed necroptosis and inflammation against chlorpyrifos toxicity; involving in ER stress and oxidative stress in carp gills. Fish Shellfish Immunol. 2023;140 doi: 10.1016/j.fsi.2023.108883. [DOI] [PubMed] [Google Scholar]
  26. Liu X., Li S., Zhao N., Xing L., Gong R., Li T., Zhang S., Li J., Bao J. Effects of acute cold stress after intermittent cold stimulation on immune-related molecules, intestinal barrier genes, and heat shock proteins in broiler ileum. Animals. 2022;12:3260. doi: 10.3390/ani12233260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liu Z.N., Wu X., Fang Q., Li Z.X., Xia G.Q., Cai J.N., Lv X.W. CD73 attenuates alcohol-induced liver injury and inflammation via blocking TLR4/MyD88/NF-κB signaling pathway. J. Inflamm. Res. 2022;15:53–70. doi: 10.2147/JIR.S341680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Liu X., Qiu S., Chen G., Liu M. Myrtenol alleviates oxidative stress and inflammation in diabetic pregnant rats via TLR4/MyD88/NF-κB signaling pathway. J. Biochem. Mol. Toxicol. 2021;35:e22904. doi: 10.1002/jbt.22904. [DOI] [PubMed] [Google Scholar]
  29. Muralidharan S., Mandrekar P. Cellular stress response and innate immune signaling: integrating pathways in host defense and inflammation. J. Leukoc. Biol. 2013;94:1167–1184. doi: 10.1189/jlb.0313153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nemati M.H., Shahir M.H., Harakinezhad M.T., Lotfalhian H. Cold-induced ascites in broilers: effects of vitamin C and coenzyme Q10. Braz. J. Poult. Sci. 2017;19:537–544. [Google Scholar]
  31. Qureshi S., Khan H.M., Mir M.S., Raja T.A., Khan A.A., Ali H., Adil S. Effect of cold stress and various suitable remedies on performance of broiler chicken. J. Worlds Poult. Res. 2018;8:66–73. [Google Scholar]
  32. Rahmani M., Golian A., Kermanshahi H., Bassami M.R. Effects of curcumin or nanocurcumin on blood biochemical parameters, intestinal morphology and microbial population of broiler chickens reared under normal and cold stress conditions. J. Appl. Anim. Res. 2018;46:200–209. [Google Scholar]
  33. Rashidian A., Muhammadnejad A., Dehpour A.R., Mehr S.E., Akhavan M.M., Shirkoohi R., Chamanara M., Mousavi S., Rezayat S.M. Atorvastatin attenuates TNBS-induced rat colitis: the involvement of the TLR4/NF-kB signaling pathway. Inflammopharmacology. 2016;24:109–118. doi: 10.1007/s10787-016-0263-6. [DOI] [PubMed] [Google Scholar]
  34. Su Y., Wei H., Bi Y., Wang Y., Zhao P., Zhang R., Li X., Li J., Bao J. Pre-cold acclimation improves the immune function of trachea and resistance to cold stress in broilers. J. Cell. Physiol. 2019;234:7198–7212. doi: 10.1002/jcp.27473. [DOI] [PubMed] [Google Scholar]
  35. Su Y., Zhang X., Xin H., Li S., Li J., Zhang R., Li X., Li J., Bao J. Effects of prior cold stimulation on inflammatory and immune regulation in ileum of cold-stressed broilers. Poult. Sci. 2018;97:4228–4237. doi: 10.3382/ps/pey308. [DOI] [PubMed] [Google Scholar]
  36. Thoma A., Lightfoot A.P. In: Pages 267-279 in Advances in Experimental Medicine and Biology. Xiao J., editor. Springer; Singapore: 2018. NF-kB and inflammatory cytokine signalling: role in skeletal muscle atrophy. [DOI] [PubMed] [Google Scholar]
  37. Venditti P., De Rosa R., Di Meo S. Effect of cold-induced hyperthyroidism on H2O2 production and susceptibility to stress conditions of rat liver mitochondria. Free Radic. Biol. Med. 2004;36:348–358. doi: 10.1016/j.freeradbiomed.2003.11.012. [DOI] [PubMed] [Google Scholar]
  38. Wang Y., Zhao H., Liu J., Shao Y., Li J., Luo L., Xing M. Copper and arsenic-induced oxidative stress and immune imbalance are associated with activation of heat shock proteins in chicken intestines. Int. Immunopharmacol. 2018;60:64–75. doi: 10.1016/j.intimp.2018.04.038. [DOI] [PubMed] [Google Scholar]
  39. Wei H., Li T., Zhang Y., Liu X., Gong R., Bao J., Li J. Cold stimulation causes oxidative stress, inflammatory response and apoptosis in broiler heart via regulating Nrf2/HO-1 and NF-κB pathway. J. Therm. Biol. 2023;116 doi: 10.1016/j.jtherbio.2023.103658. [DOI] [PubMed] [Google Scholar]
  40. Wei H., Zhang R., Su Y., Bi Y., Li X., Zhang X., Li J., Bao J. Effects of acute cold stress after long-term cold stimulation on antioxidant status, heat shock proteins, inflammation and immune cytokines in broiler heart. Front. Physiol. 2018;9:1589. doi: 10.3389/fphys.2018.01589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Wei H., Zhang Y., Li T., Zhang S., Yin J., Liu Y., Xing L., Bao J., Li J. Intermittent mild cold stimulation alleviates cold stress-induced pulmonary fibrosis by inhibiting the TGF-β1/Smad signaling pathway in broilers. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2023.103246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Xing L., Li T., Zhang Y., Bao J., Wei H., Li J. Intermittent and mild cold stimulation maintains immune function stability through increasing the levels of intestinal barrier genes of broilers. Animals. 2023;13:2138. doi: 10.3390/ani13132138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Xu L., Huang Q., Tan X., Zhao Q., Wu J., Liao H., Ai W., Liu Y., Lai Z., Fu L. Patchouli alcohol ameliorates acute liver injury via inhibiting oxidative stress and gut-origin LPS leakage in rats. Int. Immunopharmacol. 2021;98 doi: 10.1016/j.intimp.2021.107897. [DOI] [PubMed] [Google Scholar]
  44. Zanin-Zhorov A., Bruck R., Tal G., Oren S., Aeed H., Hershkoviz R., Cohen I., Lider O. Heat shock protein 60 inhibits Th1-mediated hepatitis model via innate regulation of Th1/Th2 transcription factors and cytokines. J. Immunol. 2005;174:3227–3236. doi: 10.4049/jimmunol.174.6.3227. [DOI] [PubMed] [Google Scholar]
  45. Zhang S., Gong R., Zhao N., Zhang Y., Xing L., Liu X., Bao J., Li J. Effect of intermittent mild cold stimulation on intestinal immune function and the anti-stress ability of broilers. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zhang X., Zhao Q., Wen L., Wu C., Yao Z., Yan Z., Li R., Chen L., Chen F., Xie Z., Chen F., Xie Q. The effect of the antimicrobial peptide plectasin on the growth performance, intestinal health, and immune function of yellow-feathered chickens. Front. Vet. Sci. 2021;8 doi: 10.3389/fvets.2021.688611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Zhang Z.W., Lv Z.H., Li J.L., Li S., Xu S.W., Wang X.L. Effects of cold stress on nitric oxide in duodenum of chicks. Poult. Sci. 2011;90:1555–1561. doi: 10.3382/ps.2010-01333. [DOI] [PubMed] [Google Scholar]
  48. Zhao F.Q., Zhang Z.W., Yao H.D., Wang L.L., Liu T., Yu X.Y., Li S., Xu S.W. Effects of cold stress on mRNA expression of immunoglobulin and cytokine in the small intestine of broilers. Res. Vet. Sci. 2013;95:146–155. doi: 10.1016/j.rvsc.2013.01.021. [DOI] [PubMed] [Google Scholar]
  49. Zhao F.Q., Zhang Z.W., Qu J.P., Yao H.D., Li M., Li S., Xu S.W. Cold stress induces antioxidants and HSPs in chicken immune organs. Cell Stress Chaperones. 2014;19:635–648. doi: 10.1007/s12192-013-0489-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Zhou H.J., Kong L.L., Zhu L.X., Hu X.Y., Busye J., Song Z.G. Effects of cold stress on growth performance, serum biochemistry, intestinal barrier molecules, and adenosine monophosphate-activated protein kinase in broilers. Animal. 2021;15 doi: 10.1016/j.animal.2020.100138. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES