Skip to main content
Heliyon logoLink to Heliyon
. 2024 Mar 19;10(6):e28172. doi: 10.1016/j.heliyon.2024.e28172

MTCH2 stimulates cellular proliferation and cycles via PI3K/Akt pathway in breast cancer

Wenying Jiang a,b,1, Yuxia Miao c,1, Xiaoxiao Xing d, Shuiqing Liu d, Wei Xing a,⁎⁎, Feng Qian d,e,
PMCID: PMC10979243  PMID: 38560664

Abstract

The MTCH2 protein is located on the mitochondrial outer membrane and regulates mitochondria-related cell death. This study set out to investigate the role of MTCH2 in the underlying pathophysiological mechanisms of breast cancer (BC). MTCH2 expression levels in BC were analyzed using bioinformatics prior to verification by cell lines in vitro. Experiments of over-expression and siRNA-mediated knockdown of MTCH2 were conducted to assess its biological functions, including its effects on cellular proliferation and cycle progression. Xenografts were utilised for in vivo study and signaling pathway alterations were examined to identify the mechanisms driven by MTCH2 in BC proliferation and cell-cycle regulation. MTCH2 was up-regulated in BC and correlated with patients’ overall survival. Over-expression of MTCH2 promoted cellular proliferation and cycle progression, while silencing MTCH2 had the opposite effect. Xenograft experiments were utilised to confirm the in vitro cellular findings and it was identified that the PI3K/Akt signaling pathway was activated by MTCH2 over-expression and suppressed by its silencing. Moreover, the activation of IGF-1R rescued cellular growth and cycle arrest induced by MTCH2-silencing. Overall, this study reveals that expression of MTCH2 in BC is upregulated and potentiates cellular proliferation and cycle progression via the PI3K/Akt pathway.

Keywords: Breast cancer, MTCH2, Cellular proliferation, Cell cycle, PI3K/Akt pathway

1. Introduction

Breast cancer (BC) accounts for nearly 30% of cancers identified in women, and its incidence is still increasing by 0.5% each year, partially due to increased body weight [1,2]. Although targeted therapy is now available, advanced BC with metastasis remains near incurable, and was the cause of 684,996 deaths in 2020 [1]. Currently, emphasis is placed on biologically-directed individualized therapy, such as PI3K/Akt pathway inhibitors [3], which requires information regarding the pathogenesis and development of BC in patients.

Mitochondrial carrier homolog2 (MTCH2) has been reported to be associated with several malignant tumors, including BC. MTCH2 is also known as Met-induced mitochondrial protein (MIMP) and inhibits Met-HGF/SF induced scattering and tumorigenicity by altering Met-HGF/SF signaling pathways [4]. In malignant glioma, inhibition of MTCH2 suppresses tumor invasion and enhances sensitivity to temozolomide [5]. Suppression of MTCH2 was identified to provoke ErbB2-driven BC [6]. However, the role and underlying mechanisms of MTCH2 in BC remain largely unknown.

The PI3K/Akt pathway plays a pivotal role in the regulation of cell survival and proliferation [7]. The inhibition of Bid expression by Akt results in resistance to apoptosis in ovarian cancer cells [8]. Meanwhile, MTCH2/MIMP is a major facilitator of tBID recruitment to mitochondria. Hence, the PI3K/Akt pathway may be associated with expression of MTCH2 [9].

In this investigation, the expression of MTCH2 in BC was observed to be upregulated. Furthermore, we identified that MTCH2 potentiates cellular proliferation and cycle progression via the PI3K/Akt pathway.

2. Materials and methods

2.1. Data mining in GEO and TCGA datasets

Four relevant gene expression datasets were retrieved from GEO (https://www.ncbi.nlm.nih.gov/geo): GSE7377, GSE54002, GSE45827 and GSE26459. RNA-seq data from the TCGA-BRCA project were extracted from the Genomic Data Commons (https://portal.gdc.cancer.gov/). For those genes requiring multiple probes, the expression level was referred to as the maximum. Standardization according to percentiles was conducted if necessary. Enrichment analysis of gene ontology (GO) and KEGG analysis of DEGs were performed using the clusterProfiler R package (v 3.12.0). Terms with P < 0.01, minimum count>3, and enrichment factor >1.5 were assigned as statistically significant [10]. Gene set enrichment analysis (GSEA) was employed to compare high and low groups, cut by the medium of expression level. The dataset used for GSEA is TCGA-BRCA. The analysis was processed by the clusterProfiler R package [10], with c2.cp.v7.0.symbols of MSigDB Collections being used as the reference gene sets [11].

2.2. Cell lines and culture

Cell lines, MCF 10A (RRID:CVCL_0598), MDA-MB-231 (RRID:CVCL_0062), BT474 (RRID:CVCL_0179), MCF-7 (RRID:CVCL_0031) and T-47D (RRID:CVCL_0553), were purchased from American Type Culture Collection (ATCC, Manassas, US) and maintained in MCF 10A special medium (Procell, Wuhan, China), DMEM (Kccell, Shijiazhuang, China) +10% fetal bovine serum (FBS, WISENT, Nanjing, China) +1% double antibiotics (penicillin and streptomycin, P/S, NCM Biotech, Suzhou, China), RPMI-1640 (Procell) +20% FBS + 1% P/S and RPMI-1640 + 10% FBS + 1% P/S, respectively, in humidified air at 37 °C with 5% CO2.

2.3. Construction of the lentivirus and cell transfection

A lentivirus system encoding shRNA targeting the MTCH2 mRNA sequence was employed: MTCH2-1 5′-GATCCGCCATACATAGTGTTCCTTGTCTCGAGACAAGGAACACTATGTATGGCTTTTTG-3′ and MTCH2-2 5′- GATCCGCCCACTACACTTGCCAAATTCTCGAGAATTTGGCAAGTGTAGTGGGCTTTTTG-3′ and were cloned into pLVX-shRNA2-puro (Ourui, Changsha, China). For the MTCH2 overexpression plasmid, cDNA was synthesized and cloned into pLVX-IRES- ZsGreen1(Ourui) before being verified by DNA sequencing. The pLVX-shMTCH2-1-puro pLVX-shMTCH2-2-puro or pLVX-IRES-ZsGreen1-MTCH2 plasmids were transfected into 293 T cells using Lipofectamine 2000 (ThermoFisher, US) before the lentivirus particles in the supernatant were retrieved. T-47D and MCF-7 cells (1*106 cells/well) were infected with lentivirus encoding shRNA or overexpressing MTCH2 at the multiplicity of infection (MOI) of 50 or 30, respectively.

2.4. Quantitative RT-PCR

After the total RNA of aforementioned cell lines (5 original ones and 2 lentivirus infected ones) was isolated using Trizol (Thermo Fisher Scientific, Waltham, US), cDNAs were generated from 2 μg RNA samples using a reverse transcription kit (Genecopoeia, Guangzhou, China). Sequencing by RT-PCR was performed at 95 °C for 2 min initial degeneration, then 40 cycles of 95 °C for 15 s degeneration, followed by 60–68 °C for 30 s of annealing and extension. The primers designed to match MTCH2 mRNA for the RT-PCR were forward: CATGTACGTGAAAGTGCTCATCC and reverse: TCACTCTCCTGGTAATGCTGT. Quantifications were normalized using GAPDH as an internal reference and results were calculated via the 2−ΔΔCT method [12].

2.5. Western blotting (WB)

For WB, cell lysates of were processed with RIPA lysis buffer: 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate [SDS], sodium orthovanadate, sodium fluoride, EDTA, leupeptin (Beyotime, Shanghai, China, https://m.beyotime.com/mobilegoods.do?method=code&code=P0013B). When detecting phosphorylation status, a cocktail of protease inhibitors and phosphatase inhibitors were included in the RIPA lysis buffer, which contained 100 mM AEBSF, 15 μM Aprotinin, 6.5 mM Bestatin, 0.7 mM E64 and 0.5 mM Leupeptin in DMSO, and 250 mM sodium fluoride, 50 mM sodium pyrophosphate, 50 mM β-glycerophosphate and 100 mM sodium orthovanadate in H2O, respectively (https://m.beyotime.com/mobilegoods.do?method=code&code=P1045).

Supernatants were collected and protein levels were quantified using a BCA Protein quantification kit (Beyotime). Protein lysates were fractionated by 8%, 10% or 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, Beyotime) and transferred to polyvinylidene difluoride membranes (PVDF, Millipore, US). The membranes were blocked and incubated with primary antibodies (1:1000, Proteintech, Wuhan, China) over night at 4 °C. The following antibodies were used: MTCH2 Antibody (Proteintech Cat# 16888-1-AP, RRID:AB_2266733), PCNA Antibody (Proteintech Cat# 10205-2-AP, RRID:AB_2160330), MCM2 Antibody (Proteintech Cat# 10513-1-AP, RRID:AB_2142131), CDK1 Antibody (Proteintech Cat# 19532-1-AP, RRID:AB_10638617), CDK6 Antibody (Proteintech Cat# 14052-1-AP, RRID:AB_10642144), p-AKT Antibody (Proteintech Cat# 66444-1-Ig, RRID:AB_2782958), AKT Antibody (Proteintech Cat# 10176-2-AP, RRID:AB_2224574), PI3K Antibody (Abcam Cat# ab32089, RRID:AB_777254), p-PI3K Antibody (Cell Signaling Technology Cat# 4228, RRID:AB_659940) and GAPDH (Proteintech Cat# 10494-1-AP, RRID:AB_2263076). For the phospho-specific antibodies, phosphorylated residues of Ser473 and p85 (Tyr458)/p55 (Tyr199) were the targets of anti-p-AKT and anti-p-PI3K antibodies.

After three washes with TBST, the membranes were incubated with anti-rabbit IgG (1:1000, CST, US) for 2 h at room temperature. The blot bands were visualized with an enhanced chemiluminescence detection (ECL) kit (Xinsaimei, Soochow, China) and imaged using a chemiluminescent imaging system (Tanon, Shanghai, China). The band intensities were analyzed using ImageJ software. The background grayscale level was set with a default value of 50. The desired measurements were typically area, mean gray value and integrated density. The rectangular selection tool was used to carefully outline each band of interest. By comparing the intensity of the target protein band to that of the internal control band, the relative expression level of the target protein can be determined.

2.6. Cell counting kit-8 (CCK-8) assay

To test cellular viability, cells were seeded in 96-well plates at 2*104 cells/well, with 3 repeat wells per group. At 0, 24, 48, 72 h, 10 μl CCK-8 (Sigma, US) was added to each well. After another 2 h’ incubation in CO2, the optical density (OD) of the absorbance at 450 nm was measured using a multifunctional microplate reader (PerkinElmer, US).

2.7. Flow cytometry (FCM) for cellular cycle assay

Cells were digested by trypsin (NCM Biotech, Soochow, China), washed with cold PBS (Gibco, US) and re-suspended. Next, cells were fixed with ethyl alcohol at 4 °C for 24 h. After being washed with cold PBS and centrifuged again, cells were stained with 500 μl propidium iodide staining solution (PI, Beyotime, Shanghai, China) before being scanned by flow cytometry (ACEA Biosciences, Hangzhou, China) within 24 h. Red fluorescence was examined at 488 nm excitation wavelength in addition to laser scattering.

2.8. Xenograft model of tumor growth model

Twenty-four female BALB/c nude mice at 5–6 weeks of age were acquired from Hunan SJA Laboratory Animal Co., Ltd. (Changsha, China) and bred in laboratory conditions. All animal-relevant procedures were approved by the Animal Experiments Ethics Committee of our University. Nude mice were subcutaneously injected into the right flank with tumor cells (5*106 cells/ml, 100 μl cell suspension).

Considering that Lentiviral transfection itself may have an effect on cell proliferation, it was important to have a control group without lentiviral transfection in the experiments enable distinction between the effect of lentiviral transfection itself on cell proliferation and the effect of MTCH2 gene expression on cell proliferation. Therefore, mice were assigned into 4 groups of 6 mice per group: MCF-7+LV-NC, MCF-7+LV-MTCH2 OE, MCF-7+LV-shNC, and MCF-7+LV-shMTCH2. Beginning on the 8th day, the length and width of subcutaneous tumor volumes were monitored every 4 subsequent days. The size of the tumors were calculated as follows: volume (cm3) = 0.5*length*width2.

After all mice were euthanized at day 24 after implantation, tumors were dissected and weighed prior to further evaluation of the expression of MTCH2 by WB. Finally, tumor tissues were fixed, embedded in paraffin and sectioned for immunohistochemical (IHC) staining by antibodies anti-Ki67, PCNA, CDK1 and 6 (Proteintech, Wuhan, China).

2.9. Statistics

The comparison between two groups was performed using a t-test, while comparisons between multiple groups were undertaken by one-way analysis of variance (ANOVA) followed by Dunnett’s test. The Wilcoxon rank sum test was used to compare MTCH2 expression levels between subgroup samples. R (v3.6.3) was used for bio-informatics, plots and statistics. P < 0.05 was considered statistically significant.

3. Results

3.1. MTCH2 expression is upregulated and related to survival in BC

According to GSE7377, GSE54002, GSE45827 and TCGA-BRCA, the expression levels of MTCH2 were up-regulated in hyperplastic enlarged ducts and tumorous tissues (P < 0.001, Fig. 1A–D). Moreover, MTCH2 expression levels were higher in Tamoxifen resistant cell lines than their counterparts (P < 0.001, Fig. 1E). Investigating TCGA-BRCA OS data of 1104 BC patients, MTCH2 was observed to be significantly associated with OS in BC patients (HR = 1.1393, P = 0.039, Fig. 1F).

Fig. 1.

Fig. 1

Box plots of MTCH2 expression levels and Kaplan-Meier curves for OS: (A) GSE7377, (B) GSE54002, (C) GSE45827, (D) TCGA-BRCA, (E) GSE26459; (F) TCGA-BRCA, (G) microarray data of BC patients, (H) the luminal A subtype, (I) the luminal B subtype, (J) the Her2+ subtype, and (K) the basal subtype. Abbreviations: OS, overall survival.

The survival difference of MTCH2 on microarray data (https://kmplot.com/) of BC patients were depicted. The survival rate of the MTCH2high group was significantly lower than that of the low-expression group (HR = 1.621, P < 10−16, Fig. 1G). Subgroup analysis of different molecular types were also conduct. The survival rate of the group with high MTCH2 expression was significantly lower in the Luminal A, B and Her2+ subtypes than in the low-expression group (HR = 1.52, 1.31, and 1.47, P = 0.00017, 0.0023, and 0.0019, Fig. 1H–J), which were not significant in the basal subtype (P = 0.063, Fig. 1K).

3.2. MTCH2 expression is upregulated in BC cell lines

To investigate the role of MTCH2 in BC as indicated by bio-informatics, its expression was detected by qPCR and WB. Compared to the normal breast epithelial cell line MCF10A, cancerous T-47D was associated with the highest level (P < 0.0001), while the levels of MTCH2 in MCF-7 samples were not significantly different from healthy tissue (P = 0.4625, Fig. 2A–C). Although BT474 and MDA-MB-231 cells also expressed more MTCH2 compared to MCF10A (P < 0.01 and <0.05), T-47D and MCF-7 were chosen for RNAi and overexpression manipulation, respectively. The subsequent silencing and overexpressing efficiency was confirmed via qPCR and WB (Fig. 2D–F).

Fig. 2.

Fig. 2

MTCH2 expression was upregulated in BC cell lines: (A) qPCR, (B) Western blot and (C) quantitation of Western blot band intensities; It was successfully suppressed and activated by corresponding lentiviral systems: (C) qPCR, (D) Western blot and (F) quantitation of Western blot band intensities.

3.3. MTCH2 escalates cellular proliferation and cycle progression in vitro

To explore the role MTCH2 plays in BC tumorigenesis, a CCK-8 assay was employed to observe cell viability in vitro. As revealed in Fig. 3A, overexpression of MTCH2 stimulated cellular proliferation, whereas silencing significantly suppressed cellular proliferation (Fig. 3B). Subsequently, FCM revealed that MTCH2 overexpression promoted G1/S phase transition (P < 0.0001, Fig. 3C–E), while its silencing arrested T-47D at the G0/1 phase (P < 0.0001, Fig. 3F–I). Moreover, markers of cellular proliferation and cycle, MCM2, PCNA, Cyclin E1 and CDK2, were observed by WB as being up-regulated in MTCH2-overexpressing MCF-7 and suppressed in MTCH2-silenced T-47D lines (Fig. 3J).

Fig. 3.

Fig. 3

MTCH2 promotes cellular growth and cycle progression. CCK-8 assay revealed increased cell viability in MTCH2 overexpressing cell lines (A), and suppressed in silenced cells (B); The represented graph of cell cycle analysis by PI staining and flow cytometry (C–E), transition was arrested in silenced cells (F–I). MCM2, PCNA, Cyclin E1 and CDK2 were up-regulated in MTCH2-overexpressing cells and suppressed in MTCH2-silenced lines (J). Abbreviations: CCK-8, cell counting kit-8; PI, propidium iodide.

3.4. MTCH2 escalates cellular proliferation and cycle progression in vivo

In-vitro cellular experiments were further verified by xenograft models. Mice were divided into 2 paired groups: MCF-7+LV-MTCH2 OE vs MCF-7+LV-NC, and MCF-7+LV-shMTCH2 vs MCF-7+LV-shNC. As illustrated in Fig. 4A&B all nude mice had observable solid tumors at the injection loci. It was clear that overexpression of MTCH2 promoted tumor growth (Fig. 4C), while its silencing suppressed tumor growth (Fig. 4D); these findings were confirmed by measurements depicted in Fig. 4E–G (P < 0.001, <0.001, = 0.0048, 0.0039, respectively). The size and weight of tumors in the overexpression group were 3.085 and 2.253 times of the ones in the control group, respectively. Meanwhile, the size and weight of tumors in the silencing group were 0.319 and 0.213 times of those in the control group, respectively. Moreover, the volume and weight of the tumors in the MCF-7+LV-sh-NC group were found to be larger than those in the MCF-7+LV-NC group.

Fig. 4.

Fig. 4

Xenografts in nude mice. Compared to the control group on the right side, overexpression of MTCH2 promoted tumor growth (A&C); silencing of MTCH2 suppressed tumor growth (B&D). Volumes of xenograft tumors were up and down regulated by MTCH2 over-expression and silencing, respectively (E&F). Weights were also up and down regulated by MTCH2 over-expression and silencing (G). (H&I) Protein levels of MTCH2 were confirmed by Western blot in over-expression and silenced models. (J) Immunohistochemical for biomarkers of cellular proliferation and cycle. Scale bar, 100 μm.

For molecular dissection, WB was utilised to confirm the corresponding levels of MTCH2 protein in over-expression and silencing models (Fig. 4H&I). Furthermore, IHC was applied for analysis of biomarkers of cellular proliferation and cycling (Ki67, PCNA, CDK1 and 6), all of which demonstrated up or down -regulation in models of over-expression or silencing, respectively (Fig. 4J). Collectively, these data corroborated in vivo our hypothesis that MTCH2 plays an essential role in cellular proliferation and cycle regulation in BC.

3.5. MTCH2 exerts its oncogenic role in BC via PI3K/Akt pathway

GSEA revealed that the PI3K/Akt pathway, G2M checkpoint and DNA repair were activated by MTCH2, while the early estrogen response and p53 pathways were suppressed (Fig. 5A&B). To elucidate the underlying mechanism of MTCH2 in BC, as indicated by GSEA analysis, the PI3K/Akt pathway was examined for its involvement in the MTCH2-induced adjustment of proliferation. As revealed by WB, phosphorylation of PI3K and Akt were enhanced in the MTCH2 over-expressing MCF-7 line and suppressed by MTCH2 silencing in the T-47D line (Fig. 5C&D).

Fig. 5.

Fig. 5

MTCH2 activates the PI3K/Akt pathway: (A&B) Gene set enrichment analysis; (C&D) Phosphorylation of PI3K and Akt were enhanced with MTCH2 over-expression and inhibited with MTCH2 silencing.

According to published study, insulin-like growth factor-1 receptor (IGF-1R) activates PI3K/Akt signaling [13]. Therefore, IGF-1R was employed as an activator of PI3K/Akt signaling, to further test the vital role of the PI3K/Akt signaling pathway in MTCH2’s tumorigenesis. As such, the CCK-8 assay was employed to characterize T-47D cells overexpressing IGF-1R and revealed rescuing of the anti-proliferative effect of MTCH2 silencing (Fig. 6A). These findings were further confirmed by FCM analysis of MTCH2 silenced T-47D arrested at the G0/1 phase, a state that could be rescued by IGF-1R overexpression (Fig. 6B–E). Altogether, these data provided concrete evidence that MTCH2 induces cellular proliferation and cycle progression in BC via activation of the PI3K/Akt pathway. Schematic diagram of the molecular mechanism was shown in Fig. 6F.

Fig. 6.

Fig. 6

(A) CCK-8 assay indicates that the PI3K/Akt pathway activator IGF-1R rescued the anti-proliferative effect of MTCH2 silencing; the significance of differences between groups were evaluated with t-test. (B–E) Represented grapes of cell cycle analysis by PI staining and flow cytometry, (F) Schematic summarizing the connections between MTCH2, PI3K/Akt, IGF-1R and cell cycle regulation. Abbreviations: CCK-8, cell counting kit-8; PI, propidium iodide.

4. Discussion

Precision oncology relies on the knowledge of genetic alterations in patients to guide targeted therapy. Proteins and pathways currently considered to be involved in BC in clinical practice include the estrogen receptor (ER), progesterone receptor (PR), HER2, Cyclin-dependent kinase 4 and 6 (CDK4/6), poly-ADP-ribose-polymerase (PARP), histone deacetylase (HDAC) and PI3K/Akt/mTOR signaling pathways. Globally, 20–30% of incurable breast cancer cases with distant metastasis call for novel candidates from different aspects of cancer cell pathophysiology.

Mitochondria act as power generators in healthy cells and serve as a storage compartment for apoptogenic factors. Dual functions are maintained at the level of individual proteins, balancing cellular life and death. Mitochondrial malfunction has been reported as an important factor in BC pathogenesis and development. MTCH2 is reported to reside in a complex consisting of tBID and BAX [14]. BID phosphorylation induced by DNA damage is important in cell cycle arrest. Moreover, induction of MTCH2 arrested cellular growth in response to hepatocyte growth factor/scatter factor (HGF/SF), arresting cells at S phase of the cell cycle [4], however, induction of MTCH2 or its transient expression did not lead to apoptosis.

Besides mitophagy, the ATM-BID-MTCH2 pathway plays a critical role in DNA damage response (DDR) via regulation of mitochondrial metabolism [15]. Furthermore, MTCH2 was reported to inhibit the action of estrogen, a known regulator of metabolic homeostasis [16], as well as a known culprit in BC. The ESR1 gene encodes estrogen’s receptor which is a ligand-activated transcription factor located in the nucleus. Mass spectrometry revealed the presence of both ESR1 and MTCH2 in the presence of estradiol, indicating direct binding between the two proteins [17]. Loss of MTCH2 in hematopoietic stem cells (HSCs) promotes a metabolic switch from glycolysis to OXPHOS [18,19]. Consistent with this, knockdown of MTCH2 with small interfering RNA in embryonic stem cells (ESCs) resulted in down-regulation of glycolysis and elevation of OXPHOS. Moreover, MTCH2 emerged from a genetic screen as one of six new loci whose polymorphic variants are associated with increase body mass index (BMI). Among these newly identified associated genetic loci, MTCH2 was the only gene whose mRNA was not detected in the hypothalamus, suggesting that it could impact the regulation of body mass by action in the periphery [14]. The role of MTCH2 interplay with BC oncogenes is still largely unknown, yet it is worthy of further investigation.

In our study, we verified that MTCH2 regulates cellular proliferation and cycling in BC cell lines and xenograft models. Firstly, analysis of GEO and TCGA data demonstrated that MTCH2 was over-expressed in BC tissue compared normal control and correlated with worse prognosis for BC patients. This finding was confirmed in BC cell lines and xenograft models. Subsequently, experiments of suppression and over-expression of MTCH2 provided concrete evidence for its potentiation of BC cell growth and cycle progression. Furthermore, MTCH2 action on cellular growth and the cell cycle was observed in vivo. Both the weight and volume of xenografts positively correlated with MTCH2 expression levels and IHC staining of proliferative and cell cycle biomarkers further demonstrated the same pattern. These results are consistent with previous studies mentioned above.

Recently, Guna et al. have demonstrated that MTCH2 functions as a mitochondrial outer-membrane insertase, and certain MTCH2 mutants either reduce or increase its insertase activity [20]. MTCH2 overexpression leads to a commensurate decrease in mitochondrial tail-anchored proteins mistargeting to the endoplasmic reticulum. MTCH2 is a central ‘gatekeeper’ for the mitochondrial outer membrane: MTCH2 levels and activity dictate the cytosolic reservoir of mitochondrial tail-anchored proteins, which can be re-routed to the endoplasmic reticulum if successful integration into mitochondria does not occur. Given that insertion of several MTCH2-dependent tail-anchored proteins are important in apoptosis, MTCH2 activity may affect cellular sensitivity to apoptotic stimuli. We hypothesise that there may be some relationship between MTCH2's insertase activity and cancer progression, which requires further study.

The PI3K/Akt/mTOR signaling pathway is commonly deregulated in many human tumors, including breast cancer [21]. Activation of the PI3K/Akt/mTOR pathway occurs frequently in breast cancer that is resistant to endocrine therapy [22]. The mTOR inhibitor everolimus has been applied in clinical practice for many years. Approved mTOR inhibitors effectively inhibit cell growth and proliferation but elicit PI3K/Akt phosphorylation via a feedback activation pathway, potentially leading to resistance to mTOR inhibitors [22,23]. Thus, specific PI3K inhibitors, such as alpelisib, are indicated in luminal A and B metastatic BC [24], and Akt inhibitors have shown utility, such as Ipatasertib [25].

Met is a heterodimeric receptor tyrosine kinase and Met-induced mitochondrial protein is an alternative name for MTCH2. Met’s docking site recruits signaling transducers, such as PI3K [4]. In a previous study, it was reported that the level of PI3K was upregulated following MTCH2 induction, while phosphorylated PI3K in response to HGF/SF was unaffected by the exogenous induction of MTCH2.

According to our GSEA analysis, the PI3K/Akt pathway is involved in the downstream regulation of MTCH2. In vitro study of BC cell lines has revealed that phosphorylation of PI3K and Akt was significantly regulated by MTCH2 expression. Based on the results revealing that MTCH2 silencing-induced cellular growth and cycle arrest could be rescued by the PI3K/Akt pathway activator IGF-1R, we suggest that these signaling pathways are essential to MTCH2’s action on cell proliferation and cycle. Considering that signaling pathways are often targeted by many activators and inhibitors, further study of the activation of PI3K/Akt is required.

There are several limitations to this study. First of all, the connection between MTCH2 and PI3K/Akt signaling need further verification, given that there might be other potential mechanisms by which MTCH2 may impact BC progression. Secondly, in addition to the PI3K/Akt pathway, MTCH2 was implicated in the regulation of G2M checkpoint, DNA repair, p53, and early estrogen response pathways. Moreover, other pathways may contribute to the observed changes in cell proliferation and cell cycle regulation, which require further study in addition to the phosphorylation of PI3K/AKT after overexpression of IGF-1R.

5. Conclusions

Overall, our findings have exhibited that overexpression of MTCH2 in BC provokes cellular proliferation and cycle progression via the PI3K/Akt pathway. Given its unique role in mitochondrial metabolism and apoptosis, MTCH2 makes for a good candidate for therapeutic manipulation in treatment of BC.

Ethics statement

This study was approved by the Ethics Committee of Changzhou First People's Hospital. The ethics approval number is 2023 (edu) CL023-01.

Informed consent statement

Not applicable.

Funding

Changzhou Health Commission (ZD202307).

Institutional review board statement

Not applicable.

Additional information

No additional information is available for this paper.

Data availability statement

The data generated in the present study may be requested from the corresponding author upon reasonable request.

CRediT authorship contribution statement

Wenying Jiang: Writing – original draft, Investigation, Formal analysis, Data curation. Yuxia Miao: Writing – review & editing, Project administration, Data curation. Xiaoxiao Xing: Writing – review & editing, Project administration, Data curation. Shuiqing Liu: Writing – review & editing, Project administration, Data curation. Wei Xing: Writing – review & editing, Supervision, Methodology. Feng Qian: Writing – review & editing, Supervision, Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Contributor Information

Wei Xing, Email: suzhxingwei@suda.edu.cn.

Feng Qian, Email: qf1052@czfph.com.

References

  • 1.Sung H., Ferlay J., Siegel R.L., Laversanne M., Soerjomataram I., Jemal A., Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA A Cancer J. Clin. 2021;71:209–249. doi: 10.3322/caac.21660. [DOI] [PubMed] [Google Scholar]
  • 2.Siegel R.L., Miller K.D., Fuchs H.E., Jemal A. Cancer statistics. CA A Cancer J. Clin. 2021;71(2021) doi: 10.3322/caac.21654. [DOI] [PubMed] [Google Scholar]
  • 3.Harbeck N., Penault-Llorca F., Cortes J., Gnant M., Houssami N., Poortmans P., Ruddy K., Tsang J., Cardoso F. Breast cancer. Nat. Rev. Dis. Prim. 2019;5:66. doi: 10.1038/s41572-019-0111-2. [DOI] [PubMed] [Google Scholar]
  • 4.Leibowitz-Amit R., Tsarfaty G., Abargil Y., Yerushalmi G.M., Horev J., Tsarfaty I. Mimp, a mitochondrial carrier homologue, inhibits Met-HGF/SF-induced scattering and tumorigenicity by altering Met-HGF/SF signaling pathways. Cancer Res. 2006;66:8687–8697. doi: 10.1158/0008-5472.CAN-05-2294. [DOI] [PubMed] [Google Scholar]
  • 5.Yuan Q., Yang W., Zhang S., Li T., Zuo M., Zhou X., Li J., Li M., Xia X., Chen M., Liu Y. Inhibition of mitochondrial carrier homolog 2 (MTCH2) suppresses tumor invasion and enhances sensitivity to temozolomide in malignant glioma. Mol. Med. 2021;27:7. doi: 10.1186/s10020-020-00261-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Arigoni M., Barutello G., Riccardo F., Ercole E., Cantarella D., Orso F., Conti L., Lanzardo S., Taverna D., Merighi I., Calogero R.A., Cavallo F., Quaglino E. miR-135b coordinates progression of ErbB2-driven mammary carcinomas through suppression of MID1 and MTCH2. Am. J. Pathol. 2013;182:2058–2070. doi: 10.1016/j.ajpath.2013.02.046. [DOI] [PubMed] [Google Scholar]
  • 7.Seyrek K., Richter M., Lavrik I.N. Decoding the sweet regulation of apoptosis: the role of glycosylation and galectins in apoptotic signaling pathways. Cell Death Differ. 2019;26:981–993. doi: 10.1038/s41418-019-0317-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Goncharenko-Khaider N., Lane D., Matte I., Rancourt C., Piché A. The inhibition of Bid expression by Akt leads to resistance to TRAIL-induced apoptosis in ovarian cancer cells. Oncogene. 2010;29:5523–5536. doi: 10.1038/onc.2010.288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zaltsman Y., Shachnai L., Yivgi-Ohana N., Schwarz M., Maryanovich M., Houtkooper R.H., Vaz F.M., De Leonardis F., Fiermonte G., Palmieri F., Gillissen B., Daniel P.T., Jimenez E., Walsh S., Koehler C.M., Roy S.S., Walter L., Hajnóczky G., Gross A. MTCH2/MIMP is a major facilitator of tBID recruitment to mitochondria. Nat. Cell Biol. 2010;12:553–562. doi: 10.1038/ncb2057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yu G W.L., Han Y., et al. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS A J. Integr. Biol. 2012;16:284–287. doi: 10.1089/omi.2011.0118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Subramanian A T.P., Mootha V.K., et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA. 2005;102:15545–15550. doi: 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 13.Ahmad S.S., Ahmad K., Lee E.J., Lee Y.-H., Choi I. Implications of insulin-like growth factor-1 in skeletal muscle and various diseases. Cells. 2020;9 doi: 10.3390/cells9081773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cogliati S., Scorrano L. A BID on mitochondria with MTCH2. Cell Res. 2010;20:863–865. doi: 10.1038/cr.2010.100. [DOI] [PubMed] [Google Scholar]
  • 15.Gross A., Zaltsman Y., Maryanovich M. The ATM-BID pathway plays a critical role in the DNA damage response by regulating mitochondria metabolism. Cell Death Differ. 2016;23:182. doi: 10.1038/cdd.2015.154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Rottiers V., Francisco A., Platov M., Zaltsman Y., Ruggiero A., Lee S.S., Gross A., Libert S. MTCH2 is a conserved regulator of lipid homeostasis. Obesity. 2017;25:616–625. doi: 10.1002/oby.21751. [DOI] [PubMed] [Google Scholar]
  • 17.Cheng P.-C., Chang H.-K., Chen S.-H. Quantitative nanoproteomics for protein complexes (QNanoPX) related to estrogen transcriptional action. Mol. Cell. Proteomics : MCP. 2010;9:209–224. doi: 10.1074/mcp.M900183-MCP200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Maryanovich M., Zaltsman Y., Ruggiero A., Goldman A., Shachnai L., Zaidman S.L., Porat Z., Golan K., Lapidot T., Gross A. An MTCH2 pathway repressing mitochondria metabolism regulates haematopoietic stem cell fate. Nat. Commun. 2015;6:7901. doi: 10.1038/ncomms8901. [DOI] [PubMed] [Google Scholar]
  • 19.Li P., Gao L., Cui T., Zhang W., Zhao Z., Chen L. Cops5 safeguards genomic stability of embryonic stem cells through regulating cellular metabolism and DNA repair. Proc. Natl. Acad. Sci. U.S.A. 2020;117:2519–2525. doi: 10.1073/pnas.1915079117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Guna A., Stevens T.A., Inglis A.J., Replogle J.M., Esantsi T.K., Muthukumar G., Shaffer K.C.L., Wang M.L., Pogson A.N., Jones J.J., Lomenick B., Chou T.F., Weissman J.S., Voorhees R.M. MTCH2 is a mitochondrial outer membrane protein insertase. Science. 2022;378:317–322. doi: 10.1126/science.add1856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Vitale S.R., Martorana F., Stella S., Motta G., Inzerilli N., Massimino M., Tirrò E., Manzella L., Vigneri P. PI3K inhibition in breast cancer: identifying and overcoming different flavors of resistance. Crit. Rev. Oncol.-Hematol. 2021 doi: 10.1016/j.critrevonc.2021.103334. [DOI] [PubMed] [Google Scholar]
  • 22.Di Leo A., Johnston S., Lee K.S., Ciruelos E., Lønning P.E., Janni W., O'Regan R., Mouret-Reynier M.-A., Kalev D., Egle D., Csőszi T., Bordonaro R., Decker T., Tjan-Heijnen V.C.G., Blau S., Schirone A., Weber D., El-Hashimy M., Dharan B., Sellami D., Bachelot T. Buparlisib plus fulvestrant in postmenopausal women with hormone-receptor-positive, HER2-negative, advanced breast cancer progressing on or after mTOR inhibition (BELLE-3): a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet Oncol. 2018;19 doi: 10.1016/S1470-2045(17)30688-5. [DOI] [PubMed] [Google Scholar]
  • 23.Basho R.K., Gilcrease M., Murthy R.K., Helgason T., Karp D.D., Meric-Bernstam F., Hess K.R., Herbrich S.M., Valero V., Albarracin C., Litton J.K., Chavez-MacGregor M., Ibrahim N.K., Murray J.L., Koenig K.B., Hong D., Subbiah V., Kurzrock R., Janku F., Moulder S.L. Targeting the PI3K/AKT/mTOR pathway for the treatment of mesenchymal triple-negative breast cancer: evidence from a phase 1 trial of mTOR inhibition in combination with liposomal doxorubicin and bevacizumab. JAMA Oncol. 2017;3:509–515. doi: 10.1001/jamaoncol.2016.5281. [DOI] [PubMed] [Google Scholar]
  • 24.Rugo H.S., Lerebours F., Ciruelos E., Drullinsky P., Ruiz-Borrego M., Neven P., Park Y.H., Prat A., Bachelot T., Juric D., Turner N., Sophos N., Zarate J.P., Arce C., Shen Y.-M., Turner S., Kanakamedala H., Hsu W.-C., Chia S. Alpelisib plus fulvestrant in PIK3CA-mutated, hormone receptor-positive advanced breast cancer after a CDK4/6 inhibitor (BYLieve): one cohort of a phase 2, multicentre, open-label, non-comparative study, the Lancet. Oncology. 2021;22:489–498. doi: 10.1016/S1470-2045(21)00034-6. [DOI] [PubMed] [Google Scholar]
  • 25.Isakoff S.J., Tabernero J., Molife L.R., Soria J.C., Cervantes A., Vogelzang N.J., Patel M.R., Hussain M., Baron A., Argilés G., Conkling P.R., Sampath D., Maslyar D., Patel P., Chan W., Gendreau S., Musib L., Xu N., Ma H., Lin K., Bendell J. Antitumor activity of ipatasertib combined with chemotherapy: results from a phase Ib study in solid tumors. Ann. Oncol. : Off. J. Eur. Soc. Med. Oncol. 2020;31:626–633. doi: 10.1016/j.annonc.2020.02.007. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data generated in the present study may be requested from the corresponding author upon reasonable request.


Articles from Heliyon are provided here courtesy of Elsevier

RESOURCES