Skip to main content
NCBI home page
Lippincott Open Access logoLink to Lippincott Open Access
. 2024 Feb 2;43(5):537–544. doi: 10.1097/ICO.0000000000003480

Study of IL-17 and Intercellular Adhesion Molecule-1 in Conjunctivochalasis Using Correlation Analysis

Kai Ma *, Huanming Zhou *, Wei Zhang *, Jiang Liu *, Yongyi Sha *,✉, Xueqing Kong *, Zhenhua Ni †, Minhong Xiang *,‡,✉
PMCID: PMC10980173  PMID: 38305353

Abstract

Purpose:

The aim of this study was to observe the expression of interleukin (IL)-17 and intercellular adhesion molecule (ICAM)-1 in conjunctivochalasis (CCH) and to analyze the correlations between cytokines and the severity of CCH.

Methods:

Serum samples were collected from 22 patients with CCH and 18 normal controls (NCs). The Ocular Surface Disease Index, tear film break-up time, Schirmer I test, and corneal fluorescein staining were used to evaluate the ocular surface signs and symptoms. The concentrations of IL-17, IL-23, and ICAM-1 in serum and cellular supernatants were measured by enzyme-linked immunosorbent assays, and the gene expression levels of cytokines were measured by a quantitative real-time polymerase chain reaction. The relationships between serum concentrations of IL-17, IL-23, and ICAM-1 with clinical ocular surface parameters in CCH were analyzed using the Spearman correlation analysis.

Results:

The concentrations of IL-17 and ICAM-1 in serum and cellular supernatants of CCH were significantly higher than those of NCs (all P < 0.001). The concentrations of IL-23 in serum and cellular supernatants of CCH showed no significant difference from those of NCs (P > 0.05). The mRNA expression levels of IL-17 and ICAM-1 in conjunctival fibroblasts of CCH were significantly higher than those of NCs (all P < 0.001). The mRNA expression of IL-23 in conjunctival fibroblasts of CCH was higher than that of NCs, without a significant difference (P > 0.05). Furthermore, the serum concentrations of IL-17 and ICAM-1 were positively correlated with Ocular Surface Disease Index and fluorescein staining (all P < 0.05), and negatively correlated with break-up time and Schirmer I test of CCH (all P < 0.05).

Conclusions:

The expression levels of IL-17 and ICAM-1 were significantly increased in CCH serum and associated with the disease severity. We postulate that IL-17 and ICAM-1 may play a role in the pathogenesis of CCH. IL-17 and ICAM-1 antagonists may be a potential treatment option for CCH in the future.

Key Words: conjunctivochalasis, IL-17, ICAM-1, serum, clinical parameters

Conjunctivochalasis (CCH) is often defined as redundant, loose bulbar conjunctival folds typically located in the inferior bulbar conjunctiva. It usually affects the elderly population and is therefore often regarded as a senile change.1–3 A large population-based epidemiological study showed that the prevalence of CCH in people older than 60 years was 44.8%.4 In addition, the severity of the disease increased with age.5 Several suggestions regarding the etiology and pathogenesis of CCH have been put forward in previous studies, including age-related fracture or decrease of elastic fibers,6 cell senescence,7,8 and chronic inflammatory response.9,10 However, there is no consensus regarding the exact cause and pathogenesis of CCH.

Several studies evaluating CCH have shown that ocular surface inflammation may be one of the most important pathogenic factors.10 The T-helper 17 is a newly discovered CD4+ T-cell subgroup, which has recently been found to participate in most ocular inflammatory diseases,11,12 such as uveitis, scleritis, and herpes virus–induced keratitis.13 Interleukin (IL)-17 and IL-23 are multipotent proinflammatory cytokines, which are involved in ocular surface disorders such as dry eye and intraocular inflammation in clinical and experimental models.14,15 Recent studies have shown that IL-17 and IL-23 levels are elevated in the tears of patients with dry eye when compared with age-matched normal controls (NCs).16,17 Intercellular adhesion molecule (ICAM)-1 is a member of the immunoglobulin (Ig)-like cell adhesion molecule superfamily and is markedly increased in many cell types after persistent stimulation of inflammatory mediators.18 A previous study has revealed that IL-17 is a very potent activator of the endothelium in vivo promoting expression of ICAM-1, leading to enhanced neutrophil transmigration both in cell culture and in vivo.19 Nevertheless, such Th17-associated cytokines and ICAM-1 have not been elaborated yet in CCH. Accordingly, the aim of this study was to investigate the expression of IL-17, IL-23, and ICAM-1 in the serum and cellular supernatants of patients with CCH and to analyze the correlations between the inflammatory cytokines and CCH severity.

MATERIALS AND METHODS

Patient Selection

Forty participants were recruited between October 2021 and December 2021 from Putuo Hospital, affiliated with Shanghai University of Traditional Chinese Medicine, including 18 age-matched patients who had cataract without CCH20 (8 men and 10 women; mean age: 66.72 ± 2.40 years) as NCs and 22 patients with CCH (10 men and 12 women; mean age: 68.13 ± 2.20 years). The right eye was chosen as the observed eye. This study was approved by the Ethics Committee of Putuo Hospital, affiliated with Shanghai University of Traditional Chinese Medicine, Shanghai, PR China (ethics code: PTEC-A-2021-14-1) and adhered to the tenets of the Declaration of Helsinki. Individuals with infectious or inflammatory disease, meibomian gland disease, blepharitis, history of recent ocular surgery, ocular treatment other than artificial tears, or uncontrolled systemic diseases were excluded from this study.

Clinical Evaluations

The clinical evaluation included the Ocular Surface Disease Index (OSDI), tear break-up time (BUT), Schirmer I test (SIT), and corneal fluorescein staining (FL).

Ocular Surface Disease Index

The OSDI symptom questionnaire was divided into 3 categories: vision-related functions, ocular symptoms, and environmental triggers. The 12 items in the OSDI questionnaire ranged from 0 to 4 points, with the score calculated as previously described.21

Tear BUT Test

Sterile fluorescein strips (Tianjin Jingming Co., Ltd., Tianjin, China) moistened with 0.9% sodium chloride were gently placed on the lower eyelid fornix. After fluorescein infusion and blinking several times, the BUT was examined under a slit-lamp biomicroscope with a cobalt blue filter. The time between opening the eyes and the first appearance of black spots was measured 3 times and the mean value was calculated.22

Schirmer I test

The SIT was conducted without topical anesthesia by putting 5 × 35-mm Schirmer tear test strips on the lateral canthus of the lower eyelid. The participants were asked to keep their eyes closed during the test. After 5 minutes, the wetting length was measured.23

Corneal Fluorescein Staining

The corneal integrity was evaluated using sterile fluorescein strips (Tianjin Jingming Co., Ltd). The intensity of the corneal FL was recorded in each quadrant of the cornea (temporal, nasal, upper, and lower). The total fluorescein score was calculated as the sum of the scores.24

Human Serum Collection

Serum was obtained from the peripheral blood samples collected from all participants to evaluate the expression levels of IL-17, IL-23, and ICAM-1. The serum was clarified by centrifugation at 3000 rpm for 20 minutes at 4°C and stored at −80°C for further experiments.

Cell Culture of Human Conjunctival Fibroblasts

Primary CCH and NC conjunctival fibroblasts were obtained using the tissue block adhesion method.7 Each tissue sample was cut into 2×2-mm2 squares and placed in a 25-cm2 tissue culture bottle. The tissue was covered with Dulbecco modified Eagle medium (DMEM; Gibco BRL, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 U/mL streptomycin in a CO2 incubator with 5% volume fraction at 37°C. After separation from 0.25% trypsin-EDTA in calcium-free basic medium, fibroblasts were subcultured at 90% confluence and divided into generations in a ratio of 1:3.

Immunofluorescence Staining and Fibroblast Identification

The fifth-generation cells were placed on sterile slides and grown for 24 hours. The isolated fibroblasts were washed twice with phosphate-buffered saline and fixed with 4% paraformaldehyde at room temperature for 30 minutes. The cells were subsequently incubated with 1% Triton X-100 for cell permeabilization and incubated with 10% normal goat serum and 1% Triton X-100 for 60 minutes to block nonspecific binding activity. After this, the cells were incubated with antivimentin (Abcam, Cambridge, MA, 1:500) and Alexa Fluor 488-labeled goat anti-rabbit IgG(H + L) (1:50, Beyotime Institute of Biotechnology, Jiangsu, China) for 1 hour at room temperature. The nuclei were stained with 2-(4-amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI) for 5 minutes. After immunofluorescence staining, the cells were observed using fluorescence microscopy (Leica DM IRB; Leica, Wetzlar, Germany).

Enzyme-Linked Immunosorbent Assay

The fifth-generation fibroblasts were used; the cells were plated at 5 × 105 cells/mL with 2 mL of high-glucose DMEM containing 10% FBS in a 6-well plate. Twenty-four hours after culturing, the nutrient solution was discarded. Subsequently, the 6-well plate was washed twice with phosphate-buffered saline, and 2 mL of high-glucose DMEM nutrient solution without FBS was added to each well. After incubation for 48 hours with 5% volume fraction at 37°C, the cultured supernatant fluid was collected from each well and clarified by centrifugation at 12,000 rpm for 15 minutes at 4°C. Each sample was transferred into a sterile microtube and stored at −80°C. The concentrations of IL-17, IL-23, and ICAM-1 in CCH and NC fibroblast cellular supernatant and serum samples were quantified using ELISA kits (RayBiotech, Norcross, GA) according to the manufacturer's instructions. All ELISA experiments were performed in triplicate.

Quantitative Real-Time Polymerase Chain Reaction

TRIzol reagent (Sigma-Aldrich, St Louis, MO) was used to extract total RNA from each group, and the total RNA was reverse transcribed to cDNA using a Takara Sensiscript RT Kit (Invitrogen Inc., Carlsbad, CA). A standard SYBR-Green PCR kit was used for gene expression analysis on a qRT-PCR instrument (Applied Biosystems, Carlsbad, CA). All primers were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai, China) and listed in Table 1. The data were normalized to β-actin as an internal control. The relative expression levels of each target gene were calculated using the 2−ΔΔct method. All experiments were performed in triplicate (Table 1).

TABLE 1.

Primer Sequences for qRT-PCR

Gene Primer Sequence (5′-3′) Product Size (bp)
IL-17 F: AGA​GAT​ATC​CCT​CTG​TGA​TC 67
R: TAC​CCC​AAA​GTT​ATC​TCA​GG
IL-23 F: CCTTCTCTGCTCCCTGATAGC
R: GACTGAGGCTTGGAATCTGCT		 156
ICAM-1 F: CAGTGACCATCTACAGCTTTCCG
R: GCTGCTACCACAGTGATGACAA
132
β-actin F: CAT​GTA​CGT​TGC​TAT​CCA​GGC 113
R: CTC​CTT​AAT​GTC​ACG​CAC​GAT
Open in a new tab

Statistical Analysis

All data were expressed as mean ± SD. An unpaired Student t test was used to compare the ELISA results. The Spearman correlation analysis was used to evaluate the relationship between IL-17, IL-23, ICAM-1, and clinical parameters. Statistical significance was set at P < 0.05. SPSS (version 24.0; SPSS Statistics for Windows, IBM Corp., Armonk, NY) was used for the data analysis.

RESULTS

Ocular Surface Parameters

There were no significant differences in age and sex between the 2 groups (all P > 0.05). The OSDI and FL scores of the CCH group were significantly higher than those of the NC group (all P < 0.001), and the SIT and BUT were significantly lower than those of the NC group (all P < 0.001; Table 2).

TABLE 2.

Ocular Surface Parameters of the Two Groups

Normal Control (n = 18) CCH (n = 22)
OSDI score 4.62 ± 3.74 24.58 ± 5.92*
BUT (s) 11.32 ± 2.05 3.04 ± 1.00*
SIT (mm) 15.39 ± 4.28 4.77 ± 1.21*
FL 0 4.31 ± 0.95*
Open in a new tab
*

P < 0.001.

Culture and Identification of Conjunctival Fibroblasts

Primary cultured fibroblasts were shaped like a long spindle, flat star, or multiprocess spindle, wide in the middle, with an oval nucleus, relatively small at both ends, and with 2 to 3 slender processes of different lengths extending outward (Figs. 1A–C). Vimentin was used as a marker protein to identify fibroblasts by immunofluorescence staining.25 Green fluorescence was observed in the cytoplasm of fibroblasts with positive vimentin reaction, and blue fluorescence was observed in the nucleus (Figs. 1D–F).

FIGURE 1.

FIGURE 1.

Open in a new tab

Primary fibroblasts cultured from conjunctival tissues. A, First day of primary fibroblast culture. B, Third day of primary fibroblast culture. C, Fourth passage of conjunctival fibroblasts. D–F, Vimentin immunofluorescence staining of conjunctival fibroblasts.

Expression of IL-17, IL-23, and ICAM-1 in Serum and Conjunctival Fibroblasts

To investigate the expression of IL-17, IL-23, and ICAM-1, we used ELISA to examine the serum and primary cultured conjunctival fibroblasts of CCH and NCs. As shown in Figure 2A, the mean concentration of IL-17 in the CCH serum was significantly higher than that in the NC serum (P < 0.001). The mean concentration of IL-17 in the CCH cellular supernatant was significantly higher than that in the NC cellular supernatant (P < 0.001, Fig. 3A). The mean concentration of IL-23 in the CCH serum and CCH cellular supernatant had no significant difference with NCs (P > 0.05, Figs. 2B, 3B). The mean concentration of ICAM-1 in the CCH serum was significantly higher than that in the NC serum (P < 0.001, Fig. 2C). The mean concentration of ICAM-1 in the CCH cellular supernatant was significantly higher than that in the NC cellular supernatant (P < 0.001, Fig. 3C).

FIGURE 2.

FIGURE 2.

Open in a new tab

Expression of cytokines in the serum of patients with CCH and NCs by ELISA. **P < 0.001; ▽P > 0.05.

FIGURE 3.

FIGURE 3.

Open in a new tab

Expression of cytokines in the cellular supernatant of cultured fibroblasts of patients with CCH and NCs by ELISA. **P < 0.001; ▽P > 0.05.

Gene Expression of IL-17, IL-23, and ICAM-1 in Conjunctival Fibroblasts

To explore the gene expression of IL-17, IL-23, and ICAM-1 in conjunctival fibroblasts, we measured the gene expression levels using qRT-PCR. The results showed that the IL-17 mRNA expression in CCH conjunctival fibroblasts was significantly higher than that in NC conjunctival fibroblasts (P < 0.001, Fig. 4A). The mRNA expression of IL-23 in CCH conjunctival fibroblasts showed no significant difference from that in NC conjunctival fibroblasts (P > 0.05, Fig. 4B). The expression of ICAM-1 mRNA in CCH conjunctival fibroblasts was significantly higher than that in NC conjunctival fibroblasts (P < 0.001, Fig. 4C).

FIGURE 4.

FIGURE 4.

Open in a new tab

mRNA expression of cytokines in conjunctival fibroblasts of CCH and NC groups. **P < 0.001; ▽P > 0.05.

Correlations Between IL-17, IL-23, and ICAM-1 and Clinical Parameters

To investigate further whether the serum expression of IL-17, IL-23, and ICAM-1 was related to clinical ocular surface parameters in the CCH group, we analyzed the relationships using Spearman correlation analysis. According to our results, the expression of IL-17 in the CCH serum was positively correlated with the OSDI score (R = 0.70, P < 0.001, Fig. 5A) and FL (R = 0.58, P < 0.05, Fig. 5D), and strongly negatively correlated with BUT (R = −0.73, P < 0.001, Fig. 5B) and SIT (R = −0.67, P < 0.001, Fig. 5C). The expression of ICAM-1 in the CCH serum was positively correlated with the OSDI score (R = 0.57, P < 0.05, Fig. 7A) and FL (R = 0.63, P < 0.05, Fig. 7D), and negatively correlated with BUT (R = −0.52, P < 0.05, Fig. 7B) and SIT (R = −0.53, P < 0.05, Fig. 7C). However, the analysis of the correlation between the expression of IL-23 in the CCH serum and clinical ocular surface parameters showed no significant relationships (all P > 0.05, Figs. 6A–D).

FIGURE 5.

FIGURE 5.

Open in a new tab

Correlation between IL-17 expression in serum and clinical parameters of CCH.

FIGURE 7.

FIGURE 7.

Open in a new tab

Correlation between ICAM-1 expression in serum and clinical parameters of CCH.

FIGURE 6.

FIGURE 6.

Open in a new tab

Correlation between IL-23 expression in serum and clinical parameters of CCH.

DISCUSSION

CCH is one of the most common ocular diseases and is a common mimicker of dry eye symptoms, which can cause a series of ocular discomforts, such as foreign body sensation, epiphora, dryness, blurred vision, and serious lacrimal river interruption.26 Previous studies have revealed that high levels of proinflammatory cytokines play an essential role in the occurrence and development of CCH.10,27 The overexpression of inflammatory cytokines promotes the production of matrix metalloproteinases (MMPs) and the resultant collagenolytic activity, as well as the presence of conjunctival oxidative stress, which may trigger the generation of proinflammatory cytokines and inflammatory chemokines.20 However, the exact mechanism of the pathogenesis of CCH is still uncertain.

Recent studies have indicated that Th17 cells are involved in psoriasis, rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease, systemic lupus erythematosus, and asthma, through the IL-17/IL-23 axis.28–30 IL-17 is one of the leukocyte interleukin family members mainly secreted by CD4+ memory T lymphocytes. The IL-17 family is a group of proinflammatory cytokines that includes 6 members, from IL-17A (IL-17) to IL-17F, with a wide range of biological activities.31 Previous research has demonstrated that elevated IL-17 levels are associated with the development of chronic inflammatory immune-mediated diseases.32,33 McGeachy et al32 also showed that IL-17 acted on fibroblasts, immune cells, and epithelial cells, inducing the production of cytokines, chemokines, and MMPs. Therefore, IL-17 has a prominent inflammatory role that triggers the induction of cytokines, chemokines, and MMPs, leading to the perpetuation of inflammation and tissue damage.34 Inhibition of IL-17 reduced the expression of MMP9 and MMP3 in the corneal epithelial cells in an animal model of dry eye disease, and IL-17 blockade also led to diminish disease severity.35 Strategies designed to target IL-17 or inhibit Th17 cell function may be viable approaches to treat dry eye.36 Studies have demonstrated that the pathogenesis of chronic dry eye involves persistent ocular surface inflammation associated with increased IL-17 expression.37 Th17 cell numbers and serum levels of IL-17 and IL-22 were elevated in patients with CCH in a previous study.38 In our study, the expression of IL-17, both protein and mRNA, in the serum and cellular supernatant was significantly increased in the CCH group compared with age-matched NCs. Furthermore, we confirmed that the serum expression of IL-17 in CCH was positively correlated with the OSDI score and FL score, and negatively correlated with the BUT and SIT (all P < 0.05).

Oxidative stress and chronic inflammatory cytokines play important roles in the etiology of CCH,20 and IL-17 increases endothelial ICAM-1 expression in a p38 mitogen-activated protein kinase-dependent manner.39 Expression of p38, MMP1, and MMP3 was significantly increased in fibroblasts co-cultured with CD4+ T cells from patients with CCH.38 Our results demonstrated that the protein and mRNA expression of ICAM-1 in the serum and cellular supernatant was obviously increased in the CCH group compared with age-matched NCs (all P < 0.05). Furthermore, the expression of ICAM-1 in the CCH serum was positively correlated with the OSDI score and FL score, and negatively correlated with the BUT and SIT (all P < 0.05). IL-23 is a member of the IL-12 cytokine family, secreted by antigen-presenting cells such as activated dendritic cells, monocytes, and macrophages through IL-12Rb1 and IL-23R.40 Studies have shown that IL-23 is a Th17 lymphocyte-related cytokine that enhances the expression of IL-17.41,42 However, our results showed that the expression of IL-23 protein and mRNA in the serum and cellular supernatant had no significant difference in the CCH group compared with the NCs (P > 0.05), suggesting that IL-23 may not be the main inflammatory cytokine in CCH development.

We suggest that IL-17 may induce fibroblasts to synthesize and secrete destructive molecules including MMPs and reactive oxygen species; IL-17 also induces T-cell activation and infiltration into tissues by upregulating the expression of ICAM-1 and amplifies the immune response by inducing the production of IL-6 and prostaglandin E2.43 Thus, excessive degradation of extracellular matrix, collagen fibers, and elastic fibers in the conjunctiva might lead to CCH.

In conclusion, our study found increased expression of IL-17 and ICAM-1 in the serum and cellular supernatant of patients with CCH, and the concentrations of IL-17 and ICAM-1 were associated with CCH severity. These findings indicate that IL-17 and ICAM-1 may play important roles in CCH pathogenesis and may contribute to novel therapeutic approaches in the future. However, further studies are required to determine the exact nature of the interaction between IL-17 and ICAM-1, and their involvement in CCH.

Footnotes

The authors have no funding or conflicts of interest to disclose.

K. Ma, H. Zhou, and W. Zhang contributed equally to this article.

Contributor Information

Kai Ma, Email: 384122506@qq.com.

Huanming Zhou, Email: sunday_zhm@qq.com.

Wei Zhang, Email: zwhappy909@163.com.

Jiang Liu, Email: liu96jiang@163.com.

Yongyi Sha, Email: 1908310842@qq.com.

Xueqing Kong, Email: 3334637483@qq.com.

Zhenhua Ni, Email: zhenhuani@yeah.net.

REFERENCES

  • 1.Hashemian H, Mahbod M, Amoli FA, et al. Histopathology of conjunctivochalasis compared to normal conjunctiva. J Ophthalmic Vis Res. 2016;11:345–349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Marmalidou A, Palioura S, Dana R, et al. Medical and surgical management of conjunctivochalasis. Ocul Surf. 2019;17:393–399. [DOI] [PubMed] [Google Scholar]
  • 3.Poh S, Lee R, Gao J, et al. Factors that influence tear meniscus area and conjunctivochalasis: the Singapore Indian eye study. Ophthalmic Epidemiol. 2018;25:70–78. [DOI] [PubMed] [Google Scholar]
  • 4.Zhang X, Li Q, Zou H, et al. Assessing the severity of conjunctivochalasis in a senile population: a community-based epidemiology study in Shanghai, China. BMC Public Health. 2011;11:198–206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Gumus K, Pflugfelder SC. Increasing prevalence and severity of conjunctivochalasis with aging detected by anterior segment optical coherence tomography. Am J Ophthalmol. 2013;155:238–242.e2. [DOI] [PubMed] [Google Scholar]
  • 6.Gan JY, Li QS, Zhang ZY, et al. The role of elastic fibers in pathogenesis of conjunctivochalasis. Int J Ophthalmol. 2017;10:1465–1473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Xiang MH, Mo LJ, Zhan YP, et al. P38-mediated cellular senescence in conjunctivochalasis fibroblasts. Invest Ophthalmol Vis Sci. 2019;60:4643–4651. [DOI] [PubMed] [Google Scholar]
  • 8.Xiang M, Zhang W, Wen H, et al. Comparative transcriptome analysis of human conjunctiva between normal and conjunctivochalasis persons by RNA sequencing. Exp Eye Res. 2019;184:38–47. [DOI] [PubMed] [Google Scholar]
  • 9.Acera A, Vecino E, Duran JA. Tear MMP-9 levels as a marker of ocular surface inflammation in conjunctivochalasis. Invest Ophthalmol Vis Sci. 2013;54:8285–8291. [DOI] [PubMed] [Google Scholar]
  • 10.Harbiyeli II, Erdem E, Erdogan S, et al. Investigation of conjunctivochalasis histopathology with light and electron microscopy in patients with conjunctivochalasis in different locations. Int Ophthalmol. 2019;39:1491–1499. [DOI] [PubMed] [Google Scholar]
  • 11.Wang J, Gong J, Yang Q, et al. Interleukin-17 receptor E and C-C motif chemokine receptor 10 identify heterogeneous T helper 17 subsets in a mouse dry eye disease model. Am J Pathol. 2022;192:332–343. [DOI] [PubMed] [Google Scholar]
  • 12.Wei Y, Chen S, Sun D, et al. miR-223-3p promotes autoreactive Th17 cell responses in experimental autoimmune uveitis (EAU) by inhibiting transcription factor FOXO3 expression. FASEB J. 2019;33:13951–13965. [DOI] [PubMed] [Google Scholar]
  • 13.Han F, Guo H, Wang LY, et al. TSLP produced by aspergillus fumigatus-stimulated DCs promotes a Th17 response through the JAK/STAT signaling pathway in fungal keratitis. Invest Ophthalmol Vis Sci. 2020;61:24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Chen Y, Shao C, Fan NW, et al. The functions of IL-23 and IL-2 on driving autoimmune effector T-helper 17 cells into the memory pool in dry eye disease. Mucosal Immunol. 2021;14:177–186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Garbutcheon-Singh KB, Carnt N, Pattamatta U, et al. A review of the cytokine IL-17 in ocular surface and corneal disease. Curr Eye Res. 2019;44:1–10. [DOI] [PubMed] [Google Scholar]
  • 16.Liu R, Gao C, Chen H, et al. Analysis of Th17-associated cytokines and clinical correlations in patients with dry eye disease. PLoS One. 2017;12:e0173301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Tan X, Sun S, Liu Y, et al. Analysis of Th17-associated cytokines in tears of patients with dry eye syndrome. Eye (Lond). 2014;28:608–613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bui TM, Wiesolek HL, Sumagin R. ICAM-1: a master regulator of cellular responses in inflammation, injury resolution, and tumorigenesis. J Leukoc Biol. 2020;108:787–799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zhang J, Zhang R, Zhao Z. Changes of autoantibodies and intercellular adhesion molecule-1 in patients with Grave's disease after clinical treatment. Am J Transl Res. 2021;13:5101–5106. [PMC free article] [PubMed] [Google Scholar]
  • 20.Ward SK, Wakamatsu TH, Dogru M, et al. The role of oxidative stress and inflammation in conjunctivochalasis. Invest Ophthalmol Vis Sci. 2010;51:1994–2002. [DOI] [PubMed] [Google Scholar]
  • 21.Di Zazzo A, Micera A, Coassin M, et al. InflammAging at ocular surface: clinical and biomolecular analyses in healthy volunteers. Invest Ophthalmol Vis Sci. 2019;60:1769–1775. [DOI] [PubMed] [Google Scholar]
  • 22.Cagini C, Di Lascio G, Torroni G, et al. Dry eye and inflammation of the ocular surface after cataract surgery: effectiveness of a tear film substitute based on trehalose/hyaluronic acid vs hyaluronic acid to resolve signs and symptoms. J Cataract Refract Surg. 2021;47:1430–1435. [DOI] [PubMed] [Google Scholar]
  • 23.Laoye O, Adeoye AA, Onakpoya OH, et al. Relationship between ocular surface disease and patient's satisfaction among cataract surgical patients in Nigeria. Int Ophthalmol. 2021;41:3163–3170. [DOI] [PubMed] [Google Scholar]
  • 24.Pellegrini M, Bernabei F, Moscardelli F, et al. Assessment of corneal fluorescein staining in different dry eye subtypes using digital image analysis. Transl Vis Sci Technol. 2019;8:34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ostrowska-Podhorodecka Z, McCulloch CA. Vimentin regulates the assembly and function of matrix adhesions. Wound Repair Regen. 2021;29:602–612. [DOI] [PubMed] [Google Scholar]
  • 26.Komuro A, Yokoi N, Kato H, et al. The relationship between subjective symptoms and quality of life in conjunctivochalasis patients. Diagnostics (Basel). 2021;11:179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Tiffany L, Sepideh S, Charles GE, et al. Clinicopathologic analysis of conjunctivochalasis and pastepinch-cut conjunctivoplasty for management. Can J Ophthalmol. 2021;4182:1–5. [DOI] [PubMed] [Google Scholar]
  • 28.Farah Izati A, Wong KK, Che Maraina CH. IL-23/IL-17 axis in the pathogenesis and treatment of systemic lupus erythematosus and rheumatoid arthritis. Malays J Pathol. 2020;42:333–347. [PubMed] [Google Scholar]
  • 29.Li Q, Shan Q, Sang X, et al. Total glycosides of peony protects against inflammatory bowel disease by regulating IL-23/IL-17 axis and Th17/Treg balance. Am J Chin Med. 2019;47:177–201. [DOI] [PubMed] [Google Scholar]
  • 30.Yazdani MR, Aflaki E, Gholijani N. Inflammatory and T helper 17/regulatory T cells related cytokines balance in Cutaneous Lupus Erythematosus (CLE). Iran J Allergy Asthma Immunol. 2020;19:9–17. [DOI] [PubMed] [Google Scholar]
  • 31.Amatya N, Garg AV, Gaffen SL. IL-17 signaling: the yin and the yang. Trends Immunol. 2017;38:310–322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.McGeachy MJ, Cua DJ, Gaffen SL. The IL-17 family of cytokines in health and disease. Immunity. 2019;50:892–906. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Park HJ, Yuk CM, Shin K, et al. Interleukin-17A negatively regulates lymphangiogenesis in T helper 17 cell mediated inflammation. Mucosal Immunol. 2018;11:590–600. [DOI] [PubMed] [Google Scholar]
  • 34.Verstappen GM, Corneth OB, Bootsma H, et al. Th17 cells in primary Sjögren’s syndrome: pathogenicity and plasticity. J Autoimmun. 2018;87:16–25. [DOI] [PubMed] [Google Scholar]
  • 35.De Paiva CS, Chotikavanich S, Pangelinan SB, et al. IL-17 disrupts corneal barrier following desiccating stress. Mucosal Immunol. 2009;2:243–253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Yu M, Lee SM, Lee H, et al. Neurokinin-1 receptor antagonism ameliorates dry eye disease by inhibiting antigen-presenting cell maturation and T helper 17 cell activation. Am J Pathol. 2020;190:125–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Chen Y, Chauhan SK, Lee HS, et al. Chronic dry eye disease is principally mediated by effector memory Th17 cells. Mucosal Immunol. 2014;7:38–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ma K, Liu J, Sha Y, et al. Qi Jing Mingmu decoction inhibits the p38 signaling pathway in conjunctivochalasis fibroblasts by down-regulation of Th17 cell differentiation. J Ethnopharmacol. 2023;301:115812. [DOI] [PubMed] [Google Scholar]
  • 39.Roussel L, Houle F, Chan C, et al. IL-17 promotes p38 MAPK-dependent endothelial activation enhancing neutrophil recruitment to sites of inflammation. J Immunol. 2010;184:4531–4537. [DOI] [PubMed] [Google Scholar]
  • 40.Ghoreschi K, Balato A, Enerbäck C, et al. Therapeutics targeting the IL-23 and IL-17 pathway in psoriasis. Lancet. 2021;397:754–766. [DOI] [PubMed] [Google Scholar]
  • 41.Schinocca C, Rizzo C, Fasano S, et al. Role of the IL-23/IL-17 pathway in rheumatic diseases: an overview. Front Immunol. 2021;12:637829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tiong KI, Mohd Zahidin AZ, Sumugam SKA, et al. Evaluation of interleukin-17 and interleukin-23 in pterygium: immunohistochemistry study. Asia Pac J Ophthalmol (Phila). 2017;6:403–406. [DOI] [PubMed] [Google Scholar]
  • 43.Kharwar NK, Prasad KN, Singh K, et al. Polymorphisms of IL-17 and ICAM-1 and their expression in Guillain-Barré syndrome. Int J Neurosci. 2017;127:680–687. [DOI] [PubMed] [Google Scholar]

Articles from Cornea are provided here courtesy of Wolters Kluwer Health

RESOURCES