Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Apr 2.
Published in final edited form as: J Vis Exp. 2023 Mar 17;(193):10.3791/65033. doi: 10.3791/65033

Adipocyte-Specific ATAC-Seq with Adipose Tissues Using Fluorescence-Activated Nucleus Sorting

Kyungchan Kim 1, Solaema Taleb 1, Jisun So 1, Jamie Wann 1, Hyun Cheol Roh 1
PMCID: PMC10985705  NIHMSID: NIHMS1972712  PMID: 37010301

Abstract

Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) is a robust technique that enables genome-wide chromatin accessibility profiling. This technique has been useful for understanding the regulatory mechanisms of gene expression in a range of biological processes. Although ATAC-seq has been modified for different types of samples, there have not been effective modifications of ATAC-seq methods for adipose tissues. Challenges with adipose tissues include the complex cellular heterogeneity, large lipid content, and high mitochondrial contamination. To overcome these problems, we have developed a protocol that allows adipocyte-specific ATAC-seq by employing fluorescence-activated nucleus sorting with adipose tissues from the transgenic reporter Nuclear tagging and Translating Ribosome Affinity Purification (NuTRAP) mouse. This protocol produces high-quality data with minimal wasted sequencing reads while reducing the amount of nucleus input and reagents. This paper provides detailed step-by-step instructions for the ATAC-seq method validated for the use of adipocyte nuclei isolated from mouse adipose tissues. This protocol will aid in the investigation of chromatin dynamics in adipocytes upon diverse biological stimulations, which will allow for novel biological insights.

Introduction

Adipose tissue, which is specialized for storing excess energy in the form of lipid molecules, is a key organ for metabolic regulation. The strict control of adipocyte formation and maintenance is vital for adipose tissue function and whole-body energy homeostasis1. Many transcriptional regulators play a critical role in the control of adipocyte differentiation, plasticity, and function; some of these regulators are implicated in metabolic disorders in humans2, 3 . Recent advances in high-throughput sequencing techniques for gene expression and epigenomic analysis have further facilitated the discovery of the molecular regulators of adipocyte biology4. Molecular profiling studies using adipose tissues are challenging to conduct due to the heterogeneity of these tissues. Adipose tissue consists primarily of adipocytes, which are responsible for fat storage, but also contains various other cell types, such as fibroblasts, endothelial cells, and immune cells5. In addition, the cellular composition of adipose tissue is dramatically altered in response to pathophysiological changes such as temperature and nutritional status6. To overcome these problems, we previously developed a transgenic reporter mouse, named Nuclear Tagging and Translating Ribosome Affinity Purification (NuTRAP), which produces GFP-tagged ribosomes and mCherry-tagged biotinylated nuclei in a Cre recombinase-dependent manner7. The dual-labeling system enables one to perform cell type-specific transcriptomic and epigenomic analysis with tissues. Using NuTRAP mice crossed with adipocyte-specific adiponectin-Cre lines (Adipoq-NuTRAP), we previously characterized gene expression profiles and chromatin states from pure adipocyte populations in vivo and determined how they are altered during obesity7 , 8 . Previously, NuTRAP mice crossed with brown and beige adipocyte-specific Ucp1-Cre lines (Ucp1-NuTRAP) allowed us to characterize the epigenomic remodeling of the rare thermogenic adipocyte population, beige adipocytes, in response to temperature changes9.

ATAC-seq is a widely used analytical method to assess genome-wide chromatin accessibility.The hyper-reactive Tn5 transposase used in ATAC-seq allows for the identification of open chromatin regions by tagging sequencing adapters in the chromatin-accessible region of nuclei10. ATAC-seq is a simple method, yet it provides robust results and is highly efficient even with low-input samples. It has, thus, become one of the most popular epigenomic profiling methods and has contributed to the understanding of the regulatory mechanisms of gene expression within diverse biological contexts. Since the original ATAC-seq protocol was created, various ATAC-seq-derived techniques have been further developed to modify and optimize the protocol for various types of samples. For example, Fast-ATAC is designed for analyzing blood cell samples11, Omni-ATAC is an optimized protocol for frozen tissue samples12, and MiniATAC-seq is effective for early-stage embryo analysis13. However, applying the ATAC-seq method to adipocytes, especially from tissue samples, is still challenging. In addition to the heterogeneity of adipose tissue, its high lipid content may interfere with efficient recombination reactions by Tn5 transposase even after nucleus isolation. Furthermore, the high mitochondrial content in adipocytes, particularly in brown and beige adipocytes, causes high mitochondrial DNA contamination and wasted sequencing reads. This paper describes a protocol for adipocyte-specific ATAC-seq using Adipoq-NuTRAP mice (Figure 1). By taking advantage of fluorescence-labeled nucleus sorting, this protocol allows the collection of pure populations of adipocyte nuclei away from other confounding cell types and the efficient removal of lipids, mitochondria, and tissue debris. Hence, this protocol can generate cell type-specific high-quality data and minimize waste from mitochondrial reads while using a reduced amount of input and reagents compared to the standard protocol.

Figure 1: A schematic flowchart of adipocyte-specific ATAC-seq using NuTRAP mice.

Figure 1:

The steps unique to this protocol are highlighted in the red shaded boxes.

Protocol

Animal care and experimentation were performed according to procedures approved by the Institutional Animal Care and Use Committee of Indiana University School of Medicine.

1. Preparations before beginning the experiment

  1. Tissue preparation

    1. For adipocyte nucleus labeling, cross NuTRAP mice with adipocyte-specific adiponectin-Cre lines (Adipoq-Cre) to generate Adipoq-NuTRAP mice, which are hemizygous for both Adipoq-Cre and NuTRAP.

    2. Dissect the adipose tissues of interest from the Adipoq-NuTRAP mice as described previously14.

    3. Snap-freeze the tissues in liquid nitrogen, and store them at −80 °C until use.

      NOTE: Each fat pad can be stored as a whole, and the frozen tissues can be later cut on dry ice into smaller pieces (~50 mg) for experiments. Alternatively, the fat tissues can be cut, aliquoted, and frozen in tubes for storage (~50 mg per tube). Frozen samples are never allowed to thaw after freezing until use.

  2. Buffer preparation

    NOTE: Keep the buffers on ice throughout the experiment.

    1. Prepare nucleus preparation buffer (NPB): 250 mM sucrose, 10 mM HEPES (pH 7.5), 10 mM KCl, 1.5 mM MgCl2, and 0.1% NP40. Prepare 7 mL of NPB per sample. Add fresh 100x protease inhibitor cocktail (final 1x), DTT (final 1 mM), and Hoechst (final 1 μg/mL) to the NPB before use.

      NOTE: It is recommended to prepare fresh NPB, but it can be stored at 4 °C for up to 1 month.

    2. Prepare 1x phosphate-buffered saline with 0.1% NP-40 (PBS-N).

2. Nucleus isolation

  1. Chill glass Dounce homogenizers, with one glass Dounce per sample, on ice. Then, add 7 mL of the NPB mix to each glass Dounce.

    NOTE: It is recommended to use up to eight samples in each experiment. Working with more than eight samples would significantly delay all the steps, and it may especially downgrade the nucleus quality during sorting.

  2. Put the frozen adipose tissue (50–100 mg) in the glass Dounce, and immediately cut it into a few smaller pieces using a long pair of scissors. Stroke 10x with a loose pestle for all the samples, and then 10x with a tight pestle.

    NOTE: Adipose tissues are soft, so cutting them into a few small pieces should be sufficient. For rare samples, smaller pieces (10–20 mg) can be used, although the collected adipocyte nucleus number may vary.

  3. Filter through a 100 μm strainer into a new 50 mL tube. Move the filtered homogenates to a new 15 mL tube by pouring. Spin at 200 × g for 10 min at 4 °C in a swing-bucket centrifuge. Remove the supernatant as much as possible.

    NOTE: Aspirate first using a vacuum, and then remove the remaining volume by using a micropipette.

  4. Resuspend the pellet in 500 μL of PBS-N by gentle but thorough finger tapping.

    NOTE: Avoid pipetting, as this may damage the nuclei.

  5. Filter through a 40 μm strainer into a new 50 mL tube using gentle pipetting. Rinse the strainer with 250 μL of PBS-N. Transfer the filtered nuclear resuspension to a fluorescence-activated cell sorting (FACS) tube using a micropipette.

    NOTE: If available, tubes and cell strainers can be used for smaller volumes to minimize sample loss.

3. Nucleus sorting

  1. Collection tube preparation
    1. Add 500 μL of PBS-N to new 1.5 mL tubes, and invert a few times to wet all inner surfaces with the buffer.
    2. Briefly spin the tubes to bring down all the liquid, and then chill them on ice until sorting.
  2. FACS (Figure 2)
    1. Use the FSC-A/FSC-H gating for singlets and FSC-A/SSC-A for small or large debris removal.
    2. Gate for the mCherry/GFP-positive adipocyte nucleus population.
    3. Collect 10,000 nuclei in each of the collection tubes prepared in step 3.1.
  3. Post-sorting nucleus preparation

    1. Add 500 μL of PBS-N to each collection tube, and invert a few times to mix.

    2. Spin the collection tubes at 200 × g for 10 min at 4 °C in a swing-bucket centrifuge. Completely remove the supernatant.

      NOTE: Use a vacuum first to remove bubbles, pour off the supernatant, and use paper wipes to remove the remaining liquid completely. The pellet is invisible at this point. Prepare the Tn5 master mixture during the centrifugation step as described below.

Figure 2: Representative FACS gating illustrating the isolation of mCherry/GFP-tagged adipocyte nuclei from the adipose tissues of an Adipoq-NuTRAP mouse.

Figure 2:

(A-C) Flow cytometry analysis of isolated nuclei from the eWAT, iWAT, and BAT of an Adipoq-NuTRAP mouse.(D) Quantitative analysis of nuclei from adipocytes and non-adipocytes in the eWAT, iWAT, and BAT of an Adipoq-NuTRAP mouse. Data are mean ± SEM (n = 3). These nuclei count data are from Roh et al.7. Abbreviations: FACS = fluorescence-activated cell sorting; GFP = green fluorescent protein; eWAT = epididymal white adipose tissue; iWAT = inguinal white adipose tissue; BAT = brown adipose tissue; NuTRAP = nuclear tagging and translating ribosome affinity purification; Adipoq-NuTRAP = NuTRAP mouse crossed with adipocyte-specific adiponectin-Cre line; FSC-A = forward scatter-peak area; FSC-H = forward scatter-peak height; SSC-A = side scatter-peak area; FITC-A = fluorescein isothiocyanate-peak area.

4. Tn5 Tagmentation (Table 1)

Table 1:

Components of the Tn5 master mixture.

2X Tagmentation DNA buffer 12.5 μL
TDE I enzyme 1.25 μL
Nuclease-free water 11.25 μL
Total 25 μL
  1. To prepare 25 μL of Tn5 master mixture, mix 12.5 μL of 2x tagmentation DNA buffer (TD buffer), 1.25 μL of Tn5 transposase (TDE I enzyme), and 11.25 μL of nuclease-free water.

  2. Add 25 μL of Tn5 master mixture to each nucleus pellet, and resuspend by gentle pipetting. Incubate at 600 rpm for 30 min at 37 °C using a thermomixer.

5. DNA purification

NOTE: The following procedure uses the PCR purification kit mentioned in the Table of Materials. Any other similar DNA purification methods can be used.

Table of Materials

Animals
Name Company Catalog Number
Adiponectin-Cre mouse The Jackson Laboratory 28020
NuTRAP mouse The Jackson Laboratory 29899
     
Reagents & Materials    
Name Company Catalog Number
1.5 mL DNA-LoBind tubes Eppendorf 86–923
100 µm cell strainer Falcon 352–360
15 mL tubes VWR 525–1071
2X TD buffer Illumina 15027866
384-well PCR plate Applied biosystem 4483285
40 µm cell strainer Falcon 352–340
50 mL tubes VWR 525–1077
AMPure XP reagent (SPRI beads) Beckman Coulter A63881
Bioanalyzer High Sensitivity DNA kit Agilent Technologies 5067–4626
Clear adhesive film Applied biosystem 4306311
DNase/RNase-free distilled water Invitrogen 10977015
Dounce tissue grinder DWK Life Sciences 357542
DTT Sigma D9779
DynaMag-96 side skirted magnet Thermo Fishers 12027
FACS tubes Falcon 28719128
HEPES Boston BioProducts BBH-75
Hoechst 33342 Invitrogen 2134015
KCl (2 M) Boston BioProducts MT-252
Magnetic separation rack for PCR 8-tube strips EpiCypher 10–0008
MgCl2 (1 M) Boston BioProducts MT-200
MinElute PCR purification kit Qiagen 28004
NEBNext High-Fidelity 2X PCR master mix BioLabs M0541S
NP40 Thermo Fishers 28324
PCR 8-tube strip USA scientific 1402–4708
Protease inhibitor cocktail (100X) Thermo Fishers 78439
Qubit dsDNA HS assay kit Invitrogen Q32851
Sucrose Sigma S0389–1KG
SYBR Green I (10,000X) Invitrogen S7563
TDE I enzyme Illumina 15027865
     
Instruments    
Name Company Catalog Number
Flow cytometer BD Biosciences FACSAria™ Fusion
Qubit fluorometer Invitrogen Q33226
Real-Time PCR system Thermo Fishers QuantStudio 5
  1. Add 25 μL of nuclease-free water to the 25 μL of the mixture of Tn5 nucleus resuspension obtained after step 4.2. The final volume is 50 μL per sample.

  2. Add 250 μL of buffer PB.

  3. Add 5 μL of 3 M sodium acetate (NaOAc) (pH 5.2).

  4. Transfer the mixture to a column (provided with the referenced kit), and centrifuge at 17,900 × g for 1 min at room temperature (RT).

  5. Discard the flowthrough, and place the spin column back in the same collection tube. Add 750 μL of buffer PE containing absolute ethanol (EtOH), and centrifuge at 17,900 × g for 1 min at RT.

  6. Discard the flowthrough, and place the spin column back into the same collection tube. Centrifuge at 17,900 × g for 1 min at RT, and discard the collection tube with the flowthrough.

  7. To elute the DNA fragments, equip the column with a new 1.5 mL tube, add 10 μL of buffer EB, and leave at RT for 3 min. Centrifuge at 17,900 × g for 1 min at RT.

    NOTE: The samples can be stored at 4 °C for days or at −20 °C for weeks.

6. PCR amplification (Table 2)

Table 2:

Components of the PCR master mixture and initial PCR cycling conditions.

Eluted Transposed DNA 10 µL
Primer #1 (Ad1 noMX) 25 µM 2 µL
Primer #2 (Ad2.n barcoded) 25 µM 2 µL
NEBNext HF 2x PCR mix 25 µL
H 2 O 11 µL
Total 50 µL
       
Steps Temperature Time Cycles
Initial chain displacement 72 °C 5 min 1
Initial denaturation 98 °C 30 s 1
Denaturation 98 °C 10 s 5
Annealing 63 °C 30 s 5
Elongation 72 °C 1 min 5
Hold 4 °C Forever

NOTE: The primers used in this study are listed in Table 3.

Table 3:

List of the barcoded primers for PCR amplification.

Primer name Index sequence Primer sequence
Ad1_noMX N/A AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Ad2.1 TAAGGCGA CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
Ad2.2 CGTACTAG CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT
Ad2.3 AGGCAGAA CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT
Ad2.4 TCCTGAGC CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT
Ad2.5 GGACTCCT CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT
Ad2.6 TAGGCATG CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGAGATGT
Ad2.7 CTCTCTAC CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGGCTCGGAGATGT
Ad2.8 CAGAGAGG CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGGCTCGGAGATGT
Ad2.9 GCTACGCT CAAGCAGAAGACGGCATACGAGATAGCGTAGCGTCTCGTGGGCTCGGAGATGT
Ad2.10 CGAGGCTG CAAGCAGAAGACGGCATACGAGATCAGCCTCGGTCTCGTGGGCTCGGAGATGT
Ad2.11 AAGAGGCA CAAGCAGAAGACGGCATACGAGATTGCCTCTTGTCTCGTGGGCTCGGAGATGT
Ad2.12 GTAGAGGA CAAGCAGAAGACGGCATACGAGATTCCTCTACGTCTCGTGGGCTCGGAGATGT
Ad2.13 GTCGTGAT CAAGCAGAAGACGGCATACGAGATATCACGACGTCTCGTGGGCTCGGAGATGT
Ad2.14 ACCACTGT CAAGCAGAAGACGGCATACGAGATACAGTGGTGTCTCGTGGGCTCGGAGATGT
Ad2.15 TGGATCTG CAAGCAGAAGACGGCATACGAGATCAGATCCAGTCTCGTGGGCTCGGAGATGT
Ad2.16 CCGTTTGT CAAGCAGAAGACGGCATACGAGATACAAACGGGTCTCGTGGGCTCGGAGATGT
Ad2.17 TGCTGGGT CAAGCAGAAGACGGCATACGAGATACCCAGCAGTCTCGTGGGCTCGGAGATGT
Ad2.18 GAGGGGTT CAAGCAGAAGACGGCATACGAGATAACCCCTCGTCTCGTGGGCTCGGAGATGT
Ad2.19 AGGTTGGG CAAGCAGAAGACGGCATACGAGATCCCAACCTGTCTCGTGGGCTCGGAGATGT
Ad2.20 GTGTGGTG CAAGCAGAAGACGGCATACGAGATCACCACACGTCTCGTGGGCTCGGAGATGT
Ad2.21 TGGGTTTC CAAGCAGAAGACGGCATACGAGATGAAACCCAGTCTCGTGGGCTCGGAGATGT
Ad2.22 TGGTCACA CAAGCAGAAGACGGCATACGAGATTGTGACCAGTCTCGTGGGCTCGGAGATGT
Ad2.23 TTGACCCT CAAGCAGAAGACGGCATACGAGATAGGGTCAAGTCTCGTGGGCTCGGAGATGT
Ad2.24 CCACTCCT CAAGCAGAAGACGGCATACGAGATAGGAGTGGGTCTCGTGGGCTCGGAGATGT
Ad2.25 GCTCATGA CAAGCAGAAGACGGCATACGAGATTCATGAGCGTCTCGTGGGCTCGGAGATGT
Ad2.26 ATCTCAGG CAAGCAGAAGACGGCATACGAGATCCTGAGATGTCTCGTGGGCTCGGAGATGT
Ad2.27 ACTCGCTA CAAGCAGAAGACGGCATACGAGATTAGCGAGTGTCTCGTGGGCTCGGAGATGT
Ad2.28 GGAGCTAC CAAGCAGAAGACGGCATACGAGATGTAGCTCCGTCTCGTGGGCTCGGAGATGT
Ad2.29 GCGTAGTA CAAGCAGAAGACGGCATACGAGATTACTACGCGTCTCGTGGGCTCGGAGATGT
Ad2.30 TACGCTGC CAAGCAGAAGACGGCATACGAGATGCAGCGTAGTCTCGTGGGCTCGGAGATGT
Ad2.31 ATGCGCAG CAAGCAGAAGACGGCATACGAGATCTGCGCATGTCTCGTGGGCTCGGAGATGT
Ad2.32 TAGCGCTC CAAGCAGAAGACGGCATACGAGATGAGCGCTAGTCTCGTGGGCTCGGAGATGT
Ad2.33 ACTGAGCG CAAGCAGAAGACGGCATACGAGATCGCTCAGTGTCTCGTGGGCTCGGAGATGT
Ad2.34 CCTAAGAC CAAGCAGAAGACGGCATACGAGATGTCTTAGGGTCTCGTGGGCTCGGAGATGT
Ad2.35 CGATCAGT CAAGCAGAAGACGGCATACGAGATACTGATCGGTCTCGTGGGCTCGGAGATGT
Ad2.36 TGCAGCTA CAAGCAGAAGACGGCATACGAGATTAGCTGCAGTCTCGTGGGCTCGGAGATGT
Ad2.37 TCGACGTC CAAGCAGAAGACGGCATACGAGATGACGTCGAGTCTCGTGGGCTCGGAGATGT
  1. To amplify transposed DNA fragments, prepare PCR master mixture without adding a unique Ad2.n barcoding primer (primer #2). Use 38 μL of the PCR master mixture per sample: 11 μL of nuclease-free water, 2 μL of 25 μM Ad1_noMX primer (primer #1), and 25 μL of 2x PCR Master Mix.

  2. Add 38 μL of the PCR master mixture into a 0.2 mL PCR tube.

  3. Add 10 μL of the eluted DNA fragments from step 5.7.

  4. Add 2 μL of 25 μM primer #2, which needs to be specific for each sample.

  5. Run the PCR according to the cycling conditions indicated in Table 2.

7. Real-time quantitative PCR (qPCR) test (Table 4)

Table 4:

Components of the qPCR master mixture.

PCR amplified DNA 5 µL
Primer 1 (Ad1 no MX) 25 µM 0.25 µL
Primer 2 (Ad2.n barcoded) 0.25 µL
100X SYBR GR I 0.09 µL
NEBNext High-Fidelity 2X PCR mix 5 µL
H2O 4.41 µL
Total 15 µL

NOTE: This step aims to determine the additional cycles needed to amplify the DNA. It is optional but highly recommended, especially for new experiments.

  1. Prepare qPCR master mixture without adding primer #2. Use 9.975 μL of the qPCR master mixture per sample: 4.41 μL of nuclease-free water, 0.25 μL of 25 μM primer #1, 5 μL of 2x PCR Master Mix, and 0.09 μL 100x SYBR Green I.

    NOTE: To prepare 100x SYBR Green I, dilute the 10,000x stock with nuclease-free water. As the volume of 100x SYBR Green I used for the qPCR master mixture is negligible, it is easier to make an additional master mixture of diluted 100x SYBR Green I (e.g., for 8–10 samples).

  2. Add 9.975 μL of the qPCR master mixture into each well of a qPCR plate.

  3. Add 0.25 μL of 25 μM primer #2 into each well.

    NOTE: Be sure to add the same primer #2 to match what was added to each specific sample in step 6.4.

  4. Add 5 μL of the PCR reaction obtained after the PCR amplification in step 6.5, and mix by pipetting.

    NOTE: The remaining 45 μL of the PCR reaction will be used for the second PCR amplification.

  5. Run the qPCR according to the cycling conditions indicated in Table 5.

  6. Check the amplification curves, and identify the number of additional PCR cycles needed by estimating the number of cycles that reached ~35% of the maximum (Figure 3A).

    NOTE: Typically, 10,000 nuclei require five to eight additional PCR cycles.

Table 5:

qPCR cycling conditions.

Steps Temperature Time Cycles
Initial denaturation 98 °C 30 s 1
Denaturation 98 °C 10 s 20
Annealing 63 °C 30 s
Elongation 72 °C 1 min
Hold 4 °C Forever

Figure 3: Representative amplification curves from qRT-PCR.

Figure 3:

(A) Good-quality sample that needs seven additional amplification cycles. (B) Poor-quality sample that need ≥15 additional cycles. Abbreviation: qRT-PCR = quantitative reverse transcription PCR.

8. Additional PCR amplification

  1. Run the PCR using all of the remaining 45 μL of the PCR reaction according to the calculations from step 7.6 (Table 6).

    NOTE: Each sample could require a different number of amplification cycles.

Table 6:

Second PCR cycling conditions for additional amplification.

Steps Temperature Time Cycles
Initial denaturation 98 °C 30 s 1
Denaturation 98 °C 10 s Total cycles
Annealing 63 °C 30 s calculated from step 7.6
Elongation 72 °C 1 min
Hold 4 °C Forever

9. Second DNA purification using the PCR purification kit

  1. Use the same procedures as in section 5, but elute the amplified DNA fragments with 20 μL of buffer EB.

10. DNA fragment size selection

NOTE: Use solid phase reversible immobilization beads, as described below. Any other similar DNA purification beads can be used according to the manufacturer’s instructions. The SPRI bead suspension should be completely resuspended and equilibrated at RT with rotation before use.

  1. Transfer the eluted DNA to a new PCR tube, and add 80 μL of buffer EB to make a final volume of 100 μL.

  2. Add 55 μL of SPRI beads (0.55x sample volume), and mix by pipetting. Incubate for 5 min at RT, and then separate on a mini magnetic stand for PCR 8-tube strips for 5 min.

  3. Transfer 150 μL of the supernatant to a new PCR tube. Add 95 μL of SPRI beads, and mix by pipetting.

    NOTE: The supernatant contains DNA of approximately 500 bp or smaller.

  4. Incubate for 5 min at RT, and then separate on the mini magnetic stand for 5 min. Discard the supernatant carefully.

  5. Wash the beads for 1 min with 200 μL of 70% EtOH. Repeat twice for three washes in total.

    NOTE: Do not move PCR tubes from the magnetic stand during the washes.

  6. After the final wash, spin down the tubes at 1,000 × g for 1 min, and pipet out the remaining EtOH. Dry the pellet with the lid open at 37 °C for 2 min on a PCR machine.

    NOTE: The bead pellets should display only some minor cracks once dried. Avoid over-drying.

  7. Resuspend the pellet with 20 μL of buffer EB by pipetting, and incubate for 5 min at RT. Separate on the mini magnetic stand for 5 min, and then transfer 18 μL of the supernatant containing the final library to a new 1.5 mL tube.

    NOTE The library can be stored at −20 °C while performing a quality check.

11. DNA quantification using a fluorometer

  1. To prepare the master mixture, dilute 200x dsDNA High Sensitivity (HS) reagent with dsDNA HS buffer to a final concentration of 1x.

  2. For standards, add 190 μL of the 1x master mixture and 10 μL of standard 1 or standard 2 to a fluorometer tube.

    NOTE: Equilibrate the standards at RT in the dark before starting the quantification.

  3. For the library samples, add 198 μL of the 1x master mixture and 2 μL of each sample to a separate fluorometer tube.

    NOTE: If the sample amounts are limited, the sample volume can be reduced to 1 μL, and the 1x master mixture volume can be increased to 199 μL.

  4. Vortex or shake the fluorometer tubes, and let them sit for 5 min at RT in the dark. Measure the DNA concentration using the dsDNA HS assay of the fluorometer.

12. Library quality check by high-sensitivity electrophoresis systems

  1. Take the ATAC-seq library, and dilute with nuclease-free water to a final concentration of 1–5 ng/μL.

  2. Analyze the size distribution of the ATAC-seq libraries using high-sensitivity, automated electrophoresis systems following the manufacturer’s protocols.

13. Quality check of the ATAC-seq library by using targeted qPCR

  1. Take 5–10 ng of the ATAC-seq library, and dilute with 50 μL of nuclease-free water.

  2. Run the qPCR using primers targeting the promoters and enhancers known to be active in adipocytes according to the cycling conditions indicated in Table 7.

  3. Use negative control primers targeting closed/silent genomic regions (Table 7).

  4. Calculate the enrichment of the promoter/enhancers over the negative controls (Table 8).

    NOTE: It is expected to see ≥10–20-fold enrichments with successful samples.

Table 7:

Primer sequences and targeted qPCR cycling conditions for the quality check of the ATAC-seq library.

Gene Sequences (Forward) Sequences (Reverse)
Negative control 1 TGCAAATGGCAAAATAGCTCGT CCACACGTCCAGTGATTTGC
Negative control 2 TACCAATGTCCACCCTCTGA TGCTTACACCTCAGCAGGAC
Adipoq TCACTTCTAGTCGCTAAGCAAG TCAATACTTTGCTGGGTCTGG
Fabp4 GGTCACATCTCAGAATCTCAGG ACAGGCAAAGGTTAGAAGGATG
Plin1 CTAGGATGTGGGTGAAAGGTG TCAAGACCTCTGCTCTCCTG
Pnpla2 GTAGGTGATGGTTGAAGTAGGTC TGAGTCACTGTGCCTAACATG
Ucp1 GCCCTTGGATTGGCTGAAGA CCACATGCTCAGGACACCAT
       
Steps Temperature Time Cycles
Hold Stage 50°C 2 min 1
95°C 10 min
PCR Stage 95°C 15 s 40
60°C 1 min
Melt Curve Stage 95°C 15 s 1
60°C 1 min
95°C 15 s

Table 8:

Analysis of the qPCR results for the quality check.

Raw Ct values
NC1 NC2 Adipoq Fabp4 Plin1 Pnpla2
eWAT 1 28.97360516 29.1767311 21.8443975 23.8591576 25.0069361 21.7385616
eWAT 2 29.01209068 28.9158125 22.0090828 24.0115328 25.2831001 22.0457344
iWAT 1 30.67526627 30.9066448 21.9058771 24.0909586 25.1765642 21.9324293
iWAT 2 29.73054695 30.0138845 22.1776199 24.9327497 26.8281002 23.2821865
BAT 1 31.03091812 31.4215002 23.4410648 25.7339334 27.1350803 23.389307
BAT 2 31.88665962 32.3051062 24.0364552 26.9744196 28.2373838 23.8191948
             
Caculation of the enrichment of the targeted regions over negative control (NC) 1
: 2 ^ -[ Ct (gene of interest) – Ct (negative control 1) ]
NC1 NC2 Adipoq Fabp4 Plin1 Pnpla2
eWAT 1 1 0.86866634 139.992683 34.6419346 15.6345857 150.648607
eWAT 2 1 1.06901211 128.267147 32.012377 13.2598317 125.049569
iWAT 1 1 0.85182055 436.364266 95.9564361 45.2141378 428.406617
iWAT 2 1 0.82168789 187.783568 27.8151157 7.47693373 87.3272766
BAT 1 1 0.76282177 192.651991 39.3143657 14.8855207 199.689006
BAT 2 1 0.74822987 230.75282 30.1114448 12.5470455 268.255665

14. Sequencing

  1. Submit the ATAC-seq libraries for sequencing. Use paired-end sequencing (2 × 34 bp, 2 × 50 bp or longer) with average read numbers of 10–30 million reads per sample.

Representative Results

To analyze adipose tissue using this ATAC-seq protocol, we generated Adipoq-NuTRAP mice that were fed chow diets; we then isolated adipocyte nuclei from epididymal white adipose tissue (eWAT), inguinal white adipose tissue (iWAT), and brown adipose tissue (BAT) by using flow cytometry. The isolated nuclei were used for tagmentation, followed by DNA purification, PCR amplification, quality check steps, sequencing, and data analysis, as described above. The purpose of this representative experiment was to profile the chromatin accessibility of pure adipocyte populations isolated from different fat depots.

We observed that the mCherry-labeled and GFP-labeled adipocyte nuclei were clearly distinguishable from the nuclei of other cell types isolated from the adipose tissues of an Adipoq-NuTRAP mouse using flow cytometry (Figure 2A–C). There were differences in the adipocyte fractions depending on the type of adipose depot: ~50% in eWAT, ~30% in iWAT, and ~65% in BAT (Figure 2D)7. We collected 10,000 nuclei within 2–10 min per sample and used them for the ATAC-seq procedures. We ran a total of 10–13 PCR cycles (five cycles of the first PCR and five to eight cycles of the second PCR, Figure 3A). If the samples require more than a total of 15 PCR cycles, this may indicate low-quality samples (Figure 3B). The size distribution analysis of the ATAC-seq libraries demonstrated multiple peaks corresponding to the nucleosome-free region (NFR) and mono, di, and multi-nucleosomes (Figure 4A–C), with average sizes of ~500–800 bp. Poor-quality samples typically showed mostly NFR with no or few nucleosomal peaks (Figure 4D). The quality check tests by the qRT-PCR analysis showed 10–20-fold enrichments with the positive genomic elements near adipocyte marker genes such as Adipoq, Fabp4, Plin1, and Pnpla2, while no enrichment was shown with the negative control (Figure 5). We also observed enrichment with the thermogenic gene Ucp1 specifically in BAT but not in eWAT or iWAT (Figure 5).

Figure 4: Size distribution profiles of the ATAC-seq libraries.

Figure 4:

(A-C) Good-quality and (D) poor-quality libraries are shown as representative results. Abbreviations: ATAC-seq = assay for transposase-accessible chromatin with high-throughput sequencing; FU = fluorescence units; bp = base pairs; NFR = nucleosome-free region; eWAT = epididymal white adipose tissue; iWAT = inguinal white adipose tissue; BAT = brown adipose tissue.

Figure 5: Quality control qPCR analysis of the ATAC-seq libraries.

Figure 5:

Enrichments for promoters and enhancers near the general adipocyte markers Adipoq, Fabp4, Plin1, and Pnpla2 or the brown adipocyte marker Ucp1. Abbreviations: ATAC-seq = assay for transposase-accessible chromatin with high-throughput sequencing; NC = negative control; eWAT = epididymal white adipose tissue; iWAT = inguinal white adipose tissue; BAT = brown adipose tissue. Data are mean ± SEM (n = 2).

After the sequencing and analysis, we identified ~55,000 peaks combined from three different adipose depots (eWAT, iWAT, and BAT). The mitochondrial reads were <2%, and the fraction under the peaks was ~18%−44% (Figure 6A, B). Poor-quality samples may have significantly higher mitochondria reads and/or a lower fraction of reads in the peak regions. Visual inspection of the ATAC-seq library tracks revealed multiple strong peaks with high signal-to-noise ratios near adipocyte marker genes, such as Adipoq, Plin1, and Fabp4, from all the adipose depots (Figure 7A–C). We also observed strong ATAC-seq peaks at the brown adipocyte maker Ucp1 locus in the BAT sample, but these peaks were not observed in the eWAT or iWAT samples (Figure 7D). All these data indicate successful ATAC-seq data generated from adipocyte nuclei.

Figure 6: Mitochondria reads and fractions under the peaks of the ATAC-seq libraries.

Figure 6:

(A) Mitochondria reads (%) and (B) fractions under the peaks (%) from eWAT, iWAT, and BAT. Abbreviations: ATAC-seq = assay for transposase-accessible chromatin with high-throughput sequencing; eWAT = epididymal white adipose tissue; iWAT = inguinal white adipose tissue; BAT = brown adipose tissue.

Figure 7: ATAC-seq signal tracks at the loci of representative genes.

Figure 7:

(A-C) General adipocyte marker genes. (B) Brown adipocyte-specific marker. Abbreviations: ATAC-seq = assay for transposase-accessible chromatin with high-throughput sequencing; eWAT = epididymal white adipose tissue; iWAT = inguinal white adipose tissue; BAT = brown adipose tissue.

Discussion

In this paper, we have presented an optimized ATAC-seq protocol to assess adipocyte-specific chromatin accessibility in vivo. This ATAC-seq protocol using the Adipoq-NuTRAP mouse successfully generated adipocyte-specific chromatin accessibility profiles. The most critical factor for successful and reproducible ATAC-seq experiments is nucleus quality. It is critical to immediately snap-freeze the dissected adipose tissues in liquid nitrogen and store them safely at −80 °C without thawing until use. It is also important to prevent adipocyte nucleus damage during nucleus isolation and sorting. The samples must be handled gently via low-speed centrifugation and minimal pipetting during the entire process of nuclei isolation.

Careful gating during nuclei sorting is crucial to selectively isolate the mCherry/GFP-tagged adipocyte nuclei (Figure 1). It is important to ensure a clear separation between the mCherry/GFP-positive and negative populations. Likewise, gentle handling and rapid sorting are necessary to preserve the nature of the chromatin in the nuclei. If the fluorescence is weak, sorting takes too long, and/or the adipocyte fractions are out of the anticipated ranges, this indicates that there may be issues with the samples or problems during the nuclei isolation procedures. This protocol can be modified depending on the experimental circumstances. First, the number of nuclei required for the ATAC-seq can go down to 1,000 or up to 100,000. If there are less than 5,000 nuclei, using a further reduced volume (0.6 μL) of the TDE I enzyme would prevent over-tagmentation. For numbers of nuclei equal to or higher than 50,000, the volume of the Tn5 master mixture can be doubled to 50 μL, which is the same volume as used in the original protocol10 .

Second, other nucleus labeling systems, such as INTACT (isolation of nuclei tagged in specific cell types) mice, can be used instead of NuTRAP mice16. As INTACT mice express GFP-tagged SUN1 nuclear membrane protein, GFP-tagged nuclei can be isolated by sorting and used for ATAC-seq using the same methods described in this protocol. Any other nuclear labeling methods can be adopted as well. Lastly, in vitro-cultured adipocytes can also be used for ATAC-seq following this protocol. For this, cells grown on dishes/plates are scraped, collected using NPB, and then subjected to the same downstream procedures-except that sorting should be done only based on size, complexity, and Hoechst, not mCherry/GFP as described previously15 .

This adipocyte-specific ATAC-seq protocol using the NuTRAP technique poses a limitation as it does not work without fluorescent labeling; thus, analyzing human samples will not work with this technique. However, it is still possible to perform ATAC-seq with adipocytes isolated by tissue digestion and flotation methods. It should be noted that working with human floater adipocytes has some limitations, such as contamination by other cell types when using low-speed centrifugation and the loss of large adipocytes when using higher-speed centrifugation. This protocol can be applied to any cell type for which specific Cre lines are available, allowing efficient cell type-specific chromatin profiling even with limited cell inputs17. In conclusion, this improved ATAC-seq protocol will be helpful to researchers wishing to evaluate chromatin accessibility from specific cell types within heterogeneous tissues ex vivo, in addition to the adipocytes we discussed here.

Acknowledgments

This work was supported by the IUSM Showalter Research Trust Fund (to H.C.R.), an IUSM Center for Diabetes and Metabolic Diseases Pilot and Feasibility grant (to H.C.R.), the National Institute of Diabetes and Digestive and Kidney Diseases (R01DK129289 to H.C.R.), and the American Diabetes Association Junior Faculty Award (7-21-JDF-056 to H.C.R.).

Footnotes

A complete version of this article that includes the video component is available at http://dx.doi.org/10.3791/65033.

Disclosures

The authors declare that they have no relevant or material financial interests relating to the research described in this paper.

References

  • 1.Sethi JK, Vidal-Puig AJ Thematic review series: Adipocyte biology. Adipose tissue function and plasticity orchestrate nutritional adaptation. Journal of Lipid Research 48 (6), 1253–1262 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Farmer SR Transcriptional control of adipocyte formation. Cell Metabolism 4 (4), 263–273 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bielczyk-Maczynska E White adipocyte plasticity in physiology and disease. Cells 8 (12), 1507 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Basu U, Romao JM, Guan LL Adipogenic transcriptome profiling using high throughput technologies. Journal of Genomics 1, 22–28 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Esteve Rafols M Adipose tissue: Cell heterogeneity and functional diversity. Endocrinologia y Nutricion 61 (2), 100–112 (2014). [DOI] [PubMed] [Google Scholar]
  • 6.Kwok KH, Lam KS, Xu A Heterogeneity of white adipose tissue: Molecular basis and clinical implications. Experimental and Molecular Medicine 48, e215 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Roh HC et al. Simultaneous transcriptional and epigenomic profiling from specific cell types within heterogeneous tissues in vivo. Cell Reports 18 (4), 1048–1061 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Roh HC et al. Adipocytes fail to maintain cellular identity during obesity due to reduced PPARγ activity and elevated TGFβ-SMAD signaling. Molecular Metabolism 42, 101086 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Roh HC et al. Warming induces significant reprogramming of beige, but not brown, adipocyte cellular identity. Cellular Metabolism 27 (5), 1121–1137.e5 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Buenrostro JD et al. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nature Methods 10 (12), 1213–1218 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Corces MR et al. Lineage-specific and single-cell chromatin accessibility charts human hematopoiesis and leukemia evolution. Nature Genetics 48 (10), 1193–1203 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Corces MR et al. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nature Methods 14 (10), 959–962 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wu J et al. Chromatin analysis in human early development reveals epigenetic transition during ZGA. Nature 557 (7704), 256–260 (2018). [DOI] [PubMed] [Google Scholar]
  • 14.Bagchi DP, MacDougald OA Identification and dissection of diverse mouse adipose depots. Journal of Visualized Experiments (149), e59499 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.So J et al. Chronic cAMP activation induces adipocyte browning through discordant biphasic remodeling of transcriptome and chromatin accessibility. Molecular Metabolism 66, 101619 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Loft A, Herzig S, Schmidt SF Purification of GFP-tagged nuclei from frozen livers of INTACT mice for RNA- and ATAC-sequencing. STAR Protocols 2 (3), 100805 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Heyward FD et al. Integrated genomic analysis of AgRP neurons reveals that IRF3 regulates leptin’s hunger-suppressing effects. bioRxiv (2022).

RESOURCES