Abstract
Blastocystis sp. is one of the most frequently detected protozoa during stool specimen examination. In the last decade, the studies about the pathogenic potential of Blastocystis sp. have intensified. Additionally, treatment approaches against this parasite are still disputable. The study aimed to investigate the in vitro activity of the substances of natural origin against two subtypes (ST) of Blastocystis sp.—ST3 and ST7. Garlic and turmeric extracts exhibited the highest inhibitory effect in relation to the ST3 viability. While horseradish and turmeric were found to be the most effective extracts to the ST7 viability. The study showed that ginger, garlic, horseradish, and turmeric extracts have potent antimicrobial activity against Blastocystis ST3 and ST7, with the half-maximal inhibitory concentration (IC50) ranging from 3.8 to 4.8 µg/ml and from 3.3 to 72.0 µg/ml, respectively, and thus may be useful in the prevention and control of Blastocystis infections. Additionally, this research confirmed that Blastocystis ST7 is more resistant to the selected plant extracts treatment than Blastocystis ST3 which in consequence may bring some difficulties in its eradication.
Keywords: Blastocystis spp., ST3, ST7, Garlic, Ginger, Horseradish, Turmeric
Introduction
Blastocystis sp. is an obligate anaerobic protozoan transmitted via the fecal–oral route, which can colonize the human large intestine. It is estimated that over 1 billion people around the world are infected with this parasite [1, 2]. In Poland, the prevalence of this parasite is in the range of 1–23.6% [3]. The pathogenic potential of Blastocystis sp. is the subject of many studies around the world. Some researchers suggest that this protozoan belongs to the human gut microbiome, however, under certain conditions, its presence may cause intestinal disorders. Other researchers, on the other hand, clearly point to the parasitic nature of this protozoan [4]. For this reason, the algorithm of pharmacological treatment of blastocystosis depends on the occurrence of clinical symptoms. Patients infected with Blastocystis sp. who experience gastrointestinal symptoms are most often treated with antibiotics such as metronidazole, while infected patients without gastrointestinal disorders are not treated [5]. However, recent studies on animal models indicate that even asymptomatic Blastocystis sp. infection can cause histopathological changes in the intestines of hosts [6]. In experimental studies, the presence of vacuolar forms of Blastocystis sp. in the gastrointestinal tissues of infected animals caused intense inflammatory infiltrates with a predominance of single-cell leukocytes and eosinophilia [6, 7]. Moreover, some strains of Blastocystis sp. have been found to exert pathogenic effects by disrupting the normal intestinal microbiota of the host, which is an important counterpoint to reports suggesting the commensal nature of this protozoan [8].
For many years, the classification of Blastocystis sp. was based on the host from which a given strain was isolated [9]. Currently, Blastocystis sp. has been divided into genotypic groups (subtypes) based on the sequence of the gene encoding the small subunit of rRNA (SSU rRNA) because studies using molecular techniques have revealed significant genetic variability of Blastocystis sp. [10]. There are 44 recognized subtypes of Blastocystis sp. [11]. The division into subtypes with pathogenic potential is not possible because reports indicate that the same subtype of Blastocystis sp. occurs both in patients with and without intestinal symptoms [12–14]. Thirteen subtypes have been found in humans: ST1-ST10, ST12, ST14, and ST16 [15]. In Poland, only ST1-ST4, ST6, ST7, and ST9 were isolated from patients, with a clear dominance of ST3 [3].
Diet has a significant impact on the development and composition of the human large intestine microbiome. Some substances of natural origin may inhibit the development of certain organisms that may have pathogenic abilities [16, 17]. There are studies indicating that some medicinal plants contain organic compounds that help effectively eradicate parasitic infections in humans [18, 19]. This group of plants includes, among others: garlic, horseradish, and ginger. Garlic (Allium sativum L.) possesses many beneficial and pharmacological properties in traditional and modern medicine, such as anticancer, antioxidant, antidiabetic, immunomodulatory, antithrombotic, and antimicrobial characteristics [20, 21]. It has also anti-parasitic activity against Blastocystis spp., Cryptosporidium parvum, Giardia lamblia, Entamoeba histolytica, Leishmania tropica, L. major, Plasmodium spp., Trypanosoma spp., and Toxoplasma gondii [22–28]. The therapeutic properties of garlic are owed to the presence of the most bioactive and potent components, allicin and thiosulfate (sulfur-containing compounds) [14]. The exact antimicrobial mechanisms of these bioactive compounds are not yet discovered, some studies suggested that organosulfur compounds act by reacting with proteins of microbes, disrupting DNA, RNA, and protein synthesis, and also damaging the cell wall and membrane [29]. Ginger (Zingiber officinale Rosc.) is an important ingredient of herbal medicines used in the constipation, indigestion, vomiting, and infectious diseases treatment [30]. Studies have shown that ginger extracts have significant anti-helminthic, anti-protozoal, and anti-leech activity, as well as molluscicidal and insecticidal properties [31–33]. Ginger is composed of many bioactive compounds that contribute to its recognized biological activities. Of the 400 types of compounds found in ginger, four phenolic compounds are mainly responsible for the pharmacological effects of ginger: gingerols, shogaols, paradols, and zingerone [34]. Horseradish (Armoracia rusticana Gaertn.) is commonly grown and used as a spice due to the properties of its roots. It contains different isothiocyanates in its cells [35]. Horseradish root has bactericidal and antiviral properties [36]. Additionally, the natural extracts from horseradish have also antifungal and insecticidal activity [37, 38]. Turmeric (Curcuma longa L.) comes from the equatorial region, and in many countries, it is used to color dishes to yellow-orange. It contains curcumin, which has antibacterial and antifungal effects [39]. Curcumin has also antiparasitic properties against Giardia lamblia, Leishmania spp., Plasmodium falciparum, Toxoplasma gondii, Schistosoma mansoni, and Fasciola gigantica [40–45].
Results of some research suggest that not only antibiotics can be used to treat blastocystosis, but also the inclusion of some medicinal plants in the diet can effectively lead to the eradication of the parasite [46, 47]. Therefore, the aim of the study was to analyze the effect of extracts from four selected plants (garlic, ginger, horseradish, and turmeric) at different concentrations on the viability of Blastocystis sp. cells. In the study, two subtypes of Blastocystis sp.—ST3 and ST7 were analyzed to determine the differences in their response, if any, to the substances of natural origin. We decided to analyze ST3 because it is the most common isolated subtype in patients from Poland [3]. While, ST7 has been associated with colorectal cancer [12].
Material and methods
Blastocystis subtypes
Blastocystis sp. was isolated from stool samples of two symptomatic individuals. The stool samples were submitted to the parasitology laboratory for medical tests. Volunteers gave oral and written consent to the use of strains in scientific research. Under Polish Law, consent from the Bioethics Committee is not required for such research.
Genetic analysis identified these two strains as Blastocystis subtype 3 (ST3) and Blastocystis subtype 7 (ST7). ST3 was isolated from a 26-year-old female with chronic, intensive gastrointestinal symptoms and Intestinal Methanogen Overgrowth (IMO) diagnosed previously. ST7 was isolated from a symptomatic 74-year-old female who had been diagnosed with rectal cancer.
Microscopic examination, molecular detection and subtyping
The samples were provided in a fresh state. Directly upon arrival, a small part of each specimen was cultured in previously prepared Jones’ medium supplemented with 10% horse serum (Sigma-Aldrich, Poznań, Poland) and incubated at 37 °C in anaerobic condition (pH 7.1) in tightly closed polypropylene 12-ml Falcon tubes. The xenic culture, containing gut bacteria, was subcultured every 2–3 days and screened using standard microscopy. Repeated subculture in a new medium was maintained for one month to cleanse the culture medium from fecal debris [48]. Additionally, a small part of each specimen was placed in 70% ethanol for further analysis.
Prior to DNA extraction, the samples were washed three times in phosphate-buffered saline (PBS). Genomic DNA was isolated from both stool samples using the Sherlock AX kit (A&A Biotechnology, Poland) and it was stored at − 20 °C until molecular analyses were performed. Molecular detection of Blastocystis sp. was achieved by a PCR method to specifically amplify a 1.8 kbp fragment of the SSU rRNA gene of the protozoan according to Scicluna et al. [49]. Amplification reactions (25 μl) contained PCR Master Mix Plus (A&A Biotechnology, Poland), primers BhRDr/RD5 as well as SB227 (primer for Blastocystis ST3) and SB155 (primer for Blastocystis ST7) ([50], Table 1), nuclease-free water, and template DNA. Cycling parameters were 94 °C for 3 min, and 30 cycles of denaturation, annealing, and extension at 94 °C, 59 °C and 72 °C respectively, with a final extension step of 2 min at 72 °C. PCR products (5 μl) were analyzed on 1.35% agarose gel using electrophoresis and visualized with UV light. Positive PCR products were purified using Clean-Up (A&A Biotechnology, Poland) according to the manufacturer’s recommendations. The entire procedure of DNA extraction from feces, the PCR method was described previously by Kosik-Bogacka et al. [2].
Table 1.
Primers used in PCR analyses
| Gene | Forward | Reverse |
|---|---|---|
| BhRDr/RD5* | ATCTGGTTGATCCTGCCAGT | GAGCTTTTTAACTGCAACAACG |
| SB227 | TAGGATTTGGTGTTTGGAGA | TTAGAAGTGAAGGAGATGGAAG |
| SB155 | ATCAGCCTACAATCTCCTC | ATCGCCACTTCTCCAAT |
*RD5—forward, BhRDr—reverse
Sequencing on the samples subject to PCR was done once using Macrogen Humanizing Genomics Europe (Amsterdam, The Netherlands). The primers used for sequencing were RD5 (5′-ATCTGGTTGATCCTGCCAGT-3′) and BhRDr (3′-GAGCTTTTTAACTGCAACAACG-5′). The resulting chromatograms were edited and assembled using Finch TV v 1.4 (Geospiza Inc., Seattle, WA, USA). The obtained sequences were then compared to the sequences of Blastocystis STs, previously deposited in GenBank™ (https://www.ncbi.nlm.nih.gov/genbank/) and PUBMLST databases (http://pubmlst.org/Blastocystis/). Subtypes were identified by determining the exact match (100%) or closest similarity (99%) to all known Blastocystis subtypes according to the classification by Stensvold et al. [51]. The sequences were submitted to GenBank™, reported with their accession numbers PP462157 and PP462158.
Preparation of plants extracts
Plant extracts were prepared according to publications written by Suru [52] and Abdel-Hafeez et al. [46]. Freshly peeled garlic cloves, ginger, and horseradish roots (5 g) were mixed with 100 ml of distilled water and crushed in a mortar. In the case of turmeric, 5 g powder was soaked in 100 ml of distilled water. After 48 h, the solutions were filtered through a paper filter. The solutions were diluted to obtain extracts with final concentrations: 0.01, 0.05, 0.10 and 0.50 mg/ml [47]. The aqueous extracts were stored in the dark at − 20 °C until use.
Drug susceptibility assay
The tests were performed in vitro on a 96-well plate. Each well on the plate was filled with 0.5 ml of Jones' medium containing 100,000 morphological forms of Blastocystis sp. The total number of parasites was previously counted in a Bürker chamber. The first column of wells was treated as a control group therefore only 0.5 ml of Jones' medium was added; 0.5 ml of garlic extract at a concentration of 0.01 mg/ml was added to the second column; 0.5 ml of garlic extract at a concentration of 0.05 mg/ml was added to the third column; 0.5 ml of garlic extract at a concentration of 0.1 mg/ml was added to the fourth column; and 0.5 ml of garlic extract at a concentration of 0.5 mg/ml was added to the fifth column. Afterward, the plate was covered with parafilm and incubated at 37 °C. The viability of Blastocystis sp. was examined after 24, 48, 72 and 96 h. The cultures were stained with 0.4% Trypan blue solution according to Lepczyńska and Dzika [48] and viable, unstained cells were counted in the Bürker chamber. Analogous activities were performed with the second subtype of Blastocystis sp. and other extracts. Each experiment was carried out in triplicates.
Statistical analysis
The Statistica StatSoft software (version 8.0) was used in the statistical analysis. Means of triplicate data were calculated and used as the final result. The differences between groups were calculated by non-parametric tests. The graphs were presented using Microsoft Excel 2016. GraphPad 4.0 was used for the determination of the half-maximal inhibitory concentration (IC50). IC50 values were calculated using non-linear regression analysis from dose–response curves of data obtained after direct observation at 96 h and cell counts by microscopy. In this study, p values of ≤ 0.05 were considered significant.
Results
The two isolates in this study were obtained from symptomatic volunteers suffering from gastrointestinal symptoms. Under light microscopy, the fecal samples were examined and were found to be infected with vacuolar forms of Blastocystis. Both subtypes of cells were also successfully cultured and maintained in Jones’ medium. Based on the PCR amplification and after that on sequencing, the observed genotypes were ST3 and ST7.
ST3
Growth profile studies were carried out to evaluate the anti-protozoal property and efficacy of plant extracts against Blastocystis ST3. All studied aqueous extracts at all time points and at all concentrations inhibited the development of Blastocystis ST3, statistically significantly reducing their number of living cells compared to the control group. Moreover, it was observed that the cells treated with extracts were smaller in size than untreated ones.
The length of exposure of various aqueous plant extracts to Blastocystis ST3 was compared (Fig. 1). Statistically significant differences were found between 24 h vs 48 h vs 72 h vs 96 h when the microorganism was exposed to garlic extract at a concentration of 0.01 mg/ml (H = 21.17, p < 0.001) and 0.05 mg/ml (H = 15.11, p < 0.05). In the case of turmeric, significant differences were observed between time points when exposed to all turmeric concentrations: 0.01 mg/ml (H = 18.45, p < 0.001), 0.05 mg/ml (H = 12.68, p < 0.01), 0.1 mg/ ml (H = 17.88, p < 0.001) and 0.5 mg/ml (H = 15.41, p < 0.01). According to the ginger, differences were found between four-time points at average concentrations of extracts: 0.05 mg/ml (H = 14.39, p < 0.01) and 0.1 mg/ml (H = 10.45, p < 0.05). There were no statistically significant differences in horseradish concentrations between the tested time points.
Fig. 1.
The number of Blastocystis subtype 3 cells in the control sample (A), after treatment with different concentrations of garlic (B), ginger (C), horseradish (D), and turmeric (E) extracts in various time points
Garlic extract caused significantly the highest inhibition of Blastocystis ST3 cell proliferation in 24 h at all tested concentrations, which was confirmed by statistical analysis. After 48 h of co-incubation, garlic extract was most effective at three concentrations: 0.01, 0.05, and 0.1 mg/ml, while horseradish extract was only at a concentration of 0.5 mg/ml. Moreover, it was found that the lowest concentration (0.01 mg/ml) of garlic extract was also most effective in the 72nd hour of co-incubation. However, at the mentioned concentrations in the 72nd hour and all studied concentrations in the 96th hour, the turmeric extract showed the greatest effectiveness.
The IC50 for garlic extract was 0.0039 mg/ml, for ginger extract was 0.0048 mg/ml, for horseradish extract was 0.0042 mg/ml, and for turmeric extract was 0.0038 mg/ml mg/ml.
ST7
Blastocystis ST7 also exhibited susceptibility to the plant extracts. At all time points and all studied extract concentrations, statistically significant differences were found between the number of Blastocystis ST7 cells with the added extract and the control group (without the added extract) where a lower number of Blastocystis ST7 cells was observed in comparison to the control group. Additionally, the cells treated with plant extracts were smaller compared to untreated ones (Fig. 2).
Fig. 2.
Effect of garlic extract on the growth and viability of Blastocystis ST7, untreated cells (A) and cells treated with 0.5 mg/ml after 24 h (B). Scale bar = 50 µm
The duration of exposure of Blastocystis ST7 to various aqueous plant extracts was compared (Fig. 3). Statistically significant differences were found between 24 h vs 48 h vs 72 h vs 96 h when protozoa were exposed to garlic extract at a concentration of 0.05 mg/ml (H = 14.39, p < 0.01) and 0.1 mg/ml (H = 10.45, p < 0.02). In the case of turmeric, significant differences were observed between time points when exposed to high concentrations of turmeric extract: 0.1 mg/ ml (H = 11.53, p < 0.01) and 0.5 mg/ml (H = 16.60, p < 0.001). When comparing horseradish and ginger, differences were found between four-time points at each tested concentration of these extracts: 0.01 mg/ml (H = 16.87, p < 0.001 and H = 19.78, p < 0.001, respectively), 0.05 mg/ml (H = 13.10, p < 0.01 and H = 21.41, p < 0.001, respectively), 0.1 mg/ml (H = 13.83, p < 0.01 and H = 19.71, p < 0.001, respectively), 0.5 mg/ml (H = 13.77, p < 0.01 and H = 9.62, p < 0.05).
Fig. 3.
The number of Blastocystis subtype 7 cells in the control sample (A), after treatment with different concentrations of garlic (B), ginger (C), horseradish (D), and turmeric (E) extracts in various time points
Additionally, the statistical analysis was used to evaluate which of the tested extracts and at what concentration mostly inhibited cell proliferation. At 24, 48, and 72 h after treatment, the lowest number of Blastocystis ST7 cells was observed in the tubes with horseradish extract. At 96 h, ginger extract was most effective at concentrations of 0.01, 0.05, and 0.1 mg/ml, while turmeric extract was most effective at 0.5 mg/ml.
The IC50 for garlic extract was 0.072 mg/ml, for ginger extract was 0.0033 mg/ml, for horseradish extract was 0.0037 mg/ml, and for turmeric extract was 0.015 mg/ml.
Discussion
Scientific research on Blastocystis sp. is increasingly focusing on a specific Blastocystis subtype rather than the Blastocystis genus because each subtype is characterized by different biochemical and pathogenic properties [53]. Some subtypes have been associated with health problems in humans as the case of ST7, while ST3 has been related as a non-pathogenic subtype [54–56]. However, it is very difficult to assign a subtype to those with pathogenic or non-pathogenic properties. It was revealed that ST7 caused disruptions in the gut epithelial barrier by influencing on tight junction proteins such as occludin and zonula occludens-1 (ZO-1), and also has greater adhesiveness than ST4 isolates to intestinal epithelial cells [57, 58]. Furthermore, ST7 was shown to have significantly greater cysteine protease activity compared to ST4 [57]. Additionally, Blastocystis ST7-infected patients showed a higher number of ‘harmful’ bacteria (Proteobacteria) in their gut. Recent data suggest that Blastocystis ST7 may interact with multiple members of gut microbiota, such as the Escherichia-Shigella group, to cause these negative alterations [59]. ST3, on the other hand, was associated with an eubiotic state characterized by beneficial species that are members of the phyla Firmicutes and Bacteroidetes, such as those of the genera Ruminococcus and Prevotella, respectively [60]. ST3 is mostly isolated from asymptomatic patients, however, it is also found in patients with gastrointestinal symptoms [61].
ST3 is the most dominant subtype in many countries, including highly urbanized regions [3, 62]. It is suggested that ST3 is the most human-specific subtype and is primarily transmitted among people (due to human-to-human transmission) [63]. In Poland, ST3 is the most prevalent subtype in both, males and females, in various age groups as well as in those traveling outside Europe and the patients who never left their country [2, 3]. Regarding ST7 it is considered an avian subtype because of its higher frequency in animals, including livestock, and its relative predominance in birds, both wild and farmed [64]. The highest number of ST7 human infections were reported in Nepal, Egypt, Japan, Malaysia, and Pakistan (from the highest to the lowest number of cases). In Poland, ST7 was identified much less frequently than other STs, accounting for 2.47% of cases [3]. Additionally, Blastocystis sp. infection has been found in patients with colorectal cancer (CRC). Sulżyc-Bielicka et al. [65] reported that CRC was associated with an increased risk of opportunistic Blastocystis sp. infection. The latest studies showed that subtype 7 was only isolated from CRC stool samples with significant association [12]. In this study, the volunteer with Blastocystis ST7 is diagnosed with rectal cancer.
The presented work assessed the effect of aqueous extract of garlic, ginger, horseradish, and turmeric on the viability of Blastocystis ST3 and ST7. It was found that each studied plant extract resulted in reduced ST3 viability; however, none of the studied concentrations resulted in complete eradication of the protozoan. Garlic and turmeric extracts exhibited the highest inhibitory effect in relation to the ST3 viability. The garlic activity was also observed with other protozoan parasites, such as Giardia lamblia [66, 67], Cryptosporidium parvum [68], and Entamoeba histolytica [23]. According to the literature, Blastocystis ST7 has been shown to be more resistant to anti-parasitic drugs [69, 70] and against the host innate immune response [71] compared to ST1 and ST4 isolates. In the present study reduced ST7 viability under the influence of each plant extract was observed, but similarly to ST3, none of the studied concentrations resulted in complete eradication of the protozoan. Horseradish and turmeric were found to be the most effective extracts in relation to the ST7 viability. Similar research was performed by Yakoob et al. [47] and Abdel-Hafeez et al. [46]. Yakoob et al. [47] found that Blastocystis hominis is as sensitive to metronidazole, the drug of choice for the treatment of blastocystosis, as garlic. In turn, B. hominis was not sensitive to ginger, black pepper, and cumin compared to garlic and metronidazole. Surprisingly, ginger appeared to be promoting the growth of B. hominis isolates at higher concentrations. The present study also has shown that long-term exposure to ginger extract promoted the growth of Blastocystis ST3, but not Blastocystis ST7. Based on the research of Abdel-Hafeez et al. [46] it is suggested that ginger has the greatest impact on the viability of Blastocystis hominis. Additionally, these authors reported that turmeric treatment insignificantly lowered the number of parasite cells. In this research, different results were observed, but it is important to note that for mentioned authors did not focus on any subtype of Blastocystis, only on the Blastocystis genus, in general.
The study showed that ginger, garlic, horseradish, and turmeric extracts have potent antimicrobial activity against Blastocystis ST3 and ST7, with an IC50 ranging from 3.8 to 4.8 µg/ml and from 3.3 to 72.0 µg/ml, respectively. The study authors found comparable IC50 values of anti-protozoal agents effective against Blastocystis ST7. Metronidazole has an IC50 of 31.5 μg/ml [70]. Mirza et al. [69] found that two strains within one subtype respond differently to anti-parasitic drugs. They examined nitazoxanide, furazolidone, mefloquine, quinacrine, quinine, emetine, trimethoprim sulfate-sulfamethoxazole, and iodoacetamide. The range of IC50 of these drugs was between 0.2 and 22.0 μg/ml [69]. This indicates that plant extracts have a potent antimicrobial effect against Blastocystis and are promising candidates for the alternative treatment of Blastocystis infections or as an additional adjunctive therapy.
The study has a limitation. We did not include a drug control group with metronidazole or nitazoxanide. The main reason for the decision was that both subtypes isolated from volunteers and currently studied were resistant to several anti-parasitic drugs, including metronidazole at the highest dose. Hence, an attempt was made to look for other alternative treatments for blastocystosis. In further studies on the effects of potential medicinal plants on Blastocystis sp. viability, a control trial with a drug should be added.
Conclusions
The study confirms the necessity to analyze each of the Blastocystis subtypes because the differences in pathogenic and biochemical properties between them influence on the patient’s treatment results. The study showed that selected plant extracts have potent in vitro antimicrobial activity against Blastocystis ST3 and ST7, and thus may be useful in the prevention and control of Blastocystis infections. The highest inhibitory effect in relation to the Blastocystis ST3 viability had garlic and turmeric, while horseradish and turmeric were the most effective against the Blastocystis ST7. Additionally, this research confirmed that Blastocystis ST7 is more resistant to the selected plant extracts treatment than Blastocystis ST3 which in consequence may bring some difficulties in its eradication.
Acknowledgements
Karolina Kot was supported by the Foundation for Polish Science (FNP).
Author contributions
KK: writing—original draft, review and editing, conceptualization, methodology, data curation, formal analysis, project administration, supervision; AM: methodology; data curation; EK: review and editing; ML: writing—original draft, review and editing, supervision. All authors read and approved the final manuscript.
Funding
This work was supported in part by the research project no. WFB-431/S/2024 by Pomeranian Medical University in Szczecin.
Availability of data and materials
Derived data supporting the findings of this study are available from the corresponding author (KK) on request.
Declarations
Ethics approval and consent to participate
Blastocystis sp. was isolated from stool samples of two symptomatic individuals. The stool samples were submitted to the parasitology laboratory for medical test. Volunteers gave oral and written consent to the use of strains in scientific research. Under Polish Law, consent from the Bioethics Committee is not required for such research.
Consent for publication
Not applicable.
Competing interests
The authors have no relevant financial or non-financial interests to disclose. The authors declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Bednarska M, Jankowska I, Pawelas A, Piwczyńska K, Bajer A, Wolska-Kuśnierz B, et al. Prevalence of Cryptosporidium, Blastocystis, and other opportunistic infections in patients with primary and acquired immunodeficiency. Parasitol Res. 2018;117:2869–2879. doi: 10.1007/s00436-018-5976-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kosik-Bogacka D, Lepczyńska M, Kot K, Szkup M, Łanocha-Arendarczyk N, Dzika E, et al. Prevalence, subtypes and risk factors of Blastocystis spp. infection among pre- and perimenopausal women. BMC Infect Dis. 2021;21:1125. doi: 10.1186/s12879-021-06815-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Rudzińska M, Sikorska K. Epidemiology of Blastocystis infection: a review of data from Poland in relation to other reports. Pathogens. 2023;12:1050. doi: 10.3390/pathogens12081050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Rajamanikam A, Isa MNM, Samudi C, Devaraj S, Govind SK. Gut bacteria influence Blastocystis sp. phenotypes and may trigger pathogenicity. PLoS Negl Trop Dis. 2023;17:e0011170. doi: 10.1371/journal.pntd.0011170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Coyle CM, Varughese J, Weiss LM, Tanowitz HB. Blastocystis: to treat or not to treat. Clin Infect Dis. 2012;54:105–110. doi: 10.1093/cid/cir810. [DOI] [PubMed] [Google Scholar]
- 6.Pavanelli MF, Kaneshima EN, Uda CF, Colli CM, Falavigna-Guilherm AL, Gomes ML. Pathogenicity of Blastocystis sp. to the gastrointestinal tract of mice: relationship between inoculum size and period of infection. Rev Inst Med Trop Sao Paulo. 2015;57:467–72. doi: 10.1590/S0036-46652015000600002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Elwakil HS, Hewedi IH. Pathogenic potential of Blastocystis hominis in laboratory mice. Parasitol Res. 2010;107:685–689. doi: 10.1007/s00436-010-1922-y. [DOI] [PubMed] [Google Scholar]
- 8.Yason JA, Liang YR, Png CW, Zhang Y, Tan KSW. Interactions between a pathogenic subtype and gut microbiota: in vitro and in vivo studies. Microbiome. 2019;7:30. doi: 10.1186/s40168-019-0644-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Stensvold CR, Clark CG. Current status of Blastocystis: a personal view. Parasitol Int. 2016;65:763–771. doi: 10.1016/j.parint.2016.05.015. [DOI] [PubMed] [Google Scholar]
- 10.Noël C, Dufernez F, Gerbod D, Edgcomb VP, Delgado-Viscogliosi P, Ho LC, et al. Molecular phylogenies of Blastocystis isolates from different hosts: implications for genetic diversity, identification of species, and zoonosis. J Clin Microbiol. 2005;43:348–355. doi: 10.1128/JCM.43.1.348-355.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Santin M, Figueiredo A, Molokin A, George NS, Köster PC, Dashti A, et al. Division of Blastocystis ST10 into three new subtypes: ST42-ST44. J Eukaryot Microbiol. 2024;71:e12998. doi: 10.1111/jeu.12998. [DOI] [PubMed] [Google Scholar]
- 12.Ali SH, Ismail MAM, El-Badry AA, Abu-Sarea EY, Dewidar AM, Hamdy DA. An association between Blastocystis subtypes and colorectal cancer patients: a significant different profile from non-cancer individuals. Acta Parasitol. 2022;67:752–763. doi: 10.1007/s11686-021-00508-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Alinaghizade A, Mirjalal H, Mohebal M, Stensvold CR, Rezaeian M. Inter- and intra-subtype variation of Blastocystis subtypes isolated from diarrheic and non-diarrheic patients in Iran. Infect Genet Evol. 2017;50:77–82. doi: 10.1016/j.meegid.2017.02.016. [DOI] [PubMed] [Google Scholar]
- 14.El-Saber Batiha G, Magdy Beshbishy A, Wasef LG, Elewa YHA, Al-Sagan AA, Abd El-Hack ME, et al. Chemical constituents and pharmacological activities of garlic (Allium sativum L.): a review. Nutrients. 2020;12:872. doi: 10.3390/nu12030872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Popruk S, Adao DEV, Rivera WL. Epidemiology and subtype distribution of Blastocystis in humans: a review. Infect Genet Evol. 2021;95:105085. doi: 10.1016/j.meegid.2021.105085. [DOI] [PubMed] [Google Scholar]
- 16.Onyeagba RA, Ugbogu OC, Okeke CU, Iroakasi O. Studies on the antimicrobial effects of garlic (Allium sativum Linn), ginger (Zingiber officinale Roscoe) and lime (Citrus aurantifolia Linn) Afr J Biotechnol. 2004;3:552–554. doi: 10.5897/AJB2004.000-2108. [DOI] [Google Scholar]
- 17.Singh RK, Chang HW, Yan D, Lee KM, Ucmak D, Wong K, et al. Influence of diet on the gut microbiome and implications for human health. J Transl Med. 2017;15:73. doi: 10.1186/s12967-017-1175-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.El-Sayed NM, Masoud NG. Medicinal plants as natural anti-parasitic agents against Blastocystis species. Recent Adv Anti-Infect Drug Discov. 2023;18:2–15. doi: 10.2174/27722434418666221124123445. [DOI] [PubMed] [Google Scholar]
- 19.Lepczyńska M, Białkowska J, Dzika E, Piskorz-Ogórek K, Korycińska J. Blastocystis: how do specific diets and human gut microbiota affect its development and pathogenicity? Eur J Clin Microbiol Infect Dis. 2017;36:1531–1540. doi: 10.1007/s10096-017-2965-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Londhe VP, Gavasane AT, Nipate SS, Bandawane DD, Chaudhari PD. Role of garlic (Allium sativum) in various diseases: an overview. Angiogenesis. 2011;12:13. [Google Scholar]
- 21.Rouf R, Uddin SJ, Sarker DK, Islam MT, Ali ES, Shilpi JA, et al. Antiviral potential of garlic (Allium sativum) and its organosulfur compounds: a systematic update of pre-clinical and clinical data. Trends Food Sci Technol. 2020;104:219–234. doi: 10.1016/j.tifs.2020.08.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Alnomasy SF. In vitro and in vivo anti-Toxoplasma effects of Allium sativum essential oil against Toxoplasma gondii RH strain. Infect Drug Resist. 2021;14:5057–5068. doi: 10.2147/IDR.S337905. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Azadbakht M, Chabra A, Akbarabadi AS, Motazedian MH, Monadi T, Akbari F. Anti-parasitic activity of some medicinal plants essential oils on Giardia lamblia and Entamoeba histolytica, in vitro. Res J Pharmacogn. 2020;7:41–7. doi: 10.22127/RJP.2019.168142.1462. [DOI] [Google Scholar]
- 24.Hamdy DA, Ismail MAM, El-Askary HM, Abdel-Tawab H, Ahmed MM, Fouad FM, et al. Newly fabricated zinc oxide nanoparticles loaded materials for therapeutic nano delivery in experimental cryptosporidiosis. Sci Rep. 2023;13:19650. doi: 10.1038/s41598-023-46260-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kinuthia G, Kabiru EW, Anjili C, Kigondu E, Ngure V, Ingonga J, et al. Efficacy of crude methanolic extracts of Allium sativum L. and Moringa stenopetala (Baker f) Cufod. against Leishmania major. Int J Med Arom Plants. 2014;4:16–25. [Google Scholar]
- 26.Krstin S, Sobeh M, Braun MS, Wink M. Anti-parasitic activities of Allium sativum and Allium cepa against Trypanosoma b. brucei and Leishmania tarentolae. Medicines. 2018;5:37. doi: 10.3390/medicines5020037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Mahmoudvand H, Sepahvand P, Jahanbakhsh S, Azadpour M. Evaluation of the antileishmanial and cytotoxic effects of various extracts of garlic (Allium sativum) on Leishmania tropica. J Parasit Dis. 2016;40:423–426. doi: 10.1007/s12639-014-0520-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Vathsala PG, Krishna MP. Immunomodulatory and antiparasitic effects of garlic-arteether combination via nitric oxide pathway in Plasmodium berghei-infected mice. J Parasit Dis. 2020;44:49–61. doi: 10.1007/s12639-019-01160-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Bhatwalkar SB, Mondal R, Krishna SBN, Adam JK, Govender P, Anupam R. Antibacterial properties of organosulfur compounds of garlic (Allium sativum) Front Microbiol. 2021;12:613077. doi: 10.3389/fmicb.2021.613077. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ali BH, Blunden G, Tanira MO, Nemmar A. Some phytochemical, pharmacological and toxicological properties of ginger (Zingiber officinale Roscoe): a review of recent research. Food Chem Toxicol. 2008;46:409–420. doi: 10.1016/j.fct.2007.09.085. [DOI] [PubMed] [Google Scholar]
- 31.Abd El Wahab WM, El-Badry AA, Mahmoud SS, El-Badry YA, El-Badry MA, Hamdy DA. Ginger (Zingiber officinale)-derived nanoparticles in Schistosoma mansoni infected mice: hepatoprotective and enhancer of etiological treatment. PLoS Negl Trop Dis. 2021;15:e0009423. doi: 10.1371/journal.pntd.0009423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.El-Sayed NM, El-Saka MM. Anti-parasitic activity of Zingiber officinale (ginger): a brief review. Aperito J Bacteriol Virol Parasitol. 2015;2:112–119. [Google Scholar]
- 33.El-Sayed NM, Safar EH. A brief insight on anti Toxoplasma gondii activity of some medicinal plants. Aperito J Bacteriol Virol Parasitol. 2014;1:107. [Google Scholar]
- 34.Ballester P, Cerdá B, Arcusa R, Marhuenda J, Yamedjeu K, Zafrilla P. Effect of ginger on inflammatory diseases. Molecules. 2022;27:7223. doi: 10.3390/molecules27217223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Mandáková T, Lysak MA. Healthy roots and leaves: comparative genome structure of horseradish and watercress. Plant Physiol. 2019;179:66–73. doi: 10.1104/pp.18.01165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Agneta R, Möllers C, Rivelli AR. Horseradish (Armoracia rusticana), a neglected medical and condiment species with a relevant glucosinolate profile: a review. Genet Resour Crop Evol. 2013;60:1923–1943. doi: 10.1007/s10722-013-0010-4. [DOI] [Google Scholar]
- 37.Chowański S, Chudzińska E, Lelario F, Ventrella E, Marciniak P, Miądowicz-Kobielska M, et al. Insecticidal properties of Solanum nigrum and Armoracia rusticana extracts on reproduction and development of Drosophila melanogaster. Ecotoxicol Environ Saf. 2018;162:454–463. doi: 10.1016/j.ecoenv.2018.07.030. [DOI] [PubMed] [Google Scholar]
- 38.Tedeschi P, Leis M, Pezzi M, Civolani S, Maietti A, Brandolini V. Insecticidal activity and fungitoxicity of plant extracts and components of horseradish (Armoracia rusticana) and garlic (Allium sativum) J Environ Sci Health B. 2011;46:486–490. doi: 10.1080/03601234.2011.583868. [DOI] [PubMed] [Google Scholar]
- 39.Allegra A, Innao V, Russo S, Gerace D, Alonci A, Musolino C. Anticancer activity of curcumin and its analogues: preclinical and clinical studies. Cancer Invest. 2017;35:1–22. doi: 10.1080/07357907.2016.1247166. [DOI] [PubMed] [Google Scholar]
- 40.de Paula Aguiar D, Brunetto Moreira Moscardini M, Rezende Morais E, de Paula RG, Ferreira PM, Afonso A, Belo S, et al. Curcumin generates oxidative stress and induces apoptosis in adult Schistosoma mansoni worms. PLoS ONE. 2016;11:e0167135. doi: 10.1371/journal.pone.0167135. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Dohutia C, Chetia D, Gogoi K, Sarma K. Design, in silico and in vitro evaluation of curcumin analogues against Plasmodium falciparum. Exp Parasitol. 2017;175:51–58. doi: 10.1016/j.exppara.2017.02.006. [DOI] [PubMed] [Google Scholar]
- 42.Goo YK, Yamagishi J, Ueno A, Terkawi MA, Aboge GO, Kwak D, et al. Characterization of Toxoplasma gondii glyoxalase 1 and evaluation of inhibitory effects of curcumin on the enzyme and parasite cultures. Parasit Vectors. 2015;8:654. doi: 10.1186/s13071-015-1268-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Gutiérrez-Gutiérrez F, Palomo-Ligas L, Hernández-Hernández JM, Pérez-Rangel A, Aguayo-Ortiz R, Hernández-Campos A, et al. Curcumin alters the cytoskeleton and microtubule organization on trophozoites of Giardia lamblia. Acta Trop. 2017;172:113–121. doi: 10.1016/j.actatropica.2017.04.027. [DOI] [PubMed] [Google Scholar]
- 44.Tiwari B, Pahuja R, Kumar P, Rath SK, Gupta KC, Goyal N. Nanotized curcumin and miltefosine, a potential combination for treatment of experimental visceral leishmaniasis. Antimicrob Agents Chemother. 2017;61:e01169–e1216. doi: 10.1128/AAC.01169-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Ullah R, Rehman A, Zafeer MF, Rehman L, Khan YA, Khan MA, et al. Anthelmintic potential of thymoquinone and curcumin on Fasciola gigantica. PLoS ONE. 2017;12:e0171267. doi: 10.1371/journal.pone.0171267. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Abdel-Hafeez EH, Ahmad AK, Andelgelil NH, Abdellatif MZ, Kamal AM, Mohamed RM. In vitro effect of some Egyptian herbal extracts against Blastocystis hominis. J Egypt Soc Parasitol. 2015;45:93–100. doi: 10.12816/0010854. [DOI] [PubMed] [Google Scholar]
- 47.Yakoob J, Abbas Z, Beg MA, Naz S, Awan S, Hamid S, Jafri W. In vitro sensitivity of Blastocystis hominis to garlic, ginger, white cumin, and black pepper used in diet. Parasitol Res. 2011;109:379–385. doi: 10.1007/s00436-011-2265-z. [DOI] [PubMed] [Google Scholar]
- 48.Lepczyńska M, Dzika E. The influence of probiotic bacteria and human gut microorganisms causing opportunistic infections on Blastocystis ST3. Gut Pathog. 2019;11:6. doi: 10.1186/s13099-019-0287-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Scicluna SM, Tawari B, Clark CG. DNA barcoding of blastocystis. Protist. 2006;157:77–85. doi: 10.1016/j.protis.2005.12.001. [DOI] [PubMed] [Google Scholar]
- 50.Yoshikawa H, Morimoto K, Wu Z, Singh M, Hashimoto T. Problems in speciation in the genus Blastocystis. Trends Parasitol. 2004;20:251–255. doi: 10.1016/j.pt.2004.03.010. [DOI] [PubMed] [Google Scholar]
- 51.Stensvold CR, Arendrup MC, Jespersgaard C, Mølbak K, Nielsen HV. Detecting Blastocystis using parasitologic and DNA-based methods: a comparative study. Diagn Microbiol Infect Dis. 2007;59:303–307. doi: 10.1016/j.diagmicrobio.2007.06.003. [DOI] [PubMed] [Google Scholar]
- 52.Suru SM. Onion and garlic extracts lessen cadmium-induced nephrotoxicity in rats. Biometals. 2008;21:623–633. doi: 10.1007/s10534-008-9148-5. [DOI] [PubMed] [Google Scholar]
- 53.Rojas-Velázquez L, Morán P, Serrano-Vázquez A, Portillo-Bobadilla T, González E, Pérez-Juárez H, et al. The regulatory function of Blastocystis spp. on the immune inflammatory response in the gut microbiome. Front Cell Infect Microbiol. 2022;12:967724. doi: 10.3389/fcimb.2022.967724. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Domínguez-Márquez MV, Guna R, Muñoz C, Gómez-Muñoz MT, Borrás R. High prevalence of subtype 4 among isolates of Blastocystis hominis from symptomatic patients of a health district of Valencia (Spain) Parasitol Res. 2009;105:949–955. doi: 10.1007/s00436-009-1485-y. [DOI] [PubMed] [Google Scholar]
- 55.Eroglu F, Genc A, Elgun G, Koltas IS. Identification of Blastocystis hominis isolates from asymptomatic and symptomatic patients by PCR. Parasitol Res. 2009;105:1589–1592. doi: 10.1007/s00436-009-1595-6. [DOI] [PubMed] [Google Scholar]
- 56.Stensvold CR, Sørland BA, Berg RPKD, Andersen LO, van der Giezen M, Bowtell JL, et al. Stool microbiota diversity analysis of Blastocystis-positive and Blastocystis-negative individuals. Microorganisms. 2022;10:326. doi: 10.3390/microorganisms10020326. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Wu Z, Mirza H, Tan KSW. Intra-subtype variation in Enteroadhesion accounts for differences in epithelial barrier disruption and is associated with metronidazole resistance in Blastocystis Subtype-7. PLoS Negl Trop Dis. 2014;8:e2885. doi: 10.1371/journal.pntd.0002885. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Wu Z, Mirza H, Teo JDW, Tan KSW. Strain-dependent induction of human enterocyte apoptosis by Blastocystis disrupts epithelial barrier and ZO-1 organization in a caspase 3- and 9-dependent manner. BioMed Res Int. 2014;2014:209163. doi: 10.1155/2014/209163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Deng L, Lee JWJ, Tan KSW. Infection with pathogenic Blastocystis ST7 is associated with decreased bacterial diversity and altered gut microbiome profiles in diarrheal patients. Parasit Vectors. 2022;15:312. doi: 10.1186/s13071-022-05435-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Iebba V, Totino V, Gagliardi A, Santangelo F, Cacciotti F, Trancassini M, et al. Eubiosis and dysbiosis: the two sides of the microbiota. New Microbiol. 2016;39:1–12. [PubMed] [Google Scholar]
- 61.El-Badry AA, Abd El-Wahab WM, Hamdy DA, Aboud A. Blastocystis subtypes isolated from irritable bowel syndrome patients and co-infection with Helicobacter pylori. Parasitol Res. 2018;117:127–37. doi: 10.1007/s00436-017-5679-4. [DOI] [PubMed] [Google Scholar]
- 62.Gabrielli S, Furzi F, Fontanelli Sulekova L, Taliani G, Mattiucci S. Occurrence of Blastocystis-subtypes in patients from Italy revealed association of ST3 with a healthy gut microbiota. Parasite Epidemiol Control. 2020;9:e00134. doi: 10.1016/j.parepi.2020.e00134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Tan KS, Mirza H, Teo JD, Wu B, Macary PA. Current views on the clinical relevance of Blastocystis spp. Curr Infect Dis Rep. 2010;12:28–35. doi: 10.1007/s11908-009-0073-8. [DOI] [PubMed] [Google Scholar]
- 64.Hublin JSY, Maloney JG, Santin M. Blastocystis in domesticated and wild mammals and birds. Res Vet Sci. 2021;135:260–282. doi: 10.1016/j.rvsc.2020.09.031. [DOI] [PubMed] [Google Scholar]
- 65.Sulżyc-Bielicka V, Kołodziejczyk L, Adamska M, Skotarczak B, Jaczewska S, Safranow K, et al. Colorectal cancer and Blastocystis sp. infection. Parasit Vectors. 2021;14:200. doi: 10.1186/s13071-021-04681-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Dehghani-Samani A, Madreseh-Ghahfarokhi S, Dehghani-Samani A, Pirali Y. In-vitro antigiardial activity and GC-MS analysis of Eucalyptus globulus and Zingiber officinalis essential oils against Giardia lamblia cysts in simulated condition to human’s body. Ann Parasitol. 2019;65:129–138. doi: 10.17420/ap6502.192. [DOI] [PubMed] [Google Scholar]
- 67.Mahmoud A, Attia R, Said S, Ibraheim Z. Ginger and cinnamon: can this household remedy treat giardiasis? Parasitological and histopathological studies. Iran J Parasitol. 2014;9:530–540. [PMC free article] [PubMed] [Google Scholar]
- 68.El-Shewehy DMM, Elshopakey GE, Ismail A, Hassan SS, Ramez AM. Therapeutic potency of ginger, garlic, and pomegranate extracts against Cryptosporidium parvum-mediated gastro-splenic damage in mice. Acta Parasitol. 2023;68:32–41. doi: 10.1007/s11686-022-00635-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Mirza H, Teo JD, Upcroft J, Tan KS. A rapid, high-throughput viability assay for Blastocystis spp. reveals metronidazole resistance and extensive subtype-dependent variations in drug susceptibilities. Antimicrob Agents Chemother. 2011;55:637–48. doi: 10.1128/AAC.00900-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Yason JA, Koh KARP, Tan KSW. Viability screen of LOPAC1280 reveals phosphorylation inhibitor auranofin as a potent inhibitor of Blastocystis subtype 1, 4, and 7 isolates. Antimicrob Agents Chemother. 2018;62:e00208–e218. doi: 10.1128/AAC.00208-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Yason JA, Ajjampur SSR, Tan KSW. Blastocystis isolate B exhibits multiple modes of resistance against antimicrobial peptide LL-37. Infect Immun. 2016;84:2220–2232. doi: 10.1128/IAI.00339-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Derived data supporting the findings of this study are available from the corresponding author (KK) on request.



