Abstract
In macroecology, the concept of r‐ and K‐strategy has been widely applied, yet, there have been limited studies on microbial life‐history strategies in temperate grasslands using multiple sequencing approaches. Total phospholipid fatty acid (PLFA) analysis, high‐throughput meta‐genomic sequencing, and GeoChip technologies were used to examine the changes in microbial life‐history traits in a chronosequence of restored grasslands (1, 5, 10, 15, 25, and 30 years since restoration). Grassland restoration increased the relative abundances of Actinobacteria, Proteobacteria, and Bacteroidetes but reduced the relative abundances of Acidobacteria, Planctomycetes, and Chloroflexi. PLFA analysis revealed that grassland restoration reduced the fungi:bacteria and Gram‐positive:Gram‐negative bacteria ratios. Combined with the meta‐genomic data, we found that grassland restoration shifted microorganisms from oligotrophic (K‐) to copiotrophic (r‐) groups, consistent with the increased rRNA operon copy number of the microbial community. Structural equation modeling showed that soil properties positively (p < 0.05) while plant properties negatively (p < 0.05) affected microbial life‐history traits. We built a framework to highlight the importance of plant and soil properties in driving microbial life‐history traits during grassland restoration. Finally, by incorporating meta‐genomic and other microbiological data, this study showed that microbial life‐history traits support the idea that rRNA operon copy number is a trait that reflects resource availability to soil microorganisms.
Keywords: chronosequence, high‐throughput sequencing, microbial communities, plant properties, resource availability
We concluded that the macroecological theory could be applied to soil microbial life‐history traits and also highlight the key effects of plant and soil properties on the changes in microbial strategies. These findings were suitable for this Journal (significantly advance the field of Microbial Ecology) and first proved that macroecological theory could be applied to soil microbial community, which was benefit to the development of microbial ecology and can be regarded as the evidence for most of researches.

Highlights
Grassland restoration increased and decreased abundances of r‐ and K‐strategists, respectively.
Grassland restoration shifted soil microorganisms from oligotrophic to copiotrophic.
Soil properties positively affected microbial life‐history traits.
Plant properties negatively affected microbial life‐history traits.
INTRODUCTION
Microorganisms represent the vast majority of organisms that live in the soil and possess tremendous complexity in the terrestrial ecosystem [1, 2]. On the basis of existing ecological theory, microbial ecologists proposed trait‐based classifications of soil microorganisms [3]. The copiotroph–oligotroph classification was considered analogous to the r‐ and K‐selection theory for plants and animals [4, 5]. This classification was mostly based on microbial substrate preferences, trophic strategy, and growth rates and has since been widely applied in various environmental contexts [6, 7]. Previous study had applied Competitor–Stress tolerator–Ruderal (Co‐S‐R) life‐history strategies to microbial systems, particularly in the context of anthropogenic environmental change [8]. Because the Co‐S‐R approach allows the classification of microorganisms employing mixed life strategies (e.g., CoS, SR, etc.), it has been widely used in microbial ecology research [9]. Recent efforts proposed a revised life history that builds on the work of the Co‐S‐R classification framework [10, 11], and proposed three main microbial life‐history strategies: high growth yield (Y), resource acquisition (A), and stress tolerance (S), or Y‐A‐S, along two main axes of environmental variations: resource availability and abiotic stress [12]. For instance, Y‐strategists efficiently convert monomeric substrates, such as glucose, into microbial biomass and, later, into microbial residues. In contrast, A‐strategists prevail in conditions with low resource availability, where microorganisms are under pressure to favor resource capture at the expense of growth.
Soil microorganisms can adapt to both nutrient‐rich and ‐poor environments, complicating the relationship between microbial activity and the fate of carbon (C) [13]. In soil systems, the growth and functions of soil microorganisms are critically affected by the quantity and quality of substances entering the soil. Thus, microbial communities use a variety of life strategies to organize and structure their responses, which impact soil C dynamics [14]. Previous studies suggest that microbial community composition is related to its effectiveness or substrate utilization strategy [15, 16]. On the basis of their C mineralization potential and growth rates, microorganisms can be classified into two ecologically functional categories, that is, r‐ and K‐strategists [17]. The r‐selected species (copiotrophic or opportunistic species) have a fast growth rate, low substrate affinity, and a rapid response to available C and nutrient inputs, and typically flourish in environments enriched in labile C [1, 2]. In contrast, K‐selected species (oligotrophic or equilibrium species) are slow growing, have a high substrate affinity, and are more efficient with decomposing recalcitrant C [1, 2]. To explain the linkages among microbial growth, C cycling, and resource acquisition, copiotrophs (r‐strategists) and oligotrophs (K‐strategists) have been used to predict the microbial activity and their environmental interactions, as these processes largely control C cycling.
With the advancement of meta‐genomic sequencing techniques, microbial life‐history traits have been widely applied in various ecosystems [18, 19]. On the basis of meta‐genomic sequencing, the rRNA operon copy number has been suggested as a community‐level microbial trait to identify r‐ or K‐strategists [18, 20]. In general, microorganisms with more rRNA operon copy numbers are broadly considered to be r‐strategies, because the number of rRNA operon is often correlated with the maximum growth rate, the ability to change growth rates, and fewer types of higher‐affinity transporters [21, 22]. The rapid growth of copiotrophic groups requires a substantial increase in cellular ribosome content, which is achieved by an increase in rRNA operon copy number in their genomes [23]. In contrast, microorganisms with one or a few rRNA operon copy numbers are considered to be K‐strategies, and adapted to extract maximum resources out of a limited supply [24, 25]. The efficient growth of oligotrophs leads to the greater production of offsprings per unit resource consumed, and drives gene loss and reduces the rRNA operon copy number. In addition, fast‐growing copiotrophs are also predicted to enhance the usage of synonymous codons in their ribosomal genes because they underwent translational selection, leading to greater codon usage bias [26, 27]. Therefore, greater codon usage bias is typically found to be associated with a higher maximum growth rate, a pivotal trait representing the ability of copiotrophs in response to resource pulses.
Land degradation, mainly caused by human activities, is widely distributed and is a major challenge for global environmental protection [28, 29]. The Loess Plateau of China is facing severe land degradation issues [30, 31], and is susceptible to erosion because of the highly heterogeneous terrains and man‐made interference [32, 33]. Since 1999, the Chinese government has launched the “Grain‐to‐Green” program to restore vegetation, control soil and water erosion, and preserve the ecological environment [30, 34]. Grassland restoration is widely used for revegetation in Northwest China [35, 36]. These initiatives alter the structure and composition of soil microbial communities [37, 38, 39, 40]. Due to different methods used to study microbial life‐history strategies, soil microorganisms presented different life‐history strategies during vegetation restoration. Previous meta‐analysis and experimental studies have shown significant increases in the fungi‐to‐bacteria ratio during the natural succession of abandoned cropland [39, 41, 42], because bacteria were often regarded as r‐strategists and fungi as K‐strategists. For example, Zechmeister‐Boltenstern [43] found that bacterial communities shifted from r‐ to K‐strategist groups during vegetation succession, with fungal abundances, and the ratio of fungi to bacteria increased with succession. Similarly, at a finer taxonomic scale, soil microbial communities tended to shift from r‐ to K‐strategists, both at the phylum and genus levels in a secondary succession of Quercus liaotungensis forests. [44]. While Zhang et al. [45] reported that bacterial communities shifted from Acidobacteria‐predominant (slow‐growing oligotrophic groups, K‐strategists) to Proteobacteria‐predominant communities (fast‐growing copiotrophic groups, r‐strategists) in a 30‐year vegetation succession. Thus, soil microbial life‐history strategies were widely different among different ecosystem types, as revealed by the sequencing approach. However, research on microbial life‐history strategies studied with multiple sequencing approaches is lacking in temperate grasslands. Improving our understanding of the influence of plant and soil properties on the life‐history traits of microorganisms is essential for unraveling how they regulate the biogeochemical cycles in terrestrial ecosystems.
A conceptual model was established to show the coeffects of plant and soil properties on microbial life‐history strategies during grassland restoration (Figure 1). Soil organic carbon (SOC) is formed by microbial transformation from plant litter, and soil bacteria and fungi are the main contributing factors to the decomposition of SOC, depending on nutrient availability [18, 20]. Grassland restoration changes the local environmental conditions through direct modification of litter, root systems, root exudates, and soil properties [46, 47]. As grassland restoration proceeds, plant roots produce several signaling substances and chemical compounds to protect themselves [48, 49, 50]. Most of the compounds in root exudates can promote the production of microbial biomass and extracellular enzymes [43, 47], and the decomposition of SOC is enhanced by these extracellular enzymes [51, 52, 53]. This leads to a shift in the composition and structure of soil microorganisms, ultimately altering the microbial life‐history traits [54, 55]. Here, community‐level traits inferred from meta‐genomic data can be used to distinguish copiotrophic and oligotrophic microbial communities. Especially, the r‐ and K‐strategy classification scheme might need to move beyond the restrictive focus on taxonomic genes [50], and thus we suggested expanding this theory to include data sets of functional genes. That is, functional genes involved in the degradation of labile and recalcitrant C could be grouped into r‐ and K‐strategy categories, respectively [50]. This way, these life‐history traits allow us to directly associate microbial performance with the related functional genes during grassland restoration. Thus, we used soil 16S rRNA, and internal transcribed spacer (ITS) rRNA gene sequencing to quantify the (relative) abundance, while using meta‐genomic sequencing to analyze the functional gene data to explain the special microbial life‐history traits during long‐term grassland restoration (Supporting Information Figure S1). The following two hypotheses were tested: H1, soil microbial community groups would change from K‐ to r‐strategists as the time since grassland restoration increases; and H2, soil properties are more strongly related to microbial life‐history traits than plant properties.
Figure 1.

A conceptual framework showing the impact of plant and soil properties on microbial life‐history traits by nutrient acquisition during grassland restoration. Soil organic carbon (SOC) is mainly formed by microbial transformations of plant litter, and soil bacteria and fungi are large contributors to the decomposition and mineralization of SOC. In the process of grassland restoration, plant litter is decomposed by a wide range of bacteria and fungi (1) and various root exudates and extracellular enzymes are produced (2) making nutrients available for uptake by microorganisms (3), and then shaped microbial community composition (4). The process of nutrient element release and absorption. Most of the microorganisms have access to organic nutrients and deliver these nutrients to plants, which keep the nutrient balance (5). In turn, the available nutrients promote the growth and reproduction of microorganisms (6, 7), thereby making them available to plants, enhancing plant growth during grassland restoration.
RESULTS
Vegetation community composition and soil properties
At the early restoration stage (mainly the 1‐, 5‐, and 10‐year sites), annual herbaceous plants (e.g., Artemisia capillaris and Artemisia scoparia) were the dominant species with low soil nutrients, microbial biomass, and enzyme activities (Table 1). At the late restoration stage (>10 years), perennial plants (e.g., Stipa bungeana and Artemisia stechmanniana) were the dominant species (Supporting Information Table S1), with high root biomass, soil nutrients, and enzyme activities (Table 1). The leaf C, N contents and root biomass gradually increased with years since grassland restoration. Soil properties, including soil organic C (SOC), moisture content (SM), total N (STN), available P (SAP), microbial biomass C (MBC), N (MBN), acid phosphatase (AP), α‐1,4‐glucosidase (AG), and β‐N‐acetylglucosaminidase (NAG), gradually increased with the year since grassland restoration and peaked at the 30‐year site, but the opposite trend was found for soil pH and microbial biomass P (MBP).
Table 1.
Effects of grassland restoration on plant and soil properties (means ± standard error)
| Year since restoration (yr) | ||||||
|---|---|---|---|---|---|---|
| Item | 1 | 5 | 10 | 15 | 25 | 30 |
| Plant properties | ||||||
| Root biomass (g m−2) | 12.4 ± 1.5 d | 19.3 ± 2.3 c | 23.5 ± 2.4 c | 37.9 ± 2.1 b | 41.7 ± 3.5 b | 57.8 ± 5.3 a |
| Root C (g kg−1) | 288 ± 24 e | 324 ± 35 d | 336 ± 26 d | 357 ± 17 c | 384 ± 28 b | 398 ± 23 a |
| Root N (g kg−1) | 0.76 ± 0.05 a | 0.74 ± 0.07 a | 0.74 ± 0.04 a | 0.75 ± 0.06 a | 0.73 ± 0.03 a | 0.62 ± 0.05 b |
| Root P (g kg−1) | 0.38 ± 0.02 a | 0.44 ± 0.03 c | 0.45 ± 0.05 c | 0.48 ± 0.04 b | 0.53 ± 0.06 b | 0.64 ± 0.05 a |
| Leaf C (g kg−1) | 439 ± 23 d | 446 ± 52 c | 458 ± 43 c | 461 ± 27 b | 467 ± 35 b | 472 ± 36 a |
| Leaf N (g kg−1) | 1.58 ± 0.24 a | 1.57 ± 0.26 a | 1.54 ± 0.18 a | 1.55 ± 0.33 a | 1.48 ± 0.41 a | 1.45 ± 0.52 a |
| Leaf P (g kg−1) | 0.28 ± 0.03 a | 0.28 ± 0.02 a | 0.30 ± 0.02 a | 0.31 ± 0.01 a | 0.32 ± 0.03 a | 0.33 ± 0.02 a |
| Soil properties | ||||||
| pH | 7.73 ± 0.23 a | 7.21 ± 0.24 b | 7.02 ± 0.18 b | 6.54 ± 0.37 c | 6.17 ± 0.21 c | 6.03 ± 0.25 d |
| SM (%) | 9.42 ± 2.14 d | 10.31 ± 2.75 c | 11.62 ± 1.95 c | 12.93 ± 3.16 b | 13.11 ± 3.15 b | 14.20 ± 2.22 a |
| SOC (g kg−1) | 9.12 ± 1.89 | 10.36 ± 2.13 | 12.52 ± 2.56 | 13.51 ± 2.34 | 15.68 ± 1.89 | 16.17 ± 2.45 |
| STN (g kg−1) | 1.22 ± 0.23 d | 1.32 ± 0.35 c | 1.35 ± 0.26 c | 1.48 ± 0.17 b | 1.53 ± 0.35 b | 1.59 ± 0.21 a |
| SAP (mg kg−1) | 23.4 ± 3.4 e | 25.8 ± 2.8 e | 36.8 ± 5.4 d | 43.2 ± 4.1 c | 62.6 ± 5.4 b | 68.7 ± 5.9 a |
| MBC (mg kg−1) | 341 ± 36 d | 355 ± 39 c | 362 ± 26 c | 389 ± 42 b | 403 ± 49 b | 422 ± 37 a |
| MBN (mg kg−1) | 87.1 ± 8.6 d | 92.1 ± 9.6 c | 98.0 ± 11.2 c | 101.1 ± 7.9 b | 109.0 ± 9.2 b | 115.2 ± 15.1 a |
| MBP (mg kg−1) | 19.2 ± 3.1 a | 18.8 ± 5.2 a | 18.2 ± 2.1 a | 17.9 ± 3.1 a | 17.6 ± 2.5 a | 17.3 ± 3.8 a |
Note: Different lowercase letters indicate a significant difference (p < 0.05) among the treatments (year since restoration) by Fisher's test following the analysis of variance.
Abbreviations: MBC, microbial biomass C; MBN, microbial biomass N; MBP, microbial biomass P; SAP, soil available P; SM, soil moisture content; SOC, soil organic C; STN, soil total N.
Soil microbial community structure
Soil bacterial sequences were classified into 13 phyla at the 97% level (Supporting Information Table S2), and the dominant phyla (relative abundance >5%) were Actinobacteria, Acidobacteria, and Proteobacteria. Soil fungal sequences were classified into eight phyla at the 97% level (Supporting Information Table S3), and the dominant phyla (relative abundance >5%) were Ascomycota, Basidiomycota, and Chytridiomycota. The relative abundances of Actinobacteria, Proteobacteria, and Bacteroidetes were higher at the 30‐year site and subsequently increased with the year since grassland restoration, while Acidobacteria, Planctomycetes, and Chloroflexi had high relative abundance at the 1‐year site, and then decreased with the year since grassland restoration (Supporting Information Table S4). For soil fungal phyla, Basidiomycota had a high relative abundance at the 1‐year site, and the abundance increased with the year since grassland restoration, while Ascomycota had a high relative abundance at the 30‐year site, and the abundance decreased with the year since grassland restoration (Supporting Information Table S5).
The bacterial (Supporting Information Table S2) and fungal (Supporting Information Table S3) Shannon–Wiener indices were the lowest at the 1‐year site and increased with the age of the restored grassland, reaching a maximum at the 30‐year site. We obtained smooth and saturated rarefaction curves as the sequence number increased with 97% similarity (Figure 2A,B), and bacterial and fungal communities showed a different classification according to nonmetric multidimensional scaling (NMDS; Figure 2C,D). The fungal communities displayed greater phylogenetic distances than bacterial communities (Supporting Information Figure S2).
Figure 2.

Coverage‐based rarefaction (solid line segment) and extrapolation (dotted line segments) sampling curves of bacteria (A) and fungi (B) during grassland restoration. Nonmetric multidimensional scaling (NMDS) representation of (C) soil bacterial communities and (D) fungal communities with year since grassland restoration. Operational taxonomic units (OTUs) at 97% similarity defined the communities, and ordinations were based on Bray–Curtis dissimilarities.
Network analysis (Supporting Information Figure S3) shows that there were more positive than negative correlations in all networks during grassland restoration. The networks of the soil microbial community at the 30‐year site were stronger (more abundant nodes) than at other sites. We found a typical module structure due to the calculated modularity index, which was more than 0.4 (Supporting Information Table S6). The average clustering coefficient (avgCC), and the values of the average path length in these empirical networks gradually increased with year since restoration. In addition, the modularity index and average connectivity (avgK) gradually increased with year since restoration, while the average path length and network diameter showed the opposite trend.
Soil microbial life‐history traits and their functional genes
The average 16S rRNA genes, codon usage bias, average genome size gradually increased with the year since restoration (Figure 3A–D), whereas variation in guanine–cytosine (GC) contents was found to follow a reverse pattern. No significant difference in 16S rRNA genes and codon usage bias was found between 1‐ and 5‐year sites (p > 0.05).
Figure 3.

Soil microbial life‐history traits during grassland restoration. Box plots show the comparisons of life‐history trait values during grassland restoration. The medians in these box plots are as follows: average 16S rRNA genes (A), codon usage bias (B), average genome size (C), and GC content (D). The lower and upper boundaries of the box represent the first and third quartiles, respectively; the horizontal line represents the mean; the bounds of the lower and upper bars reflect the 10th and 90th percentiles, respectively. Different lowercase letters indicate a significant difference (p < 0.05) among the treatments (year since restoration) by Fisher's test following the analysis of variance. Relative abundance of soil microbial functional genes (E, C degradation genes; F, C fixation genes) during grassland restoration. The genes are arranged by the biodegradability of their target substrates, from labile to recalcitrant. GC, guanine–cytosine.
We analyzed 17 gene families encoding enzymes for C degradation and fixation (Figure 3E,F). Among C degrading genes, the relative abundances in amyA (encoding α‐amylase), amyX (encoding glucoamylase), abfA (encoding hemicellulose), and apu (encoding amylopectin) increased, while glx (encoding glyoxal oxidase for lignin degradation) decreased with year since restoration (Supporting Information Table S7). The relative abundances of the genes for C fixation (accA, aclB, acsA, and rbcL) and those of acsB and smtA gradually decreased with year since restoration (Supporting Information Table S8).
Fungal phospholipid fatty acids (PLFAs) gradually reduced, while bacterial PLFAs gradually increased with year since restoration (Figure 4); however, grassland restoration had no significant effect on the total PLFAs (p > 0.05). Meanwhile, fungal‐to‐bacterial PLFA ratio, Gram‐positive to Gram‐negative bacterial PLFA ratio, and K:r ratio gradually decreased with year since restoration.
Figure 4.

The response of major soil extracellular enzyme activities and microbial groups (indicated by PLFAs) during grassland restoration. All values are presented as means (standard errors). Different lowercase letters indicate a significant difference (p < 0.05) among the treatments (year since restoration) by Fisher's test following the analysis of variance. AG, α‐1,4‐glucosidase; AP, acid phosphatase; F:B ratio, fungal‐to‐bacterial PLFA ratio; G+:G− ratio, Gram‐positive to Gram‐negative bacterial PLFA ratio; NAG, β‐N‐acetylglucosaminidase; PLFAs, phospholipid fatty acids.
Importance of plant and soil properties on microbial life‐history traits
The relative abundance of Acidobacteria was positively correlated with root biomass, root C, STN, MBC, MBN, AG, and NAG (p < 0.05; Figure 5A). In contrast, the relative abundance of Proteobacteria was related to soil pH and negatively correlated with root biomass, root C, SOC, STN, MBC, MBN, and AG. For soil fungal phyla, the relative abundance of Ascomycota was positively correlated with root biomass, root C, STN, MBN, AG, and NAG. The relative abundance of Basidiomycota was negatively related to soil pH.
Figure 5.

Spearman correlation analysis between the relative abundance of dominant soil microbial phyla (left columns, bacterial communities; right columns, fungal communities) and plant and soil properties (A). The color of each cell is proportional to the value of Spearman's correlation coefficient. Green indicates a positive correlation (dark green, r = 0.80); red indicates a negative correlation (dark red, r = 0.80). *p < 0.05; **p < 0.01. The final structural equation model (SEM) depicting the effects of plant and soil properties on microbial life‐history traits (p = 0.634; χ 2 = 6.12; GFI = 0.984; AIC = 156.23; RSMEA = 0.002, 75%) (B). The rectangles are including observable variables. The numbers adjacent to the arrows are standardized path coefficients, analogous to relative regression weights, and are indicative of the effect of the size on the relationship. R 2 denotes the proportion of variance explained. The red numbers mean the negative effect, and the blue numbers mean the positive effect, respectively. AG, α‐1,4‐glucosidase; AP, acid phosphatase; MBC, microbial biomass C; MBN, microbial biomass N; MBP, microbial biomass P; NAG, β‐N‐acetylglucosaminidase; SAP, soil available P; SM, soil moisture content; SOC, soil organic C; STN, soil total N.
According to the final model in our structural equation modeling, soil properties positively while plant properties negatively influenced microbial life‐history traits (p < 0.05; Figure 5B). Most importantly, the variance of the changes in microbial life‐history traits was explained better by soil properties than by plant properties (Figure 5B).
DISCUSSION
Effects of grassland restoration on soil microbial communities
Generally, soil bacteria are classified as r‐strategists, and soil fungi are described as K‐strategists [35, 40, 45, 50, 56, 57, 58, 59]. Previous researches have shown a significant increase in soil fungi‐to‐bacteria ratio during the natural succession of abandoned croplands, indicating a possible shift from r‐ to K‐strategists [56, 57, 58, 59]. However, in this study, the ratio of fungal‐to‐bacterial biomass decreased during grassland restoration (Figure 4), which is consistent with other work on vegetation succession, in which bacteria may outcompete fungi during vegetation succession [60, 61, 62]. This is because soil fungi, especially filamentous fungal species, have a greater capacity than bacteria to explore the soil's pore networks at macroscales [63, 64]. Consumption of labile C compounds by bacterial r‐strategists at the early restoration stage might therefore be limited by short‐distance transport [54, 55, 65]. This limitation was lifted with grassland restoration, leading to the increase in bacterial r‐strategists. In addition, the ratio of Gram‐positive (G+):Gram‐negative (G‐) bacteria ratio also decreased during grassland restoration (Figure 4). Gram‐negative bacteria prefer to utilize more labile organic C than Gram‐positive bacteria. This leads to the decrease of K‐strategists, since the K‐strategists are more adapted to nutrient‐poor niches and efficient to mineralize the recalcitrant C [66, 67, 68, 69], implying a shift from K‐ towards r‐strategy and supporting our first hypothesis.
At the deep branching clades, Actinobacteria, Proteobacteria, Bacteroidetes, and Ascomycota are often considered fast‐growing copiotrophic members, which are endowed with numerous enzymes for the depolymerization of fresh organic matter and feed on labile organic C, and can be characterized as typical r‐strategists [70, 71, 72]. In this study, Actinobacteria, Proteobacteria, Bacteroidetes, and Ascomycota were particularly enriched in 30 years of restoration (Supporting Information Table S4), and all are rich in labile organic C. These copiotrophic microorganisms are typical soil inhabitants and respond fast to nutrient‐rich conditions, but are also able to utilize proteins and lipids (microbial components) and to participate in degrading polymers, such as cellulose [14, 60, 61, 62, 65, 73]. However, Acidobacteria, Planctomycetes, Chloroflexi, and Basidiomycota are relative K‐strategists (oligotrophs) as they can grow on hemicellulose or cellulose and mineralize recalcitrant organic C [60, 62, 73]. These slow‐growing or oligotrophic microorganisms play an important role in SOC decomposition because they primarily invest in the production of extracellular enzymes for the degradation of complex C during periods of resource scarcity [4, 5]. At an early restoration stage, low nutrient availability usually limits microbial growth and activity, in this case, microorganisms are dominant with r‐strategists, because they help in population re‐establishment after disturbance [51, 52]. Due to the poor availability of soil nutrients, these microorganisms usually invest more energy in reproduction than in growth, metabolism, or improving competitiveness [5, 74, 54]. However, this limitation can be alleviated as restoration continues over time because of increased soil C input and nutrient accumulation after vegetation restoration [1, 40]. At a late restoration stage, the relative abundance of Basidiomycota under the category of oligotrophs (K‐strategists) decreased. The rich soil nutrient resources were beneficial to microbial growth, and improved the decomposition and mineralization of organic matter, leading to high competition and stable populations (r‐strategists) [5, 19]. Such microorganisms with rapid growth stimulate the uptake of nutrients through root systems, which can generate more litter and root exudates, leading to a balance between nutrient cycling and decomposition [14, 54, 75, 76, 77].
In microbial networks (Supporting Information Figure S3), the high positive interactions of microbial co‐occurrence networks at the 30‐year site indicated that the proportion of potential cooperative interactions between microbial groups was relatively high [78, 79]. The high modularity of co‐occurrence network means that populations within communities may possess semblable ecological niches or modular structures [80, 81]. Compared with the 1‐year site, the microbial community network at the 30‐year site was more modular and had a more complex community structure (Supporting Information Figure S3). It is generally accepted that more complex communities have greater stability [1]. Therefore, the more complex microbial community network at the 30‐year site had higher stability when coping with a changing environment. This is because the higher soil nutrient resource increases the metabolic reaction of specific microorganisms, allowing them to occupy more ecological niches after long‐term environmental filtering [76]. In addition, fungi showed a higher Bray–Curtis distance than bacteria (Figure 2), indicating that soil fungi are more likely to mutate and evolve than bacterial during grassland restoration. This finding is consistent with other work on secondary succession [58], in which fungi may outcompete bacteria during succession and generate greater variation and evolution [82], because they establish close associations with plants and maybe more effective in utilizing the C available from plants.
Effects of grassland restoration on soil microbial functional genes and life‐history traits
Due to the enormous phylogenetic and physiological diversity within each phylum, it is unlikely that an entire phylum would share common ecological roles [1]. For example, in the phylum Proteobacteria, β‐Proteobacteria exhibit copiotrophic attributes (r‐strategists); while α‐Proteobacteria may not be classified as r‐strategists. Similarly, some members of the phylum Actinobacteria (e.g., Actinomycetales) are likely able to depolymerize complex and recalcitrant C compounds (e.g., lignin, cellulose), and, thus, showed a tendency as a K‐strategist [4, 5]. For example, in studies conducted in natural grassland and forest ecosystems, Actinobacteria grow slowly and can survive in nutrient‐poor conditions, and thus are usually classified as K‐strategists [17]. By contrast, in nutrient addition experiments, Actinobacteria is widely found to be positively related to increased N availability and classified as r‐strategists [83]. In addition to counting the proportion of likely oligotrophs or copiotrophs, the weighted averaged rRNA operon copy number is a better indicator for the ecological strategy of a microbial community [1]. Given that the rRNA operon copy number can be conveniently estimated by environmental genomic sequences in DNA databases because the rRNA operon copy number is conserved with phylogeny [4, 5]. It has been shown that genomic signatures, such as codon usage bias indices and the rRNA operon copy number, could be used as proxies for microbial life‐history strategies, because copiotrophs (r‐strategists) often have a higher rRNA gene copy number, while oligotrophs (K‐strategists) often have a lower rRNA gene copy number [6, 84]. The average copy numbers of rRNA genes gradually increased with year since grassland restoration (Figure 4), and the rich resource availability increased the ribosomal content and promoted the growth of copiotrophic microbial groups, further supporting the dominance of r‐strategists during grassland restoration. Moreover, the microorganisms demonstrated a high codon usage bias for the ribosomal gene [85, 86], indicating a high expression of the genes for rapid growth during grassland restoration [4]. This is because soil microorganisms usually use more energy for reproduction than for growth, metabolism, or enhancing competitiveness (K‐strategists) at the early restoration stage, whereas microorganisms at the late restoration stage had a low reproductive rate and a high survival rate, leading to high competitiveness and a stable number of populations (r‐strategists) [3, 4, 18, 19, 74, 40, 45].
The r/K selection concept was expanded to the functional gene data in this study. A previous study found that vegetation succession increased the diversity of soil microbial communities and the abundance of soil microbial genes associated with C fixation, C degradation (amyA, nplT, xylA, CDH, and glx) [45]. Vegetation succession increased C input and promoted the gene abundance of recalcitrant C decomposition. Our results showed that the abundances of labile C genes (amyA, amyX, apu, and sga) were higher in the older sites (Supporting Information Table S7), while the recalcitrant C genes (chiA, pgu, and glx) were higher at the early stage of grassland restoration (Supporting Information Table S8). It means that the population of soil microorganisms had a low reproductive rate but a high survival rate, resulting in strong competitiveness and a stable population of K‐strategists at the late restoration stage [4, 5, 14], while soil microorganisms often spend more energy on reproduction than on growth, metabolism and improving competitiveness (r‐strategists) at the late restoration stage. It is well known that the functional genes in microorganisms can regulate the corresponding activity of soil enzymes, and extracellular enzymes are the direct driver of soil C cycling [40]. The higher abundance of C‐fixing genes we found is a benefit to soil C sequestration [58, 81]. In addition, soil microorganisms are commonly C‐limited, and the enhanced availability of C due to increased plant production in conjunction with higher soil C contents, may contribute to greater microbial biomass to form recalcitrant C and benefit SOC accumulation, consistent with our previous studies [40, 42].
Effects of grassland restoration on the K:r ratio and the ecological implications on microbial life‐history traits
The negative relationship of K:r ratio with plant properties and the positive relationship with soil properties (p < 0.05, Figure 5B) support our second hypothesis. Our data thus suggest that changes in microbial life‐history traits were more strongly correlated with soil properties than with plant properties, similar to the findings of Zhang et al. [45] and Cui et al. [71]. This was because soil properties (including microbial biomass, nutrient contents, and extracellular enzyme activities) were improved during grassland restoration, and this considerably enhanced microbial metabolism and promoted microbial growth [40, 71, 87, 88, 89]. However, Mitchell et al. [90] found that the composition of plant communities was a better predictor for the microbial community than soil chemical properties in a boreal ecosystem. Similarly, Peay et al. [91] showed that the composition of fungal communities was more tightly associated with changes in plant communities in tropical forests. It is possible that those relationships are ecosystem‐specific. This was because the nutrient requirements (from plant and soil resources) for microorganisms varied greatly in different ecosystems [92, 93]. For example, in most grassland ecosystems, the nutrient requirements were mainly from plant residues, but microbial residues were the primary nutrient resource for microorganisms in most forest ecosystems [92].
Here, we established a framework of how plant and soil properties drove changes in soil microbial life‐history traits during grassland restoration (Figure 6). This life‐history framework enables us to directly link microbial performance to nutrient resource availabilities. Our results show that grassland restoration can promote plant growth and then increase the root biomass (Table 1), which produces large amounts of exudates and organic resources for the growth of microorganisms in microhabitats [94, 95]. In this case, the improvement of the nutrient resource may also alter the relative abundances of microorganisms with different growth strategies [50, 66, 96, 97]. We demonstrated that multiple ecologically informed traits inferred from metagenomic data could advance the trait‐based characterization of microbial communities within a copiotroph–oligotroph framework (Figure 6). However, it is important to note that metagenomic approaches are biased towards bacteria because of their dominance in the soil DNA pool [43, 98, 99]. Other important mediators of soil biogeochemical processes, such as fungi, soil viruses, and antibiotics, are not as well incorporated. Therefore, future studies should increase the sample size, better integrate soil eukaryotes, viruses and antibiotics, and more precisely target specific biogeochemical processes are essential for a better understanding of the relationships between soil communities, genes, and processes.
Figure 6.

A proposed framework that reveals plant and soil properties driving the changes in microbial life‐history traits. According to the Monod equation and the resource availability (both concentration and loading rate), r‐strategists (copiotrophs or opportunistic species) are described as living in temporarily resource‐rich environments, and characterized by high nutritional requirements per unit cell mass, faster specific growth and weaker substrate affinity, which preferentially use easily available soil organic C (SOC) (e.g., root exudates and other low molecular weight or water‐soluble organic C sources) when resources are rich. By contrast, microbial K‐strategists (oligotrophs or equilibrium species) are described as having the opposite of these characteristics, with slower specific growth but stronger substrate affinity. During grassland restoration, the members with an r‐strategy gradually increase to improve community productivity and opportunity, while other members with a K‐strategy decrease due to adjustment due functional redundancy for enhanced community efficiency. A balance in community between r‐ and K‐strategies facilitates adaptation to resource disturbance during grassland restoration.
CONCLUSIONS
We conclude that multiple ecologically informed traits inferred from amplicon sequencing, meta‐genomic, and GeoChip data can be used to study microorganisms within a copiotroph–oligotroph framework, and soil microbial life‐history traits shifted with plant and soil properties. Soil microorganisms shifted from oligotrophic to copiotrophic groups during grassland restoration, which was more strongly related to soil than plant properties. Therefore, we further conclude that the macro‐ecological theory could be applied to soil microbial life‐history traits and highlight the key roles of plant properties (root biomass and C content) and soil properties (mainly soil pH, SOC, and extracellular enzymes) on the changes in microbial strategies in restored grasslands.
METHODS
Study site
This study was conducted in restored grasslands located at an altitude of 1800–2100 m on the Loess Plateau in China (Supporting Information Figure S1). The region has a temperate climate and is dominated by temperate grasslands. The annual precipitation is 400–450 mm, with 60–75% of the precipitation occurring from July to September. The annual evaporation is 1017–1739 mm, and the annual mean temperature is around 7.0°C, with approximately 2500 h of annual average sunlight.
Historically, grassland degradation was caused by overgrazing (>50 sheep ha−1), land cultivation, as well as excessive hay harvesting. Multiple measures (enclosure and no grazing) have been taken by the Chinese government to conserve grassland resources. Therefore, grazing was forbidden for the area for vegetation restoration after the 1980s. In the 1980s, a long‐term natural restoration experiment was commenced with the aim of restoring degraded grasslands in this area. Before grassland conservation, soil physicochemical properties in our study area with the same soil type and natural conditions were not significantly different. A range of grasslands with similar degradation levels was selected at random and fenced for natural restoration every few years, generating a 30‐year chronosequence of restored grasslands without livestock grazing and anthropogenic disturbance. Around 300 species of wild plants [40, 55], such as A. stechmanniana, S. bungeana, Potentilla bifurca, Agropyron cristatum, Lespedeza daurica, and Thymus mongolicus, were found in this region. Currently, this area is used as an experimental field to monitor grassland dynamics at the Chinese Academy of Sciences.
Sampling design
On the basis of our previous studies in this area [40, 54], six grasslands representing 1, 5, 10, 15, 25, and 30 years since restoration were sampled in August 2019. These grasslands had similar elevation, slope position, and aspect, with the same typical loess soil [65]. Three random plots (40 × 60 m) were selected from each grassland. We installed three quadrats (1 × 1 m) in each plot (Supporting Information Figure S1). In each quadrat, five soil samples (more than 1 kg) were collected from the 0–10 cm depth using a stainless steel corer (5 cm inner diameter), and then mixed into one composite sample. Altogether, 6 × 3 × 3 = 54 samples were collected and sieved using a 2‐mm mesh to remove partial roots and debris.
A portion of soil samples was stored at 4°C for measuring microbial biomass carbon (C), nitrogen (N), phosphorus (P), and extracellular enzyme activities. After removing the litter horizon and biological crusts, soil samples for measuring microbial communities were collected in 50 ml centrifuge tubes. The samples were frozen in liquid nitrogen, placed in a box containing dry ice, and delivered to the laboratory. The tubes were stored at −80°C before DNA extraction. The samples that were used to detect soil physicochemical properties were sieved using a 2‐mm mesh and milled to powder (RM200, Retsch).
Plant properties
In each quadrat, we cut all the plant shoots and dug up all the roots (1 × 1 m2) to a depth of 50 cm. We rinsed and dried the plant samples at 75°C till constant weight to determine the biomass. Then, the samples were sieved via a 0.5‐mm mesh to analyze C, N, and P concentrations. We also determined the vegetation composition in each quadrat (Supporting Information Table S1).
The root and leaf C, N concentrations were analyzed using an Element analyzer (AIC100). A microwave digestion system (NAI‐WB) was used to digest samples with 70% HNO3 for 12 h; leaf and root P concentrations were then measured by molybdenum blue colorimetry [100].
Soil properties
We used a WET sensor (WET‐2 sensor, Delta‐T Devices Ltd.) for determining soil moisture content and a pH meter (Model PHS‐2, INESA Instrument) for measuring soil pH [101]. The Kjeldahl method was used for measuring STN, while the potassium dichromate external heating approach was used to measure SOC [102]. SAP was measured by treatment with 0.5 mol L−1 NaHCO3 followed by molybdenum blue colorimetry [101]. For measuring soil microbial biomass C, N, and P (MBC, MBN, and MBP, mg kg−1), we extracted approximately 4.0 g freshly prepared soil specimens with 0.5 M K2SO4 for a 1.5‐h period within the overhead shaker under ambient temperature, followed by filtration using paper filters (3 hw, Sartorius Stedim Biotech). Then, we determined MBC, MBN, and MBP using a fumigation–extraction method [101].
The MBC was calculated as EC/kEC, where EC = (organic C extracted from fumigated soils) − (organic C extracted from nonfumigated soils) and kEC = 0.45.
The MBN was calculated as EN/kEN, where EN = (total N extracted from fumigated soils) − (total N extracted from nonfumigated soils) and kEN = 0.54.
The MBP was calculated as EP/kEP, where EP = (total P extracted from fumigated soils) − (total P extracted from nonfumigated soils) and kEP = 0.40.
About 4.0 g of each fresh sample was stirred with 40 ml of 1 M acetic acid buffer solution (pH = 5.0) for 2 min, to obtain a homogenate. Next, 100 μl of this homogenate and 150 μl of acetic acid buffer solution were added to the wells of black 96‐well microplates. Compounds with high fluorescence, including 4‐methylumbelliferone (MUB), were used to measure extracellular soil enzymes, such as AP, AG, and NAG, by standard fluorometric approaches [18]. Then, the MUB standard curves (0, 2.5, 5, 10, 25, 50, and 100 μM) were plotted [48]. Each sample had a test (substrate + homogenate) and a control (buffer + homogenate), and each sample was assayed with eight replicates in the microplates. After being incubated at 25°C for 3 h, 1 μl of 1 M NaOH was added to stop the reactions in the samples. Fluorescence values were recorded at 450 nm for emission and 365 nm for excitation (Beckman Coulter DTX 880) [103]. After correcting for quenching, extracellular soil enzymes are expressed in units of nmol activity g−1 dry soil h−1 (nmol g−1 h−1). Enzyme commission numbers, incubation times, and substrates for each enzyme can be found in Supporting Information Table S9.
Amplicon sequencing
Homogenized soil (0.5 g) was used for genomic DNA extraction with the Soil DNA Kit (200) (MoBio Laboratories). Primers were used for the V3–V4 regions of the 16S rRNA gene in soil bacteria exclusively by polymerase chain reaction (PCR) assay and included F515 (5′‐GTGCCAGCMGCCGCGGTAA‐3′) and R907 (5′‐CCGTCAATTCMTTTRAGTTT‐3′) for amplification [1]. For soil fungi, the ITS region, which was used as the universal DNA barcode marker, was amplified with the primers ITS1F (5′‐GGAAGTAAAAGTCGTAACAAGG‐3′) and ITS2R (5′‐GCTGCGTTCTTCATCGATGC‐3′). Following normalization with the purified amplicons, they were integrated at equimolar contents and underwent paired‐end sequencing (2 × 300 bp) on the Illumina MiSeq platform (Guhe Information Technology Co. Ltd.).
Processing of sequence data
Using the Quantitative Insights Into Microbial Ecology (QIIME, version 2.0, https://qiime2.org/), we performed extra trimming and demultiplexing on sequence reads, and then the reads depth was corrected [78]. For the FastQ files, the Sickle software was used to filter raw sequence reads and remove sequences that were <150 bp or had a mean quality score <20. Then, after trimming the rest of the sequences to barcoded ITS or 16S rRNA gene sequences, we selected representative sequences by an online search using BLAST (http://sundarlab.ucdavis.edu/rice/blast/blast.html) according to the significant similarity. Then, QIIME was used to annotate the barcoded ITS or 16S rRNA gene sequences to various libraries and obtain operational taxonomic units (OTUs), which were screened by Vsearch (v. 1.11.1, https://github.com/torognes/vsearch/releases) for dereplication, clustering, and chimera detection. Taxonomy was assigned to OTUs based on their representative sequence by using Greengene 13.8 (http://www.greengene.com/). The number of sequences per sample was normalized by the size of the sequences and by the sampling coverage. Then, we performed coverage‐based rarefaction in R statistical software with the “iNEXT” package [79]. Indicators of soil microbial diversity, such as Shannon–Wiener, Simpson, and Chao1 indices, were measured by QIIME. The phylogenetic trees of the UniFrac distances among bacterial and fungal phylotypes were rooted and constructed using the neighbor‐joining method (Supporting Information Figure S2).
Microbial PLFAs
Soil microbial PLFAs were extracted from each of 6 g freeze‐dried soil samples using a chloroform–methanol extraction mixture modified to incorporate a phosphate buffer [42]. The abundance of individual fatty acids was determined as nmol per gram dry soil. Standard nomenclature was used to describe PLFAs. PLFA concentrations were calculated based on the 19:0 (methyl nonadecanoate, C20H40O2) internal standard concentration. Overall, microbial community composition represented by PLFAs was distinguished into bacteria (Gram‐positive bacteria and Gram‐negative bacteria) and fungi, which are listed in Supporting Information Table S10. The G+:G− and F:B ratios represent Gram‐positive to Gram‐negative bacterial biomass ratio and fungal‐to‐bacterial biomass ratio, respectively.
In addition, the microbial life‐history strategies of K‐ and r‐members in microbial communities and functional genes are listed in Supporting Information Table S11. We used Gram‐positive bacteria and Gram‐negative bacteria to calculate the K:r ratio.
GeoChip data and functional gene abundance
For determining the compositions of functional genes, the GeoChip 5.0 (60 K) technology was utilized to obtain the relative abundances of functional genes in soil microorganisms. There were ~60,000 oligonucleotide probes in the gene array belonging to ~400 gene families associated with biogeochemical events, such as C and N cycling genes [104]. In brief, after purification, this work labeled 0.8 μg DNA using Cy‐3 dye (GE Healthcare UK Limited), followed by purification using the QIAquick kit (Qiagen) as well as drying within the SpeedVac (ThermoSavant). After 24‐h hybridization of labeled samples under 67°C, this work utilized NimbleGen MS 200 microarray scanner (Roche) for scanning GeoChip microarray. Thereafter, Agilent's Data Extraction software was employed for image data processing and signal intensity transformation. We eliminated spots whose signal intensity was <2‐fold background, and the signal‐to‐noise ratio was <2 [105]. Additionally, probes measured within one replicate were eliminated. For every spot, we normalized its signal intensity based on relative abundances across diverse samples before later biostatistical analyses. The abundance of functional annotations was filtered, and annotations with a minimum abundance of 10% were removed. Finally, annotation abundance was normalized through log‐transformation [1, 3, 14].
Metagenomic data and microbial life‐history traits
For meta‐genomic sequencing, the total soil genomic DNA was extracted using the FastDNA SPIN Kit (MP Biomedicals) and purified using the DNeasy PowerClean Pro Cleanup Kit (Qiagen) according to the guidelines of the manufacturers. The concentration of DNA in all the samples was obtained by equalization in PCR water (MoBio Laboratories), and then, the DNA was trimmed to 300 bp fragments by placing the samples in 50 µl tubes and subjecting them to an M220 Focused‐ultrasonicator (Covaris) for 90 s [25]. The DNA samples were subsequently transported to Weishengtai Technology Co. Ltd. for preparing the library and shotgun metagenomic sequencing using the Illumina HiSeq. 4000 platform (Illumina Inc.), following specific protocols (www.illumina.com). The reads were annotated using the subsystem and GenBank databases for functional genes and taxonomy, respectively [28]. The minimum identity of annotation filtering was 80%, with an e‐value cut‐off at 1 × 10−5 and a minimum alignment length of 20 bp, which was more restrictive compared to the default parameters [106].
We computed the sample traits based on metagenomic sequencing data to elucidate the life‐history traits of microorganisms. First, the rRNA operon copy number for each OTU was estimated through the rrnDB database, based on its closest relatives with known rRNA operon copy numbers. We calculated the abundance‐weighted average rRNA operon copy number of OTUs for each sample, taking the product of the estimated operon copy number and the relative abundance for each OTU and summing this value across all OTUs in a sample [107]. Second, Genome quantity was assumed to be the average coverage of single‐copy genes. We calculated the mean genome size as the quotient of the number of base pairs and genomes [108]. Third, we calculated the codon usage bias between the mean and upregulated genes [1]. Briefly, ΔENC' was used as an empirical estimator for selection strength acting on codon usage bias of upregulated genes. For every genome, the ΔENC' value was measured for all coding sequences (ΔENC'all) and ribosomal protein gene (ΔENC'rib) concentrations, with mean coding nucleotide frequency. Then, ΔENC' was indicated by
For all gene sets, open reading frames of at least 450 bp were obtained using the EMBOSS function getorf [4]. For the upregulated gene sets, ribosomal proteins were obtained based on the similarity with the ribosomal proteins from a database for the existing sequenced genomes (e‐value < 10–5) [3, 109]. Finally, the genomic GC content was obtained from the NCBI Genome Database, and we calculated the variance of GC of the quality‐filtered reads as described in Wang et al. [47].
Statistical analyses
Statistical analyses were conducted using the R software v. 3.4.2 (http://www.datavis.ca/R/), and one‐way analysis of variance combined with Fisher's test was used at 95% (p < 0.05) and 99% (p < 0.01) probability levels. We adopted NMDS based on Bray–Curtis dissimilarities to determine the changes in soil microbial community structures. The NMDS analysis was performed using the “vegan” package to visualize the sample relationships across different groups. Different network construction methods may lead to different information. SparCC was found to have the highest performance among a series of methods tested, which was also used to construct the co‐occurrence network in this study [79]. Co‐occurrence networks were constructed for microbial communities by Spearman correlations using the “corr.test” function in the psych R package. In each microbial taxa (bacteria or fungi) during grassland restoration, the 500 most abundant OTUs were selected to construct the SparCC co‐occurrence networks. Both Spearman correlation and SparCC results were filtered by the thresholds r > 0.75 and false discovery rate <0.05. Network graphs were generated by using the “igraph” R package, and the nodes in the co‐occurrence networks represent the OTUs, whereas the edges correspond to a significant correlation between nodes. To better quantify the topology of networks, a set of network parameters, including numbers of nodes and edges, average path length, network diameter, cumulative degree distribution, clustering coefficient, modularity, and so forth, was calculated and networks were visualized using the interactive platform Gephi 0.9.2 (https://gephi.org; Supporting Information Figure S3).
Spearman coefficients (using the “cor” function) were calculated to determine the correlation of environmental factors, such as plant and soil properties, and the relative abundance of the predominant microbial phyla, and then, heatmaps were made by using ORIGIN 21.0 software (http://www.origin.com/) [78]. The structural equation model (SEM) was particularly useful in large‐scale correlative studies, as it allows us to partition causal influences among multiple variables. The first step in SEM requires the establishment of an a priori model based on known effects on microbial life‐history traits (K:r ratio). A priori model (Supporting Information Figure S4) was established based on the effects of plant and soil properties on microbial life‐history traits (K:r ratio). This model included two groups: plant properties (including plant coverage, diversity, root biomass, root C, N, P, and leaf C, N, P) and soil properties (including soil pH, SOC, STN SAP, MBC, MBN, MBP, AG, NAG, and AP). Some data manipulation was required before modeling to improve the normality and linearity of our data. For example, data were transformed as necessary (including plant coverage, diversity, root biomass, root C, N, P, and leaf C, N, P, soil pH, SOC, STN SAP, MBC, MBN, MBP, AG, NAG, and AP) to meet assumptions of normality and homogeneity of variance, and tests were considered significant at p ≤ 0.05. Plant and soil properties were included as a composite variable. After attaining a satisfactory model fit, we introduced composite variables into our model. The use of composite variables does not alter the underlying model but collapses the effects of multiple conceptually related variables into a single‐composite effect, aiding the interpretation of model results [80]. Since some of the variables introduced were not normally distributed, the probability that a path coefficient differs from zero was tested using bootstrap resampling. Bootstrapping is preferred to the classical maximum‐likelihood estimation in these cases because, in bootstrapping, probability assessments are not based on the assumption that data follow a particular theoretical distribution [81]. Thus, data are randomly sampled with replacement to arrive at estimates of standard errors that are empirically associated with the distribution of the data found in the samples. When these data manipulations were completed, we parameterized our model using our data set and tested its overall goodness of fit. We used the low χ 2 value, 0.05 ≤ p ≤ 1.00, and 0 ≤ RMSEA ≤ 0.05 (root mean square error of approximation), comparative fit index (CFI > 0.90). Additionally, because some variables were not normal, we confirmed the fit of the model using the Bollen–Stine bootstrap test (the model has a good fit when 0.10 < bootstrap p ≤ 1.00), and finally our model attained an acceptable fit by all criteria. With a good model fit, we were free to interpret the path coefficients of the model and their associated p values. The SEM analysis was conducted using AMOS 21.0 (SPSS Inc., https://spssau.com/).
AUTHOR CONTRIBUTIONS
Yang Yang and Yanxing Dou conceived and supervised the study. Yang Yang and Zhijing Xue established the experimental sites. Yang Yang and Baorong Wang collected the samples and analyzed the data. Yunqiang Wang, Shaoshan An, and Scott X. Chang assisted with data analysis. Yang Yang wrote the manuscript with input from all authors.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
Supporting information
Supporting information.
Supporting information.
ACKNOWLEDGMENTS
This study was funded by the Strategic Priority Research Program of Chinese Academy of Science (No. XDB40020203), the National Natural Sciences Foundation of China (Nos. 42107282 and 42077072), the CAS “Light of West China” Program (No. XAB2019B07), the Natural Science Foundation of Shaanxi Province (No. 2021JM‐213), and the State Key Laboratory of Loess and Quaternary Geology, Chinese Academy of Sciences (No. SKLLQGPY2004).
Yang, Yang , Dou Yanxing, Wang Baorong, Xue Zhijing, Wang Yunqiang, An Shaoshan, and Chang Scott X.. 2023. “Deciphering factors driving soil microbial life‐history strategies in restored grasslands.” iMeta 2, e66. 10.1002/imt2.66
Contributor Information
Yunqiang Wang, Email: wangyq@ieecas.cn.
Shaoshan An, Email: shan@ms.iswc.ac.cn.
DATA AVAILABILITY STATEMENT
All the data needed to evaluate the conclusions in the paper are presented in the paper and/or the supplementary materials. The 16S and ITS sequences were submitted to the SRA of the NCBI under accession numbers PRJNA600081 and PRJNA600087. The data and scripts used are saved in GitHub https://github.com/yangyangnature/Soil-microbial-life-history-strategies-in-restored-grasslands. Supplementary materials (figures, tables, scripts, graphical abstract, slides, videos, Chinese translated version and updated materials) may be found in the online DOI or iMeta Science http://www.imeta.science/.
REFERENCES
- 1. Chen, Yongjian , Neilson Julia W., Kushwaha Priyanka, Maier Raina M., and Barberán Albert. 2021. “Life‐History Strategies of Soil Microbial Communities in an Arid Ecosystem.” The ISME Journal 15: 649–57. 10.1038/s41396-020-00803-y [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Shao, Pengshuai , Lynch Laurel, Xie Hongtu, Bao Xuelian, and Liang Chao. 2021. “Tradeoffs Among Microbial Life History Strategies Influence the Fate of Microbial Residues in Subtropical Forest Soils.” Soil Biology and Biochemistry 153: 108112. 10.1016/j.soilbio.2020.108112 [DOI] [Google Scholar]
- 3. Nakov, Teofil , Beaulieu Jeremy M., and Alverson Andrew J.. 2018. “Accelerated Diversification Is Related to Life History and Locomotion in a Hyperdiverse Lineage of Microbial Eukaryotes.” New Phytologist 219: 462–73. 10.1111/nph.15137 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Cairns, Johannes , Moerman Felix, Fronhofer Emanuel A., Altermatt Florian, and Hiltunen Teppo. 2020. “Evolution in Interacting Species Alters Predator Life‐History Traits, Behaviour and Morphology in Experimental Microbial Communities.” Proceedings of the Royal Society B 287: 20200652. 10.1098/rspb.2020.0652 [DOI] [PMC free article] [PubMed]
- 5. Pianka, Eric R. 1970. “On r‐ and K‐Selection.” The American Naturalist 104: 592–7. 10.1086/282697 [DOI] [Google Scholar]
- 6. Malik, Ashish A. , Martiny Jennifer B. H., Brodie Eoin L., Martiny Adam C., Treseder Kathleen K., and Allison Steven D.. 2020. “Defining Trait‐Based Microbial Strategies with Consequences for Soil Carbon Cycling Under Climate Change.” The ISME Journal 14: 1–9. 10.1038/s41396-019-0510-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Fierer, Noah , Bradford Mark A., and Jackson Robert B.. 2007. “Toward an Ecological Classification of Soil Bacteria.” Ecology 88: 1354–64. 10.1890/05-1839 [DOI] [PubMed] [Google Scholar]
- 8. Grime, J. Philip . 1977. “Evidence for The Existence of Three Primary Strategies in Plants and Its Relevance to Ecological and Evolutionary Theory.” The American Naturalist 111: 1169–94. 10.2307/2460262 [DOI] [Google Scholar]
- 9. Pierce, Simon , Negreiros Daniel, Cerabolini Bruno E. L., Kattge Jens, Díaz Sandra, Kleyer Michael, Shipley Bill, et al. 2017. “A Global Method for Calculating Plant CSR Ecological Strategies Applied Across Biomes World‐Wide.” Functional Ecology 31: 444–57. 10.1111/1365-2435.12722 [DOI] [Google Scholar]
- 10. Bellingham, Peter J. , and Sparrow Ashley D.. 2000. “Resprouting as a Life History Strategy in Woody Plant Communities.” Oikos 89(2): 409–16. 10.1034/j.1600-0706.2000.890224.x [DOI] [Google Scholar]
- 11. Li, Chaonan , Liao Haijun, Xu Lin, Wang Changting, He Nianpeng, Wang Junming, and Li Xiangzhen. 2022. “The Adjustment of Life History Strategies Drives the Ecological Adaptations of Soil Microbiota to Aridity.” Molecular Ecology 31: 2920–34. 10.1111/mec.16445 [DOI] [PubMed] [Google Scholar]
- 12. Malik, Ashish A. , and Bouskill Nicholas J.. 2022. “Drought Impacts on Microbial Trait Distribution and Feedback to Soil Carbon Cycling.” Functional Ecology 36: 1442–56. 10.1111/1365-2435.14010 [DOI] [Google Scholar]
- 13. Burghardt, Liana T. , Epstein Brendan, Guhlin Joseph, Nelson Matt S., Taylor Margaret R., Young Nevin D., Sadowsky Michael J., et al. 2018. “Select and Resequence Reveals Relative Fitness of Bacteria in Symbiotic and Free‐Living Environments.” Proceedings of the National Academy of Sciences 115: 2425–30. 10.1073/pnas.1714246115 [DOI] [PMC free article] [PubMed]
- 14. Delgado‐Baquerizo, Manuel , Maestre Fernando T., Reich Peter B., Jeffries Thomas C., Gaitan Juan J., Encinar Daniel, Berdugo Miguel, Campbell Colin D., and Singh Brajesh K.. 2016. “Microbial Diversity Drives Multifunctionality in Terrestrial Ecosystems.” Nature Communications 7: 10541. 10.1038/ncomms10541 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Schutter, Mary , and Dick Richard. 2001. “Shifts in Substrate Utilization Potential and Structure of Soil Microbial Communities in Response to Carbon Substrates.” Soil Biology and Biochemistry 33: 1481–91. 10.1016/S0038-0717(01)00057-8 [DOI] [Google Scholar]
- 16. Larkin, Robert P. 2003. “Characterization of Soil Microbial Communities Under Different Potato Cropping Systems by Microbial Population Dynamics, Substrate Utilization, and Fatty Acid Profiles.” Soil Biology and Biochemistry 35: 1451–66. 10.1016/S0038-0717(03)00240-2 [DOI] [Google Scholar]
- 17. Li, Hui , Yang Shan, Semenov Mikhail V., Yao Fei, Ye Ji, Bu Rencang, Ma Ruiao, et al. 2021. “Temperature Sensitivity of SOM Decomposition Is Linked with a K‐Selected Microbial Community.” Global Change Biology 27: 2763–79. 10.1111/gcb.15593 [DOI] [PubMed] [Google Scholar]
- 18. Sinsabaugh, Robert L. , Hill Brian H., and Follstad Shah Jennifer J.. 2009. “Ecoenzymatic Stoichiometry of Microbial Organic Nutrient Acquisition in Soil and Sediment.” Nature 462: 795–8. 10.1038/nature08632 [DOI] [PubMed] [Google Scholar]
- 19. Colloff, Matt . 2004. “Communities and Ecosystems: Linking the Above‐Ground and Below‐Ground Components.” Austral Ecology 29: 358–9. 10.1111/j.1442-9993.2004.01322.x [DOI] [Google Scholar]
- 20. de Vries, Franciska T. , Manning Pete, Tallowin Jerry R. B., Mortimer Simon R., Pilgrim Emma S., Harrison Kathryn A., Hobbs Phil J., et al. 2012. “Abiotic Drivers and Plant Traits Explain Landscape‐Scale Patterns in Soil Microbial Communities.” Ecology Letters 15: 1230–9. 10.1111/j.1461-0248.2012.01844.x [DOI] [PubMed] [Google Scholar]
- 21. Sinsabaugh, Robert L. , Manzoni Stefano, Moorhead Daryl L., and Richter Andreas. 2013. “Carbon Use Efficiency of Microbial Communities: Stoichiometry, Methodology and Modelling.” Ecology Letters 16: 930–9. 10.1111/ele.12113 [DOI] [PubMed] [Google Scholar]
- 22. Lalanne, Jean‐Benoît , Taggart James C., Guo Monica S., Herzel Lydia, Schieler Ariel, and Li Gene‐Wei. 2018. “Evolutionary Convergence of Pathway‐Specific Enzyme Expression Stoichiometry.” Cell 173: 749–61. 10.1016/j.cell.2018.03.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Stock, Svenja C. , Köster Moritz, Dippold Michaela A., Nájera Francisco, Matus Francisco, Merino Carolina, Boy Jens, et al. 2019. “Environmental Drivers and Stoichiometric Constraints on Enzyme Activities in Soils from Rhizosphere to Continental Scale.” Geoderma 337: 973–82. 10.1016/j.geoderma.2018.10.030 [DOI] [Google Scholar]
- 24. Tian, Peng , Razavi Bahar S., Zhang Xuechen, Wang Qingkui, and Blagodatskaya Evgenia. 2020. “Microbial Growth and Enzyme Kinetics in Rhizosphere Hotspots Are Modulated by Soil Organics and Nutrient Availability.” Soil Biology and Biochemistry 141: 107662. 10.1016/j.soilbio.2019.107662 [DOI] [Google Scholar]
- 25. Burns, Richard G. , DeForest Jared L., Marxsen Jürgen, Sinsabaugh Robert L., Stromberger Mary E., Wallenstein Matthew D., Weintraub Michael N., et al. 2013. “Soil Enzymes in a Changing Environment: Current Knowledge and Future Directions.” Soil Biology and Biochemistry 58: 216–34. 10.1016/j.soilbio.2012.11.009 [DOI] [Google Scholar]
- 26. Zhao, Fazhu , Ren Chenjie, Han Xinghui, Yang Gaihe, Wang Jun, and Doughty Russell. 2018. “Changes of Soil Microbial and Enzyme Activities Are Linked to Soil C, N and P Stoichiometry in Afforested Ecosystems.” Forest Ecology and Management 427: 289–95. 10.1016/j.foreco.2018.06.011 [DOI] [Google Scholar]
- 27. Ghosh, Avijit , Singh A. B., Kumar R. V., Manna M. C., Bhattacharyya Ranjan, Mahmudur Rahman Mohammad, and Sharma Poonam, et al. 2020. “Soil Enzymes and Microbial Elemental Stoichiometry as Bio‐Indicators of Soil Quality in Diverse Cropping Systems and Nutrient Management Practices of Indian Vertisols.” Applied Soil Ecology 145: 103304. 10.1016/j.apsoil.2019.06.007 [DOI] [Google Scholar]
- 28. Bullock, James M. , Aronson James, Newton Adrian C., Pywell Richard F., and Rey‐Benayas Jose M.. 2011. “Restoration of Ecosystem Services and Biodiversity: Conflicts and Opportunities.” Trends in Ecology and Evolution 26: 541–49. 10.1016/j.tree.2011.06.011 [DOI] [PubMed] [Google Scholar]
- 29. Johnson, Christopher N. , Balmford Andrew, Brook Barry W., Buettel Jessie C., Galetti Mauro, Guangchun Lei, Wilmshurst Janet M., et al. 2017. “Biodiversity Losses and Conservation Responses in the Anthropocene.” Science 356: 270–75. 10.1126/science.aam9317 [DOI] [PubMed] [Google Scholar]
- 30. Fu, Bojie , Chen Liding, Ma Keming, Zhou Huafeng, and Wang Jun. 2000. “The Relationships Between Land Use and Soil Conditions in the Hilly Area of the Loess Plateau in Northern Shaanxi, China.” Catena 39: 69–78. 10.1016/S0341-8162(99)00084-3 [DOI] [Google Scholar]
- 31. Huang, Laiming , and Shao Ming'an. 2019. “Advances and Perspectives on Soil Water Research in China's Loess Plateau.” Earth‐Science Reviews 199: 102962. 10.1016/j.earscirev.2019.102962 [DOI] [Google Scholar]
- 32. Deng, Lei , Shangguan Zhou‐ping, and Sweeney Sandra. 2014. “Grain for Green” Driven Land Use Change and Carbon Sequestration on the Loess Plateau, China.” Scientific Reports 4: 7039. 10.1038/srep07039 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Feng, Xiaoming , Fu Bojie, Piao Shilong, Wang Shuai, Ciais Philippe, Zeng Zhenzhong, Lü Yihe, et al. 2016. “Revegetation in China's Loess Plateau Is Approaching Sustainable Water Resource Limits.” Nature Climate Change 6: 1019–22. 10.1038/nclimate3092 [DOI] [Google Scholar]
- 34. Deng, Lei , Peng Changhui, Huang Chunbo, Wang Kaibo, Liu Qiuyu, Liu Yulin, Hai Xuying, and Shangguan Zhouping. 2019. “Drivers of Soil Microbial Metabolic Limitation Changes Along a Vegetation Restoration Gradient on the Loess Plateau, China.” Geoderma 353: 188–200. 10.1016/j.geoderma.2019.06.037 [DOI] [Google Scholar]
- 35. Xu, Zhiwei , Yu Guirui, Zhang Xinyu, He Nianpeng, Wang Qiufeng, Wang Shengzhong, Wang Ruili, et al. 2017. “Soil Enzyme Activity and Stoichiometry in Forest Ecosystems Along the North‐South Transect in Eastern China.” Soil Biology and Biochemistry 104: 152–63. 10.1016/j.soilbio.2016.10.020 [DOI] [Google Scholar]
- 36. Hu, Peilei , Liu Shujuan, Ye Yingying, Zhang Wei, Wang Kelin, and Su Yirong. 2018. “Effects of Environmental Factors on Soil Organic Carbon Under Natural or Managed Vegetation Restoration.” Land Degradation and Development 29: 387–97. 10.1002/ldr.2876 [DOI] [Google Scholar]
- 37. Yang, Yang , Liu Bingru, and An Shaoshan. 2018. “Ecological Stoichiometry in Leaves, Roots, Litters and Soil Among Different Plant Communities in a Desertified Region of Northern China.” Catena 166: 328–38. 10.1016/j.catena.2018.04.018 [DOI] [Google Scholar]
- 38. Deng, Lei , Kim Donggill, Li Miaoyu, Huang Chunbo, Liu Qiuyu, Cheng Min, Shangguan Zhouping, et al. 2019. “Land‐Use Changes Driven by ‘Grain for Green’ Program Reduced Carbon Loss Induced by Soil Erosion on the Loess Plateau of China.” Global and Planetary Change 177: 101–15. 10.1016/j.gloplacha.2019.03.017 [DOI] [Google Scholar]
- 39. Li, Jiwei , Liu Yulin, Hai Xuying, Shangguan Zhouping, and Deng Lei. 2019. “Dynamics of Soil Microbial C:N:P Stoichiometry and Its Driving Mechanisms Following Natural Vegetation Restoration After Farmland Abandonment.” Science of The Total Environment 693: 133613. 10.1016/j.scitotenv.2019.133613 [DOI] [PubMed] [Google Scholar]
- 40. Yang, Yang , Liang Chao, Wang Yunqiang, Cheng Huan, An Shaoshan, and Chang Scott X.. 2020. “Soil Extracellular Enzyme Stoichiometry Reflects the Shift From P‐ to N‐Limitation of Microorganisms with Grassland Restoration.” Soil Biology and Biochemistry 149: 107928. 10.1016/j.soilbio.2020.107928 [DOI] [Google Scholar]
- 41. Zhou, Zhenghu , Wang Chuankuan, Zheng Mianhai, Jiang Lifen, and Luo Yiqi. 2017. “Patterns and Mechanisms of Responses by Soil Microbial Communities to Nitrogen Addition.” Soil Biology and Biochemistry 115: 433–41. 10.1016/j.soilbio.2017.09.015 [DOI] [Google Scholar]
- 42. Yang, Yang , Dou Yanxing, Wang Baorong, Wang Yunqiang, Liang Chao, An Shaoshan, Soromotin Andrey, and Kuzyakov Yakov. 2022. “Increasing Contribution of Microbial Residues to Soil Organic Carbon in Grassland Restoration Chronosequence.” Soil Biology and Biochemistry 170: 108688. 10.1016/j.soilbio.2022.108688 [DOI] [Google Scholar]
- 43. Zechmeister‐Boltenstern, Sophie , Katharina Maria Keiblinger, Maria Mooshammer, Josep Peñuelas, Andreas Richter, Jordi Sardans, and Wolfgang Wanek. 2015. “The Application of Ecological Stoichiometry to Plant–Microbial–Soil Organic Matter Transformations.” Ecological Monographs 85: 133–55. 10.1890/14-0777.1 [DOI] [Google Scholar]
- 44. Yan, Benshuai , Lipeng Sun, Jingjing Li, Caiqun Liang, Furong Wei, Sha Xue, and Guoliang Wang. 2020. “Change in Composition and Potential Functional Genes of Soil Bacterial and Fungal Communities with Secondary Succession in Quercus liaotungensis Forests of the Loess Plateau, Western China.” Geoderma 364: 114199. 10.1016/j.geoderma.2020.114199 [DOI] [Google Scholar]
- 45. Zhang, Chao , Liu Guobin, Xue Sha, and Wang Guoliang. 2016. “Soil Bacterial Community Dynamics Reflect Changes in Plant Community and Soil Properties During the Secondary Succession of Abandoned Farmland in the Loess Plateau.” Soil Biology and Biochemistry 97: 40–9. 10.1016/j.soilbio.2016.02.013 [DOI] [Google Scholar]
- 46. Cutler, Nick A. , Chaput Dominique L., and van der Gast Christopher J.. 2014. “Long‐Term Changes in Soil Microbial Communities During Primary Succession.” Soil Biology and Biochemistry 69: 359–70. 10.1016/j.soilbio.2013.11.022 [DOI] [Google Scholar]
- 47. Wang, Guangzhou , Schultz Peggy, Tipton Alice, Zhang Junling, Zhang Fusuo, and Bever James D.. 2019. “Soil Microbiome Mediates Positive Plant Diversity‐Productivity Relationships in Late Successional Grassland Species.” Ecology Letters 22: 1221–32. 10.1111/ele.13273 [DOI] [PubMed] [Google Scholar]
- 48. Sinsabaugh, Robert L. , Lauber Christian L., Weintraub Michael N., Ahmed Bony, Allison Steven D., Crenshaw Chelsea, Contosta Alexandra R., et al. 2008. “Stoichiometry of Soil Enzyme Activity at Global Scale.” Ecology Letters 11: 1252–64. 10.1111/j.1461-0248.2008.01245.x [DOI] [PubMed] [Google Scholar]
- 49. Elser, James J. , and Hamilton Andrew. 2007. “Stoichiometry and the New Biology: The Future Is Now.” PLoS Biology 5: e181. 10.1371/journal.pbio.0050181 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Chen, Hao , Li Dejun, Zhao Jie, Zhang Wei, Xiao Kongcao, and Wang Kelin. 2018. “Nitrogen Addition Aggravates Microbial Carbon Limitation: Evidence From Ecoenzyme Stoichiometry.” Geoderma 329: 61–4. 10.1016/j.geoderma.2018.05.019 [DOI] [Google Scholar]
- 51. Cleveland, Cory C. , and Liptzin Daniel. 2007. “C:N:P Stoichiometry in Soil: Is There a “Redfield Ratio” for the Microbial Biomass? Biogeochemistry 85: 235–52. 10.1007/s10533-007-9132-0 [DOI] [Google Scholar]
- 52. Pausch, Johanna , and Kuzyakov Yakov. 2018. “Carbon Input by Roots into the Soil: Quantification of Rhizodeposition from Root to Ecosystem Scale.” Global Change Biology 24: 1–12. 10.1111/gcb.13850 [DOI] [PubMed] [Google Scholar]
- 53. Wei, Xiaomeng , Razavi Bahar S., Hu Yajun, Xu Xingliang, Zhu Zhenke, Liu Yuhuai, Kuzyakov Yakov, et al. 2019. “C/P Stoichiometry of Dying Rice Root Defines the Spatial Distribution and Dynamics of Enzyme Activities in Root‐Detritusphere.” Biology and Fertility of Soils 55: 251–63. 10.1007/s00374-019-01345-y [DOI] [Google Scholar]
- 54. Yang, Yang , Dou Yanxing, Huang Yimei, and An Shaoshan. 2017. “Links Between Soil Fungal Diversity and Plant Soil Properties on the Loess Plateau.” Frontiers in Microbiology 8: 2198. 10.3389/fmicb.2017.02198 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Liu, Shibin , Zamanian Kazem, Schleuss Per‐Marten, Zarebanadkouki Mohsen, and Kuzyakov Yakov. 2018. “Degradation of Tibetan Grasslands: Consequences for Carbon and Nutrient Cycles.” Agriculture, Ecosystems and Environment 252: 93–104. 10.1016/j.agee.2017.10.011 [DOI] [Google Scholar]
- 56. Shao, Pengshuai , Liang Chao, Rubert‐Nason Kennedy, Li Xiangzhen, Xie Hongtu, and Bao Xuelian. 2018. “Secondary Successional Forests Undergo Tightly‐Coupled Changes in Soil Microbial Community Structure and Soil Organic Matter.” Soil Biology and Biochemistry 128: 56–65. 10.1016/j.soilbio.2018.10.004 [DOI] [Google Scholar]
- 57. Feng, Chun , Ma Yuhua, Jin Xi, Wang Zhe, Ma Yan, Fu Songling, Chen Han, and Ma Y.H.. 2019. “Soil Enzyme Activities Increase Following Restoration of Degraded Subtropical Forests.” Geoderma 351: 180–7. 10.1016/j.geoderma.2019.05.006 [DOI] [Google Scholar]
- 58. Zhong, Yangquanwei , Yan Weiming, Wang Ruiwu, Wang Wen, and Shangguan Zhouping. 2018. “Decreased Occurrence of Carbon Cycle Functions in Microbial Communities Along with Long‐Term Secondary Succession.” Soil Biology and Biochemistry 123: 207–17. 10.1016/j.soilbio.2018.05.017 [DOI] [Google Scholar]
- 59. Li, Jiwei , Shangguan Zhouping, and Deng Lei. 2020. “Dynamics of Soil Microbial Metabolic Activity During Grassland Succession After Farmland Abandonment.” Geoderma 363: 114167. 10.1016/j.geoderma.2019.114167 [DOI] [Google Scholar]
- 60. Jangid, Kamlesh , Williams Mark A., Franzluebbers Alan J., Schmidt Thomas M., Coleman David C., and Whitman William B.. 2011. “Land‐Use History Has a Stronger Impact on Soil Microbial Community Composition Than Aboveground Vegetation and Soil Properties.” Soil Biology and Biochemistry 43: 2184–93. 10.1016/j.soilbio.2011.06.022 [DOI] [Google Scholar]
- 61. Griffiths, Bryan S. , Spilles Annette, and Bonkowski Michael. 2012. “C:N:P Stoichiometry and Nutrient Limitation of the Soil Microbial Biomass in a Grazed Grassland Site Under Experimental P Limitation or Excess.” Ecological Processes 1: 6. 10.1186/2192-1709-1-6 [DOI] [Google Scholar]
- 62. Leff, Jonathan W. , Jones Stuart E., Prober Suzanne M., Barberán Albert, Borer Elizabeth T., Firn Jennifer L., Harpole W. Stanley, et al. 2015. “Consistent Responses of Soil Microbial Communities to Elevated Nutrient Inputs in Grasslands Across the Globe.” Proceedings of the National Academy of Sciences 112: 10967–72. 10.1073/pnas.1508382112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Bystrianský, Lukáš , Hujslová Martina, Hršelová Hana, Řezáčová Veronika, Němcová Lenka, Šimsová Jana, Gryndlerová Hana, et al. 2019. “Observations on Two Microbial Life Strategies in Soil: Planktonic and Biofilm‐Forming Microorganisms Are Separable.” Soil Biology and Biochemistry 136: 107535. 10.1016/j.soilbio.2019.107535 [DOI] [Google Scholar]
- 64. Malik, Ashish A. , Dannert Helena, Griffiths Robert I., Thomson Bruce C., and Gleixner Gerd. 2015. “Rhizosphere Bacterial Carbon Turnover Is Higher in Nucleic Acids Than Membrane Lipids: Implications for Understanding Soil Carbon Cycling.” Frontiers in Microbiology 6: 268. 10.3389/fmicb.2015.00268 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Liu, Yang , Chen Xiaotian, Liu Jiaxi, Liu Tingting, Cheng Jimin, Wei Gehong, and Lin Yanbing. 2019. “Temporal and Spatial Succession and Dynamics of Soil Fungal Communities in Restored Grassland on the Loess Plateau in China.” Land Degradation and Development 30: 1273–87. 10.1002/ldr.3289 [DOI] [Google Scholar]
- 66. Zhang, Jiaoyang , Yang Xiaomei, Song Yahui, Liu Hongfei, Wang Guoliang, Xue Sha, Liu Guobin, et al. 2020. “Revealing the Nutrient Limitation and Cycling for Microorganisms Under Forest Management Practices in the Loess Plateau–Ecological Stoichiometry” Geoderma 361: 114108. 10.1016/j.geoderma.2019.114108 [DOI] [Google Scholar]
- 67. Delgado‐Baquerizo, Manuel , Maestre Fernando T., Reich Peter B., Trivedi Pankaj, Osanai Yui, Liu Yu‐Rong, Hamonts Kelly, et al. 2016. “Carbon Content and Climate Variability Drive Global Soil Bacterial Diversity Patterns.” Ecological Monographs 86: 373–90. 10.1002/ecm.1216 [DOI] [Google Scholar]
- 68. Hartman, Wyatt H. , Ye Rongzhong, Horwath William R., and Tringe Susannah G.. 2017. “A Genomic Perspective on Stoichiometric Regulation of Soil Carbon Cycling.” The ISME Journal 11: 2652. 10.1038/ismej.2017.115 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Meunier, Cédric L. , Boersma Maarten, El‐Sabaawi Rana, Halvorson Halvor M., Herstoff Emily M., Van de Waal Dedmer B., Vogt Richard J., and Litchman Elena. 2017. “From Elements to Function: Toward Unifying Ecological Stoichiometry and Trait‐Based Ecology.” Frontiers in Environmental Science 5: 18. 10.3389/fenvs.2017.00018 [DOI] [Google Scholar]
- 70. Zhang, Wei , Weichao Liu, Miaoping Xu, Jian Deng, Xinhui Han, Gaihe Yang, Feng Yongzhong, et al. 2019. “Response of Forest Growth to C:N:P Stoichiometry in Plants and Soils During Robinia pseudoacacia Afforestation on the Loess Plateau, China.” Geoderma 337: 280–89. 10.1016/j.geoderma.2018.09.042 [DOI] [Google Scholar]
- 71. Cui, Yongxing , Fang Linchuan, Guo Xiaobin, Han Fu, Ju Wenliang, Ye Luping, Wang Xia, et al. 2019. “Natural Grassland as the Optimal Pattern of Vegetation Restoration in Arid and Semi‐Arid Regions: Evidence From Nutrient Limitation of Soil Microorganisms.” Science of the Total Environment 648: 388–97. 10.1016/j.scitotenv.2018.08.173 [DOI] [PubMed] [Google Scholar]
- 72. Wang, Congyan , Wang Shu, Wu Bingde, Wei Mei, Rong Xinshan, Li Yan, and Du Daolin. 2020. “Ecological Restoration Treatments Enhanced Plant Soil Microbial Diversity in the Degraded Alpine Steppe in Northern Tibet.” Land Degradation & Development 32: 723–37. 10.1002/ldr.3754 [DOI] [Google Scholar]
- 73. Guo, Kangying , Zhao Yingzhi, Liu Yang, Chen Junhui, Wu Qifeng, Ruan Yifei, Li Songhao, et al. 2020. “Pyrolysis Temperature of Biochar Affects Ecoenzyme Stoichiometry and Microbial Nutrient‐Use Efficiency in a Bamboo Forest Soil.” Geoderma 363: 114162. 10.1016/j.geoderma.2019.114162 [DOI] [Google Scholar]
- 74. Liu, Hongfei , Wang Xiukang, Liang Chutao, Ai Zemin, Wu Yang, Xu Hongwei, Xue Sha, and Liu Guobin. 2020. “Glomalin‐Related Soil Protein Affects Soil Aggregation and Recovery of Soil Nutrient Following Natural Revegetation on the Loess Plateau.” Geoderma 357: 113921. 10.1016/j.geoderma.2019.113921 [DOI] [Google Scholar]
- 75. Fierer, Noah , and Jackson Robert B.. 2006. “The diversity and biogeography of soil bacterial communities.” Proceedings of the National Academy of Sciences 103: 626–31. 10.1073/pnas.0507535103 [DOI] [PMC free article] [PubMed]
- 76. Yuan, Mengting Maggie , Guo Xue, Wu Linwei, Zhang Ya, Xiao Naijia, Ning Daliang, Shi Zhou, et al. 2021. “Climate Warming Enhances Microbial Network Complexity and Stability.” Nature Climate Change 11: 343–8. 10.1038/s41558-021-00989-9 [DOI] [Google Scholar]
- 77. Wu, Minghui , Chen Shengyun, Chen Jianeei, Xue Kai, Chen Shilong, Wang Xiao‐ming, and Chen Tuo, et al. 2021. “Reduced microbial stability in the active layer is associated with carbon loss under alpine permafrost degradation.” Proceedings of the National Academy of Sciences 118(25), e2025321118. 10.1073/pnas.2025321118 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78. Jiao, Shuo , Chu Haiyan, Zhang Baogang, Wei Xiaorong, Chen Weimin, and Wei Gehong. 2022. “Linking Soil Fungi to Bacterial Community Assembly in Arid Ecosystems.” iMeta 1: e2. 10.1002/imt2.2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79. Zhong, Yangquanwei , Sorensen Patrick O., Zhu Guangyu, Jia Xiaoyu, Liu Jin, Shangguan Zhouping, Wang Ruiwu, and Yan Weiming. 2022. “Differential Microbial Assembly Processes and Co‐Occurrence Networks in the Soil–Root Continuum Along an Environmental Gradient.” iMeta 1: e18. 10.1002/imt2.18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80. Delgado‐Baquerizo, Manuel , Bissett Andrew, Eldridge David J., Maestre Fernando T., He Jizheng, Wang Jun‐Tao, Hamonts Kelly, et al. 2017. “Palaeoclimate Explains a Unique Proportion of the Global Variation in Soil Bacterial Communities.” Nature Ecology and Evolution 1: 1339–47. 10.1038/s41559-017-0259-7 [DOI] [PubMed] [Google Scholar]
- 81. Delgado‐Baquerizo, Manuel , Reich Peter B., Trivedi Chanda, Eldridge David J., Abades Sebastián, Alfaro Fernando D., Bastida Felipe, et al. 2020. “Multiple Elements of Soil Biodiversity Drive Ecosystem Functions Across Biomes.” Nature Ecology & Evolution 4: 210–20. 10.1038/s41559-019-1084-y [DOI] [PubMed] [Google Scholar]
- 82. Barka, Essaid Ait , Vatsa Parul, Sanchez Lisa, Gaveau‐Vaillant Nathalie, Jacquard Cedric, Klenk Hans‐Peter, Clément Christophe, et al. 2016. “Taxonomy, Physiology, and Natural Products of Actinobacteria.” Microbiology and Molecular Biology Reviews 80: 1–43. 10.1128/MMBR.00019-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83. Wu, Linwei , Yang Yunfeng, Chen Si, Jason Shi Zhou, Zhao Mengxin, Zhu Zhenwei, and Yang Sihang, et al. 2017. “Microbial Functional Trait of rRNA Operon Copy Numbers Increases with Organic Levels in Anaerobic Digesters.” The ISME Journal 11: 2874–8. 10.1038/ismej.2017.135 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84. Barberán, Albert , Fernández‐Guerra Antoni, Bohannan Brendan J. M., and Casamayor Emilio O.. 2012. “Exploration of Community Traits as Ecological Markers in Microbial Metagenomes.” Molecular Ecology 21: 1909–17. 10.1111/j.1365-294X.2011.05383.x [DOI] [PubMed] [Google Scholar]
- 85. Odum, Eugene P. 1969. “The Strategy of Ecosystem Development.” Science 164: 262–70. 10.1126/science.164.3877.262 [DOI] [PubMed] [Google Scholar]
- 86. Sinsabaugh, Robert L. , and Jennifer J. Follstad Shah. 2012. “Ecoenzyme Stoichiometry and Ecological Theory.” Annual Review of Ecology, Evolution, and Systematics 43: 313–43. 10.1146/annurev-ecolsys-071112-124414 [DOI] [Google Scholar]
- 87. Cenini, Valeria L. , Fornara Dario A., McMullan Geoffrey, Ternan Nigel, Carolan Rachael, Crawley Michael J., Clément Jean‐Christophe, et al. 2016. “Linkages Between Extracellular Enzyme Activities and the Carbon and Nitrogen Content of Grassland Soils.” Soil Biology and Biochemistry 96: 198–206. 10.1016/j.soilbio.2016.02.015 [DOI] [Google Scholar]
- 88. Luo, Ling , Meng Han, and Gu Jidong. 2017. “Microbial Extracellular Enzymes in Biogeochemical Cycling of Ecosystems.” Journal of Environmental Management 197: 539–49. 10.1016/j.jenvman.2017.04.023 [DOI] [PubMed] [Google Scholar]
- 89. Fujita, Kazuki , Miyabara Yuichi, and Kunito Takashi. 2019. “Microbial Biomass and Ecoenzyme Stoichiometries Vary in Response to Nutrient Availability in an Arable Soil.” European Journal of Soil Biology 91: 1–8. 10.1016/j.ejsobi.2018.12.005 [DOI] [Google Scholar]
- 90. Mitchell, Ruth J. , Hester Alison J., Campbell Colin D., Chapman Stephen J., Cameron Clare M., Hewison Richard L., and Potts Jackie M.. 2010. “Is Vegetation Composition or Soil Chemistry the Best Predictor of the Soil Microbial Community.” Plant and Soil 333: 417–30. 10.1007/s11104-010-0357-7 [DOI] [Google Scholar]
- 91. Peay, Kabir G. , Baraloto Christopher, and Fine Paul V. A.. 2013. “Strong Coupling of Plant and Fungal Community Structure Across Western Amazonian Rainforests.” The ISME Journal 7: 1852–61. 10.1038/ismej.2013.66 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92. Bell, Colin , Carrillo Yolima, Boot Claudia M., Rocca Jennifer D., Pendall Elise, and Wallenstein Matthew D.. 2014. “Rhizosphere Stoichiometry: Are C:N:P Ratios of Plants, Soils, and Enzymes Conserved at the Plant Species‐Level? New Phytologist 201: 505–17. 10.1111/nph.12531 [DOI] [PubMed] [Google Scholar]
- 93. Meyer, Kyle M. , Memiaghe Hervé, Korte Lisa, Kenfack David, Alonso Alfonso, and Bohannan Brendan J. M.. 2018. “Why Do Microorganisms Exhibit Weak Biogeographic Patterns?” The ISME Journal 12: 1404. 10.1038/s41396-018-0103-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94. Van der Putten, Wim H. , Louise E. M. Vet, Jeffrey A. Harvey, and Wäckers Felix L.. 2001. “Linking Above‐ and Belowground Multitrophic Interactions of Plants, Herbivores, Pathogens, and Their Antagonists.” Trends in Ecology & Evolution 16: 547–54. 10.1016/S0169-5347(01)02265-0 [DOI] [Google Scholar]
- 95. Wardle, David A. , Bardgett Richard D., Klironomos John N., Setälä Heikki, van der Putten Wim H., and Wall Diana H.. 2004. “Ecological Linkages Between Aboveground and Belowground Biota.” Science 304: 1629–33. 10.1126/science.1094875 [DOI] [PubMed] [Google Scholar]
- 96. Sinsabaugh, Robert L. 2010. “Phenol Oxidase, Peroxidase and Organic Matter Dynamics of Soil.” Soil Biology and Biochemistry 42: 391–404. 10.1016/j.soilbio.2009.10.014 [DOI] [Google Scholar]
- 97. Zheng, Haifeng , Liu Yang, Chen Yamei, Zhang Jian, Li Hongjie, Wang Lifeng, and Chen Qianmei. 2020. “Short‐Term Warming Shifts Microbial Nutrient Limitation without Changing the Bacterial Community Structure in an Alpine Timberline of the Eastern Tibetan Plateau.” Geoderma 360: 113985. 10.1016/j.geoderma.2019.113985 [DOI] [Google Scholar]
- 98. Castaño, Carles , Lindahl Björn D., Alday Josu G., Hagenbo Andreas, Martínez de Aragón Juan, Parladé Javier, Pera Joan, and Bonet José Antonio. 2018. “Soil Microclimate Changes Affect Soil Fungal Communities in a Mediterranean Pine Forest.” New Phytologist 220: 1211–21. 10.1111/nph.15205 [DOI] [PubMed] [Google Scholar]
- 99. Liu, Qianyuan , Xu Xingliang, Wang Huimin, Blagodatskaya Evgenia, and Kuzyakov Yakov. 2019. “Dominant Extracellular Enzymes in Priming of SOM Decomposition Depend on Temperature.” Geoderma 343: 187–95. 10.1016/j.geoderma.2019.02.006 [DOI] [Google Scholar]
- 100. Kuss, H. M . 1992. “Applications of Microwave Digestion Technique for Elemental Analyses.” Fresenius' Journal of Analytical Chemistry 343: 788–93. 10.1007/BF00633568 [DOI] [Google Scholar]
- 101. Pansu, Marc , and Gautheyrou Jacques. 2006. Handbook of Soil Analysis: Mineralogical, Organic and Inorganic Methods, 993. Berlin: Springer. ISBN 3‐540‐31210‐2. [Google Scholar]
- 102. Ellert, B. H. , Janzen H. H., VandenBygaart Bert, and Bremer Eric. 2008. “Measuring Change in Soil Organic Carbon Storage.” Soil Sampling and Methods of Analysis 5: 25–38. 10.1201/9781420005271.ch3 [DOI] [Google Scholar]
- 103. Saiya‐Cork, K. R. , Sinsabaugh R. L., and Zak D. R.. 2002. “The Effects of Long Term Nitrogen Deposition on Extracellular Enzyme Activity in an Acer saccharum Forest Soil.” Soil Biology and Biochemistry 34: 1309–15. 10.1016/S0038-0717(02)00074-3 [DOI] [Google Scholar]
- 104. Delmont, Tom O. , Prestat Emmanuel, Keegan Kevin P., Faubladier Michael, Robe Patrick, Clark Ian M., Pelletier Eric, et al. 2012. “Structure, Fluctuation and Magnitude of a Natural Grassland Soil Metagenome.” The ISME Journal 6: 1677–87. 10.1038/ismej.2011.197 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105. Pell, Jason , Hintze Arend, Canino‐Koning Rosangela, Howe Adina, Tiedje James M., and Titus Brown C.. 2012. “Scaling Metagenome Sequence Assembly with Probabilistic De Bruijn Graphs.” Proceedings of the National Academy of Sciences 109: 13272–7. 10.1073/pnas.1121464109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 106. Krause, Sascha , Le Roux Xavier, Niklaus Pascal A., Van Bodegom Peter M., Lennon Jay T., Bertilsson Stefan, Grossart Hans‐Peter, Philippot Laurent, and Bodelier Paul L. E.. 2014. “Trait‐Based Approaches for Understanding Microbial Biodiversity and Ecosystem Functioning.” Frontiers in Microbiology 5: 251. 10.3389/fmicb.2014.00251 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107. Ravanbakhsh, Mohammadhossein , Kowalchuk George A., and Jousset Alexandre. 2019. “Root‐Associated Microorganisms Reprogram Plant Life History Along the Growth–Stress Resistance Tradeoff.” The ISME Journal 13: 3093–101. 10.1038/s41396-019-0501-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 108. Morrissey, Ember M. , Mau Rebecca L., Hayer Michaela, Liu Xiao‐Jun Allen, Schwartz Egbert, Dijkstra Paul, Koch Benjamin J., et al. 2019. “Evolutionary History Constrains Microbial Traits Across Environmental Variation.” Nature Ecology & Evolution 3: 1064–9. 10.1038/s41559-019-0918-y [DOI] [PubMed] [Google Scholar]
- 109. Mason‐Jones, Kyle , Robinson Serina L., Veen G. F., Manzoni Stefano, and van der Putten Wim H.. 2021. “Microbial Storage and Its Implications for Soil Ecology.” The ISME Journal 16: 1–13. 10.1038/s41396-021-01110-w [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supporting information.
Supporting information.
Data Availability Statement
All the data needed to evaluate the conclusions in the paper are presented in the paper and/or the supplementary materials. The 16S and ITS sequences were submitted to the SRA of the NCBI under accession numbers PRJNA600081 and PRJNA600087. The data and scripts used are saved in GitHub https://github.com/yangyangnature/Soil-microbial-life-history-strategies-in-restored-grasslands. Supplementary materials (figures, tables, scripts, graphical abstract, slides, videos, Chinese translated version and updated materials) may be found in the online DOI or iMeta Science http://www.imeta.science/.
