Abstract
Microplastics biological toxicity, environmental persistence and biological chemicals have been paid widespread attention. Microplastics exposed to chicken spleen injury of the specific mechanism is unclear. Thus, we randomly assigned chickens to 4 groups: C (normal diet), L-MPs (1 mg/L), M-MPs (10 mg/L), and H-MPs (100 mg/L), and assessed spleen damage after 42 d of exposure. Morphologically, the boundary between the red and white pulp of the spleen was blurred, along with the expansion of the white pulp. It was further speculated that microplastics induced mitochondrial dynamic homeostasis (Drp1 upgraded, Mfn1, Mfn2, and OPA1 reduced), and provoked the mitochondrial apoptotic pathway (Bcl-2/Bax decreased, cytc, caspase3, and caspase9 raised), resulting in redox imbalance and lipid peroxide accumulation (MDA increased, CAT, GSH, and T-AOC plummeted), and further stimulated ferroptosis (FTH1, GPX4, and SLC7A11 decreased). Here we explored the impact of polystyrene microplastics on the spleen, as well as the programmed death (apoptosis and ferroptosis) involved, and the regulative role of mitochondria in this process. This could be of significant importance in bridging the gap in laboratory research on microplastics-induced spleen injury in chicken.
Key words: polystyrene microplastics, mitochondria, apoptosis, ferroptosis, spleen
GRAPHICAL ABSTRACT

INTRODUCTION
Plastic brings great convenience to human life, followed by immeasurable pollution (Liu et al., 2023b; Wu et al., 2023). Tiny sheets of plastic between 100 nm and 5 mm in diameter are commonly defined as microplastics (MP) (Song et al., 2023). MPs pollution mainly comes from secondary release after fragmentation and degradation of daily plastic products, chemical products, and medical products such as masks (Hettiarachchi and Meegoda 2023; Kaur et al., 2023; Turner and Filella 2023). Some studies have pointed out the toxicity of polystyrene microplastics (PS-MP) to aquatic animals, such as the damage of 50 μm to the nervous system of goldfish larvae (Yang et al., 2020), and the metabolic disorder of liver in monopterus albus caused by 0.1 μm PS-MPs (Zhu et al., 2023). In mammals, mice neuroinflammation and parkinsonian lesions occurred after MPs exposure (Yang et al., 2019; Lee et al., 2022), and the 5 μm size demonstrates disruption of the rat intestinal barrier, further attracting digestive disorders (Huang et al., 2023b). A total of 1 to 12 μm MPs particles can directly damage the wound surface or pass through the blood barrier of the body to reach the organs (Wu et al., 2022; Shi et al., 2023b). MPs negatively affect the cardiovascular system of chickens (Zhang et al., 2022b), and MPs interfere with the proper functioning of the liver by disrupting the digestive metabolism of the chicken intestine (Yin et al., 2023), and these toxicological effects have been frequently reported in recent years. Nowadays, reports on the negative effects of MPs on the biology are gradually increasing (Khan et al., 2023), and people's attention to the harm of MPs is increasing by degrees.
The spleen is an important secondary lymphoid organ of chicken, which is involved in humoral and cellular immunity (He et al., 2023; Shi et al., 2023a; Vali et al., 2023). As the bursa degenerates after sexual maturity, the assumed character of the spleen in chicken should not be underestimated. B cells in the bursa migrate to other tissues, such as blood, spleen, thymus, and bone marrow, among which spleen and blood are the main colonization sites of B cells after migration (Paramithiotis and Ratcliffe 1993; Chen et al., 2020). Therefore, the spleen can often assess the degree to which the body is affected by the toxicity of external substances (environmental pollution, bacterial toxins, and virus attacks). MPs were able to influence lymphocyte subsets in the spleen of maternal and offspring mice (Tang et al., 2022). Splenic toxicity of microplastics had also been reported in oryzias latipes (Zhu et al., 2020) and carassius (Wei et al., 2023), which data was absent on spleen in chicken. The specific mechanism of injury in it was worth exploring.
As dynamic biophysical systems, mitochondria play a decisive role in regulating energy metabolism and controlling cell survival (Chen et al., 2023; Hao et al., 2023). Mitochondrial damage is one of the common mechanisms under MPs exposure (Liu et al., 2022b; Zhang et al., 2022b) in which MPs accumulate, breaking the electronic respiratory chain and further bringing mitochondrial membrane damage (Das 2023). Under external stimuli, the cell death signal is transmitted to mitochondria, B-cell lymphoma-2 (Bcl-2) family mediates the opening of membrane permeability transition pore and the efflux of cytochrome c (cytc), which initiates the mitochondrial apoptosis pathway (Martinou and Youle 2011; Wang et al., 2021). Ferroptosis is an iron dependence of programmed cell death, in which mitochondria have been found to play a crucial part (Dong et al., 2023; Li et al., 2023c). Mitochondria participate in the regulation of the body's redox equilibrium. Oxidation-reduction imbalance and lipid oxidation accumulation ensue which are the core of ferroptosis (Li et al., 2024a; Li et al., 2024b). Therefore, the role played by mitochondria in ferroptosis and apoptosis deserves attention.
Although the severity of MPs pollution has received extensive attention, studies on chicken spleen only paid little attention. The key of the correlation between them in PS-MPs induced spleen injury remains to be investigated. This exploration focused more on the correlation of mitochondria between PS-MPs induced splenocyte apoptosis and ferroptosis. We aimed to probe the impact of MPs exposure on spleen and the specific mechanism by constructing the exposure model of chicken PS-MPs, and to provide some views on the content of chicken spleen injury under MPs exposure.
MATERIALS AND METHODS
Animal Model Construction
Experimental PS-MPs with a diameter of 5 μm was purchased from Tesulang Chemical Company (China), and PS-MPs were exposed by water, and a homogeneous suspension was prepared for feeding using an ultrasonic machine, and the residual liquid of the tank was stirred every 2 h after addition to the tank to ensure that microplastic precipitation was minimized. A total of 60 one-day-old Ross 308 broilers (males: females = 1:1) purchased from Harbin Weiwei Co., LTD, were randomly divided by 4 experimental groups: control group C, L-MPs (PS-MPs 1 mg/L), M-MPs (PS-MPs 10 mg/L), and H-MPs (PS-MPs 100 mg/L), with 15 chickens in each group. One mg/L MPs was considered an ambient concentration (Das et al., 2023). The rearing conditions of 1-day-old chicks were maintained at 33°C, 65% humidity, and 16h sunshine to acclimate to the new environment. Subsequently, the temperature was decreased by 1°C every 3 d, and the humidity was decreased by 5% every week, finally maintained at 22°C, 55% humidity, and 16h sunshine (Li et al., 2023b). Chickens were exposed continuously for 42 d. The sinks were washed daily to reduce residue. Afterwards we euthanized the chickens and separated the spleen for subsequent experiments. This work was approved by the Institutional Animal Care and Use Committee of Northeast Forestry University (Approval No. UT-31, June 20, 2014).
Histopathological Observation
Fresh spleen tissues using paraformaldehyde fixed, embedded in paraffin, and cut the organization block into thin slices of 5 μm, and then by xylene elution paraffin, using ethanol for hydration. Fixed the slices on the glass slide and stained with hematoxylin and eosin (H&E) (Qing et al., 2022). Finally, we observed the pathological damage of the spleen using an optical microscope (Nikon DS-F12, Japan).
Transmission Electron Microscopy Observation
Prepared spleen into 1mm³ slices and immediately fixed with 2.5% glutaraldehyde for 2h, 1% osmic acid for 2h, gradient dehydration with 50 to 100% ethanol, dehydration with acetone twice, and finally stained with uranyl acetate and led citrate for observation using transmission electron microscopy (JEM-1200EX, Japan).
Biochemical Analysis
We followed the instructions of catalase (CAT) (Nanjing Jiancheng, China), trace reduced glutathione (GSH) (Nanjing Jiancheng, China), total antioxidant capacity (T-AOC) (Wanlei bio, China), malondialdehyde (MDA) (Wanlei bio, China), and tissue iron (Nanjing Jiancheng, China) kits to detect the levels of CAT, GSH, T-AOC, MDA, and tissue iron in spleen.
Real-Time Quantitative Polymerase Chain Reaction
Spleen tissues were weighed and total RNA was extracted using Triazole method. cDNA was obtained using a reverse transcription kit (Vazyme Biotechnology, China). The levels of mRNA expression were measured using the HiScript II Q RT SuperMix kit (Vazyme Biotechnology, China) via an ABI-7500 (Applied Biosystems, USA) instrument. β-actin was used as the reference gene, and calculated according to the 2−ΔΔCt method (Lei et al., 2023). The primer sequences are shown in Table 1.
Table 1.
The primers involved in this study.
| Gene | Forward (5′–3′) | Reverse (5′–3′) | Serial number |
|---|---|---|---|
| β-actin | GCCCTCTTCCAGCCATCTTT | AGTGTACAGGTAGCCCCTCC | NM_205518.2 |
| Bax | TATGGGACACCAGGAGGGTA | CGTAGACCTTGCGGATAAAGC | XM_040676625.2 |
| Bcl-2 | ATCGTCGCCTTCTTCGAGTT | ATCCCATCCTCCGTTGTTCT | NM_205339.3 |
| caspase9 | CCGAAGGAGCAAGCACG | AGGTTGGACTGGGATGGAC | XM_046931415.1 |
| caspase3 | ATTCTACTGCTCCAGGCTACTACTCC | GTTCCTTCAGCATCCTACACAGAGAC | XM_046915477.1 |
| Fas | TGTGTGCAGAATGCAAGTCAAG | GTGGTGGGTCAGGTCAACAT | XM_046919845.1 |
| caspase8 | CCTCTTGGGCATGGCTA | TGCTGCTCACCTCTTGATT | NM_204592.4 |
| cytc | CACTGTAAGCGGAGCGGC | TGGAAGATGCCAAGACCCAC | NM_001079478.2 |
| GPX4 | AGAATGTGCGCTCAGGCG | TCCACTTGATGGCATTCCCC | NM_204220.3 |
| FTH1 | TGCAGGACATCAAGAAACCGGA | CTGCTCATCCAGGTAGTGAGTC | NM_205086.2 |
| SLC7A11 | GGGCTTTGAAACACCCAGGA | CTGACACAGGCCAAAACGTG | XM_040670527.2 |
Western Blot
The organization of the extracted total protein by SDS-PAGE gel electrophoresis separation was transferred to the PVDF membranes. At room temperature, blocked the membrane, then used the primary antibody to incubate overnight and incubated with the corresponding HRP conjugated secondary antibody, 2h duration. Finally, images were acquired using Image Quant LAS4000 (General Electric, USA). The antibody information is shown in Table 2.
Table 2.
The antibodies used in this study.
| Antibody name | Dilution ratio | Resource | Article number |
|---|---|---|---|
| β-actin | 1: 2,000 | Abclonal,USA | AC006 |
| Mfn1 | 1:500 | Abclonal, USA | A21293 |
| Mfn2 | 1:500 | Abclonal, USA | A19678 |
| OPA1 | 1:500 | Abclonal, USA | A9833 |
| Drp1 | 1:500 | WanLei Biotechnology, China | WL03028 |
| Bax | 1: 500 | WanLei Biotechnology, China | WL01637 |
| Bcl-2 | 1: 500 | WanLei Biotechnology, China | WL01556 |
| caspase-9 | 1: 500 | WanLei Biotechnology, China | WL03421 |
| caspase-3 | 1: 500 | WanLei Biotechnology, China | WL02117 |
| Fas | 1:1,000 | Abclonal, USA | A0233 |
| caspase8 | 1: 500 | WanLei Biotechnology, China | WL03426 |
| cytc | 1: 1,000 | Boster Biotechnology, China | A03529 |
| GPX4 | 1:500 | Boster Biotechnology, China | A02059-1 |
| FTH1 | 1:500 | Boster Biotechnology, China | BM4487 |
| SLC7A11 | 1:500 | Boster Biotechnology, China | BM5318 |
Statistics of Microplastics Related Literature
Entered “TS= (Microplastics* or Microplastic)” into Web of Science to get the research status of MPs. Entered “TS=((Microplastics* or Microplastic) and (bird or birds or Chicken or peacock or quail or raptor or crane or heron or duck or goose or dove or ostrich))” to obtain the research status of MPs. Data from 2013 to 2022 were extracted and ranked, where the bars represented the number of studies, the broken line values were the percentage of the number of studies the total number of studies in the corresponding year, with MPs in purple and MPs-birds in blue. The different species were compared by typing “TS= ((Microplastics* or Microplastic) and X)”, where X is the corresponding species name.
Gene Enrichment and Protein-Protein Interaction Analysis
In order to systematically explore the interrelationships between genes and proteins involved in this experiment, we used the online website Metascape (http://metascape.org) and STRING (http://string-db.org/) to conduct gene enrichment analysis and PPI network mapping on the collected target genes and proteins. Bar graph colored by p-values for gene enrichment analysis.
Statistics Analysis
The experimental data were from at least 3 separate experiments. The experimental data were analyzed for significance by one-way ANOVA analysis using IBM SPSS Statistics 20 software and compared with the control group. Data results were expressed as mean ± SD. P < 0.05 indicates a statistically significant difference. (*, **, *** respectively represent P < 0.05, P < 0.01, and P < 0.001).
RESULTS
Investigation of MPs Research Status
We analyzed the MPs in all species research, attention to 18,240 articles were about MPs and only 3,446 articles were about MPs-birds. Although more and more studies had been conducted on MPs (Figure 1A), by analyzing the research status among species, we found that compared with other species, there is still a large gap in the research on chicken (Figure 1B).
Figure 1.
Investigation of MPs research status. (A) Research status of MPs and MPs-birds from 2013 to 2022. Bars showed the number of studies, the broken line values were the percentage of the number of studies the total number of studies in the corresponding year, with MPs in purple and MPs-birds in blue. (B) Bar graph of the status of research on microplastics in different species.
MPs Promoted the Pathological Changes of Chicken Spleen
In the control group, the red and white pulp interface of the spleen was clear, the morphology was complete, the arrangement was close, and the structure of splenic nodules (yellow arrow) is clear (Figure 2A). After MPs treatment, no apparent damage was found in the L-MPs (Figure 2B). The spleen of the M-MPs and H-MPs showed abnormalities, the boundary between the red and white pulp was blurred (white arrow), and the number of splenic nodules were reduced (yellow arrow), in the meantime the white pulp was constantly expanded (Figures 2C and 2D). It was suggested that the exposure of MPs caused pathological damage to the spleen.
Figure 2.
MPs led to mitochondrial damage. (A) Control group, clear red pulp and white pulp boundary, complete tissue structure. (B) L-MPS, exposed to 1mg/L, no obvious abnormality. (C) M-MPs, exposed to 10mg/L, the boundary between red and white pulp (white arrow) was blurred. (D) H-MPs, exposed to 100mg/L, the boundary between red and white pulp was confused (white arrow), and the number of splenic nodules were reduced (yellow arrow), in the meantime the white pulp was constantly expanded (H&E staining; magnification, 100×).
MPs Led to Mitochondrial Damage
By observing the damage of the spleen's ultrastructure through transmission electron microscopy, the typical symptoms of ferroptosis included increased mitochondrial membrane density and ridge rupture were found (Liang et al., 2023). With the increase of MPs exposure concentration, the mitochondrial damage became more pronounced. Increased mitochondrial membrane density and the cristae were broken in the M-MPs and even disappeared in the H-MPs (Figure 3A). The red arrows were diseased mitochondria. We measured the levels of proteins involved in mitochondrial dynamics. The levels of mitochondrial fusion and fission proteins corresponding to the exposed group showed abnormality: the fission protein dynamin-related protein 1 (Drp1) showed an increasing trend, and the fusion proteins optic atrophy 1 (OPA1), mitofusin 1 (Mfn1), and mitofusin 2 (Mfn2) showed a decreasing trend (Figure 3B and 3C). These manifestations may indicate that MPs elicited damage to the spleen mitochondrial structure and dynamic disorder.
Figure 3.
MPs led to mitochondrial damage. (A) MPs exposure spleen ultrastructure observation, mitochondrial membrane density was expanded, the red arrows indicate the mitochondria damage including mitochondrial crest broken and disappeared. (B) Western blot of mitochondria-associated proteins. (C) Quantitative analysis of Mfn1, Mfn2, OPA1, and Drp1 protein expression. Data were expressed as mean ± SD, n = 3. *, **, ***, denotes: p < 0.05, 0.01 and 0.001, respectively.
MPs Caused Oxidation-Reduction Imbalance in Chicken Spleen
The oxidation regulation indicators CAT, GSH, MDA, and T-AOC were detected (Figures 4A and 4B). In the M-MPs and H-MPs, anti-oxidation index CAT activities, GSH, and T-AOC content decreased markedly (p < 0.05–0.001), MDA content significantly enhanced (p < 0.05–0.001). The results indicated that the spleen tissue was exposed to the oxidation-reduction imbalance under the MPs, and the body had oxidative stress.
Figure 4.
MPs caused oxidative stress in the spleen. (A and B) C, L-MPs, M-MPs, H-MPs corresponding oxidative stress indicators CAT, GSH, MDA, and T-AOC detection. (C) Determination of tissue iron content. Data were expressed as mean ± SD, n = 3. *, **, ***, denotes: p < 0.05, 0.01, and 0.001, respectively.
MPs Provoked Apoptosis in Chicken Spleen
After exposure to MPs, apoptosis factors in spleen tissue changed significantly. The protein expression levels of Bcl2-associated X (Bax), cysteinyl aspartate specific proteinase 9 (caspase 9), caspase 3, and cytc in the mitochondrial pathway of apoptosis in the MPs exposure groups were sensibly increased (p < 0.001), and Bcl-2 was significantly decreased (p < 0.001). Death receptor pathway factor: factor related apoptosis (Fas), and caspase 8 were significantly augmented (p < 0.01–0.001) (Figures 5A and 5B). In addition, the mRNA levels of Bax, Bcl-2, caspase 9, caspase 3, cytc, Fas, and caspase 8 were measured (Figure 5C). The results suggested that MPs exposure triggered the spleen mitochondrial pathway and death receptor pathway of apoptosis, which may further cause spleen injury.
Figure 5.
MPs induced ferroptosis in spleen. (A) Western Blot results in ferroptosis-related proteins. (B) Quantitative analysis of GPX4, FTH1, and SLC7A11 protein expression. (C) Ferroptosis-related factors of mRNA expression changes. Data were expressed as mean ± SD, n = 3. *, **, ***, denotes: p < 0.05, 0.01, and 0.001, respectively.
MPs Induced Ferroptosis in Chicken Spleen
To explore the MPs exposed the exact mechanism of spleen injury, ferroptosis-related factors were tested. MPs exposure significantly inhibited the protein expression levels of ferroptosis-related factors glutathione peroxidase 4 (GPX4), solute carrier family 7 member 11 (SLC7A11), and ferritin heavy chain 1 (FTH1) (p < 0.001), and the mRNA levels were basically consistent with the protein (Figure 6). Iron levels in tissues was also detected, and we found that the L-MPs group did not increase significantly after exposure to MPs, while the M-MPs and H-MPs groups increased significantly (P < 0.001) (Figure 3B). The results displayed that the exposure of MPs would induce ferroptosis in the spleen.
Figure 6.
MPs provoked apoptosis in spleen. (A) Western Blot of proteins related to the mitochondrial pathway and death receptor pathway. (B) Quantitative analysis of protein expression. (C) Changes in mRNA expression of factors involved in the mitochondrial pathway and death receptor pathway. Data were expressed as mean ± SD, n = 3. *, **, ***, denotes: p < 0.05, 0.01, and 0.001, respectively.
Gene Enrichment and Protein Interaction Network Analysis
By establishing the protein-protein interaction network at the protein level, we discovered that the proteins related to apoptosis, mitochondrial damage and ferroptosis formed a dense network (Figure 7A). We used Metascape to perform enrichment analysis of the genes involved in this experiment, and the top 7 were screened, including apoptosis, mitochondrial fusion, and ferroptosis, which coincided with our experimental investigation (Figure 7B).
Figure 7.
Gene enrichment and protein interaction network analysis. (A) Interaction network of apoptosis, mitochondrial damage, and ferroptosis proteins. Among them, DENR, CASP3, CASP9, and CASP8 represent Drp1, caspase 3, caspase 9, and caspase 8 respectively. (B) Differential gene enrichment analysis.
DISCUSSION
At present, MPs pollution has become a focus topic. The research related to MPs began to rise rapidly from 2019, and there was still an upward trend. From the perspective of time development, people's research on MPs in birds has been steadily increasing. But the lack of laboratory data on the damage caused by MPs exposure should not be overlooked (Yin et al., 2022; Li et al., 2023a). Chickens eat plastic products by mistake, which are further decomposed in the gizzard and then absorbed by the spleen (Rivers-Auty et al., 2023). As one of the largest meat consumption, MPs for its wide variety of risk, involving food and environment. Our focus was on chicken, and PS-MPs exposure models were constructed to examine the mechanism of spleen injury caused by concrete. For the first time, it was demonstrated that MPs cause chicken spleen injury by triggering mitochondrial structural and functional collapse, which triggers mitochondrial pathway apoptosis and subsequent redox imbalance and iron death.
Mitochondrial damage attracted by MPs exposure has been frequently reported (Zhang et al., 2022a; Gu et al., 2023). MPs significantly increased oxidation levels in oocytes and embryos, and produced mitochondrial dysfunction and apoptosis (Zhang et al., 2023). Based on our experiment, MPs treatment gave rise mitochondrial structural damage, and accompanied by the disturbance of dynamics (Figure 2), which was consistent with other MPs studies (Elsheikh et al., 2023). Apoptosis is a kind of programmed cell death, which can be divided into endogenous and exogenous (Ji et al., 2019). The endogenous includes the mitochondrial pathway and endoplasmic reticulum pathway, and the exogenous consists of death receptor pathway. As a member of the family of Bcl-2, pro-apoptotic proteins Bax generally exists in the cytoplasm. When the apoptotic signal is stimulated, it will locate on the surface of mitochondria, causing the mitochondrial permeability transition pore (mPTP) to open, and increasing membrane permeability. With the release of cytc, caspase 9 and caspase3 and other apoptotic factors were released to cause mitochondrial pathway of apoptosis (Xu et al., 2023). In this research, the pro-apoptotic factor Bax was markedly expanded, while the anti-apoptotic factor Bcl-2 was memorably declined after MPs exposure (Figure 4). The release of cytc, and the activation of caspase family confirmed that MPs exposure activated apoptosis in spleen via the mitochondrial pathway.
Numerous studies have demonstrated that mitochondrial dynamics proteins (Mfn1, Mfn2, Drp1, and OPA1) are closely linked to apoptosis (Liu et al., 2023; Wang et al., 2023; Sun et al., 2024). When stimulated by death signals, Bax/Bak forms oligomers (Bax oligomerizes) to form pores in the outer mitochondrial membrane, releasing cytc and activating apoptosis. In rats, Mfn1 overexpression inhibited Bax translocation, oligomerization, and subsequent activation of apoptosis (Ryu et al., 2012; Campbell et al., 2019). After Mfn1/2 and OPA1 depletion (Wang et al., 2023), mitochondria were damaged and showed Bax activation and subsequent apoptosis, while cells with Drp1 silencing showed resistance to Bax activation. In this research, Mfn1, Mfn2, and OPA1 in M-MPs and H-MPs groups were significantly decreased, while Drp1 and Bax were visibly increased (Figures 2A and 4A). They speculate that MPs exposure elicited spleen cell apoptosis by inducing mitochondrial dynamics disorder, it may be due to the aberrant expression of Mfn1/2, OPA1, and Drp1, which disturbed Bax oligomerization and the localization of Bax in mitochondria, resulting in the activation of apoptosis in spleen cells.
Apoptosis in the progression of the immune system, and in the process of immune response plays a decisive role (Sobrido-Cameán and Barreiro-Iglesias 2018; Huang et al., 2023a). It affects the development of lymphocytes, participates in the exclusion of excessive immunocyte in the immune response, and also regulates the clearance of target cells by cytotoxic T lymphocyte (CTL) and natural killer cell (NK). CTL can induce apoptosis of target cells containing Fas on the surface by releasing factor related apoptosis ligand (FasL) to achieve the effect of eliminating target cells. The cell surface receptor Fas binds to the ligand FasL, forming a death receptor domain (DD) on the cytoplasmic side of Fas. It recruits procaspase 8 through the adaptor molecule Fas-associating protein with a novel death domain (FADD) to create a death inducing signaling complex (DISC), hydrolysis activates caspase 8, which in turn activates downstream caspase 3 to execute apoptosis (Huang et al., 2023a). The spleen is a typical immune organ. We detected the levels of Fas and caspase 8 protein in spleen cells and found that both proteins were significantly increased in M-MPs and H-MPs groups (Figures 4A and 4B). It indicated that in the spleen, MPs exposure may trigger the targeting effect of killer T cells to induce apoptosis through the death receptor pathway. During the study, the absence of dose-dependent spleen injury could be attributed to self-regulation. At low concentrations, the body resisted the damage of MPs by self-regulation, this was within the affordable range. Once this threshold was exceeded, the consequences aroused by the outside world cannot be reversed, which may be the reason why the high concentration damage is significant.
When mitochondria are damaged, redox imbalance and a large amount of ROS burst will follow. This work found that after MPs exposure, spleen redox imbalance, manifested by a significant decrease in antioxidant enzyme CAT activity, GSH and T-AOC content, likewise a significant increase in MDA, and the product of lipid peroxidation (Figure 3A). High levels of free radicals will attack intracellular lipids and proteins, damage their structure and function, then cause cell damage (Gong et al., 2022; Liu et al., 2022a; Liang et al., 2023). Physiologically, lipid peroxides can be removed, and cells take extracellular cystine into the cell to synthesize GSH through the cystine/glutamate antiporter system (System Xc-), which is consist of the light chain subunit SLC7A11 and the heavy chain subunit SLC3A2 (Pan et al., 2023; Zhou et al., 2023). Under the catalysis of GPX4, lipid peroxides are reduced to phospholipid molecules, thereby preventing excessive accumulation of lipid peroxides. FTH1, as an important protein for storing and releasing iron, can protect cells from the toxic effects of free iron ions (Qiu et al., 2023; Tang et al., 2023). Undoubtedly, the expression of SLC7A11, GSH, and GPX4 proteins could slow down the process of ferroptosis, and the expression of these factors were inhibited in our study (Figures 3A and 5). We inferred that mitochondrial damage acted as a trigger to advance redox imbalance in the body, accelerated the process of lipid peroxidation, and triggered ferroptosis under MPs exposure.
CONCLUSIONS
In summary, our study showed that MPs exposure can damage the mitochondrial structure, give rise to the disorder of mitochondrial function, trigger apoptosis of the mitochondrial pathway, and stimulate redox imbalance-induced ferroptosis, thus inducing damage to spleen tissue. This work centered on mitochondrial damage to explore the specific mechanism of MPs’ damage to the spleen of chicken, providing a supplement to the laboratory toxicology data of MPs-chicken.
ACKNOWLEDGMENTS
This work was supported by the Heilongjiang Provincial Postdoctoral Science Foundation (LBH-Z23057), and the National Natural Science Foundation of China (32373075).
DISCLOSURES
The authors declare no conflicts of interest.
REFERENCES
- Campbell G.R., To R.K., Spector S.A. TREM-1 protects HIV-1-infected macrophages from apoptosis through maintenance of mitochondrial function. mBio. 2019;10 doi: 10.1128/mBio.02638-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen D., Ning F., Zhang J., Tang Y., Teng X. NF-κB pathway took part in the development of apoptosis mediated by miR-15a and oxidative stress via mitochondrial pathway in ammonia-treated chicken splenic lymphocytes. Sci. Total Environ. 2020;729 doi: 10.1016/j.scitotenv.2020.139017. [DOI] [PubMed] [Google Scholar]
- Chen D., Shen F., Liu J., Tang H., Zhang K., Teng X., Yang F. The protective effect of Luteolin on chicken spleen lymphocytes from ammonia poisoning through mitochondria and balancing energy metabolism disorders. Poult. Sci. 2023;102:103093. doi: 10.1016/j.psj.2023.103093. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Das A. The emerging role of microplastics in systemic toxicity: involvement of reactive oxygen species (ROS) Sci. Total Environ. 2023;895 doi: 10.1016/j.scitotenv.2023.165076. [DOI] [PubMed] [Google Scholar]
- Das B.C., Ramanan P.A., Gorakh S.S., Pillai D., Vattiringal Jayadradhan R.K. Sub-chronic exposure of Oreochromis niloticus to environmentally relevant concentrations of smaller microplastics: accumulation and toxico-physiological responses. J Hazardous Mater. 2023;458 doi: 10.1016/j.jhazmat.2023.131916. [DOI] [PubMed] [Google Scholar]
- Dong W., Gong F., Zhao Y., Bai H., Yang R. Ferroptosis and mitochondrial dysfunction in acute central nervous system injury. Front. Cell. Neurosci. 2023;17 doi: 10.3389/fncel.2023.1228968. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Elsheikh AA., Alnasser SM., Shalaby AM., Alabiad MA., Abd-Almotaleb NA., Alorini M., Jaber FA., Khayal EE. Polystyrene microplastic particles induced hepatotoxic injury via pyroptosis, oxidative stress, and fibrotic changes in adult male albino rats; the therapeutic role of silymarin. Toxicol Mech Methods. 2023;33:512–528. doi: 10.1080/15376516.2023.2191270. [DOI] [PubMed] [Google Scholar]
- Gong Z.G., Zhao Y., Wang Z.Y., Fan R.F., Liu Z.P., Wang L. Epigenetic regulator BRD4 is involved in cadmium-induced acute kidney injury via contributing to lysosomal dysfunction, autophagy blockade and oxidative stress. J. Hazardous Mater. 2022;423 doi: 10.1016/j.jhazmat.2021.127110. (Pt A) [DOI] [PubMed] [Google Scholar]
- Gu Y., Xu D., Liu J., Chen Y., Wang J., Song Y., Sun B., Xia B. Bioaccumulation of functionalized polystyrene nanoplastics in sea cucumber Apostichopus japonicus (Selenka, 1867) and their toxic effects on oxidative stress, energy metabolism and mitochondrial pathway. Environ Pollut. 2023;319:121015. doi: 10.1016/j.envpol.2023.121015. [DOI] [PubMed] [Google Scholar]
- Hao Y., Zhao L., Zhao J.Y., Han X., Zhou X. Unveiling the potential of mitochondrial dynamics as a therapeutic strategy for acute kidney injury. Front. Cell Develop Biol. 2023;11 doi: 10.3389/fcell.2023.1244313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- He M., Wu Q., Wei J., Zhang Y., Guo H., Guo X. Research Note: Effect of Rubia cordifolia L. processed Terminalia chebula Retz polysaccharide on the histological structure and apoptosis in the spleen in immunosuppressed Chinese yellow quail. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hettiarachchi H., Meegoda J.N. Microplastic pollution prevention: the need for robust policy interventions to close the loopholes in current waste management practices. Int. J. Environ. Res. Public Health. 2023;20 doi: 10.3390/ijerph20146434. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang H., Hou J., Liao Y., Wei F., Xing B. Polyethylene microplastics impede the innate immune response by disrupting the extracellular matrix and signaling transduction. iScience. 2023;26 doi: 10.1016/j.isci.2023.107390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang Z., Weng Y., Shen Q., Zhao Y., Luo T., Xiao Y., Yang G., Jin Y. Nano- and micro-polystyrene plastics interfered the gut barrier function mediated by exosomal miRNAs in rats. Environ. Poll. (Barking, Essex : 1987) 2023;335 doi: 10.1016/j.envpol.2023.122275. [DOI] [PubMed] [Google Scholar]
- Ji Y., Shen J., Li M., Zhu X., Wang Y., Ding J., Jiang S., Chen L., Wei W. RMP/URI inhibits both intrinsic and extrinsic apoptosis through different signaling pathways. Int. J. Biol. Sci. 2019;15:2692–2706. doi: 10.7150/ijbs.36829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaur M., Ghosh D., Guleria S., Arya S.K., Puri S., Khatri M. Microplastics/nanoplastics released from facemasks as contaminants of emerging concern. Marine Poll. Bullet. 2023;191 doi: 10.1016/j.marpolbul.2023.114954. [DOI] [PubMed] [Google Scholar]
- Khan A., Jie Z., Wang J., Nepal J., Ullah N., Zhao Z.Y., Wang P.Y., Ahmad W., Khan A., Wang W., Li M.Y., Zhang W., Elsheikh M.S., Xiong Y.C. Ecological risks of microplastics contamination with green solutions and future perspectives. Sci. Total Environ. 2023;899:165688. doi: 10.1016/j.scitotenv.2023.165688. [DOI] [PubMed] [Google Scholar]
- Lee C.W., Hsu L.F., Wu I.L., Wang Y.L., Chen W.C., Liu Y.J., Yang L.T., Tan C.L., Luo Y.H., Wang C.C., Chiu H.W., Yang T.C., Lin Y.Y., Chang H.A., Chiang Y.C., Chen C.H., Lee M.H., Peng K.T., Huang C.C. Exposure to polystyrene microplastics impairs hippocampus-dependent learning and memory in mice. J. Hazardous Mater. 2022;430:128431. doi: 10.1016/j.jhazmat.2022.128431. [DOI] [PubMed] [Google Scholar]
- Lei Y., Xu T., Sun W., Wang X., Gao M., Lin H. Evodiamine alleviates DEHP-induced hepatocyte pyroptosis, necroptosis and immunosuppression in grass carp through ROS-regulated TLR4 /MyD88 / NF-κB pathway. Fish Shellfish Immunol. 2023;140 doi: 10.1016/j.fsi.2023.108995. [DOI] [PubMed] [Google Scholar]
- Li A., Wang Y., Kulyar M.F., Iqbal M., Lai R., Zhu H., Li K. Environmental microplastics exposure decreases antioxidant ability, perturbs gut microbial homeostasis and metabolism in chicken. Sci. Total Environ. 2023;856 doi: 10.1016/j.scitotenv.2022.159089. [DOI] [PubMed] [Google Scholar]
- Li H., Yu K., Hu H., et al. METTL17 coordinates ferroptosis and tumorigenesis by regulating mitochondrial translation in colorectal cancer. Redox Biol. 2024;71 doi: 10.1016/j.redox.2024.103087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li J., Yin K., Hou L., et al. Polystyrene microplastics mediate inflammatory responses in the chicken thymus by Nrf2/NF-κB pathway and trigger autophagy and apoptosis. Environ. Toxicol. Pharmacol. 2023;100 doi: 10.1016/j.etap.2023.104136. [DOI] [PubMed] [Google Scholar]
- Li X., Zhang W., Xing Z., Hu S., Zhang G., Wang T., Wang T., Fan Q., Chen G., Cheng J., Jiang X., Cai R. Targeting SIRT3 sensitizes glioblastoma to ferroptosis by promoting mitophagy and inhibiting SLC7A11. Cell Death Dis. 2024;15:168. doi: 10.1038/s41419-024-06558-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li Y., Zhou Y., Liu D., Wang Z., Qiu J., Zhang J., Chen P., Zeng G., Guo Y., Wang X., DiSanto M.E., Zhang X. Glutathione Peroxidase 3 induced mitochondria-mediated apoptosis via AMPK /ERK1/2 pathway and resisted autophagy-related ferroptosis via AMPK/mTOR pathway in hyperplastic prostate. J. Transl. Med. 2023;21:575. doi: 10.1186/s12967-023-04432-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liang Y., Xia L., Lu S., Yang S., Guo S., Shan X., Zhao P., Zhang C., Guo W., Xu M., Chen H., Lu R. A new mechanism of therapeutic effect of stachydrine on heart failure by inhibiting myocardial ferroptosis. Eur. J. Pharmacol. 2023;954:175881. doi: 10.1016/j.ejphar.2023.175881. [DOI] [PubMed] [Google Scholar]
- Liu J.B., Li Z.F., Lu L., Wang Z.Y., Wang L. Glyphosate damages blood-testis barrier via NOX1-triggered oxidative stress in rats: Long-term exposure as a potential risk for male reproductive health. Environ. Int. 2022;159 doi: 10.1016/j.envint.2021.107038. [DOI] [PubMed] [Google Scholar]
- Liu H., Lin H., Xu T., Shi X., Yao Y., Khoso P.A., Jiang Z., Xu S. New insights into brain injury in chickens induced by bisphenol A and selenium deficiency-Mitochondrial reactive oxygen species and mitophagy-apoptosis crosstalk homeostasis. Sci. Total Environ. 2023;905:166890. doi: 10.1016/j.scitotenv.2023.166890. [DOI] [PubMed] [Google Scholar]
- Liu L., Liu B., Zhang B., Ye Y., Jiang W. Polystyrene micro(nano)plastics damage the organelles of RBL-2H3 cells and promote MOAP-1 to induce apoptosis. J. Hazardous Mater. 2022;438 doi: 10.1016/j.jhazmat.2022.129550. [DOI] [PubMed] [Google Scholar]
- Liu X., Fang L., Yan X., Gardea-Torresdey J.L., Gao Y., Zhou X., Yan B. Surface functional groups and biofilm formation on microplastics: environmental implications. Sci. Total Environ. 2023;903:16658. doi: 10.1016/j.scitotenv.2023.166585. [DOI] [PubMed] [Google Scholar]
- Martinou J.- C., Youle Richard J. Mitochondria in apoptosis: Bcl-2 family members and mitochondrial dynamics. Develop. Cell. 2011;21:92–101. doi: 10.1016/j.devcel.2011.06.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pan Z., Van den Bossche J.L., Rodriguez-Aznar E., Janssen P., Lara O., Ates G., Massie A., De Paep D.L., Houbracken I., Mambretti M., Rooman I. Pancreatic acinar cell fate relies on system x(C)(-) to prevent ferroptosis during stress. Cell Death Dis. 2023;14:536. doi: 10.1038/s41419-023-06063-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Paramithiotis E., Ratcliffe M.J. Bursa-dependent subpopulations of peripheral B lymphocytes in chicken blood. Eur. J. Immunol. 1993;23:96–102. doi: 10.1002/eji.1830230116. [DOI] [PubMed] [Google Scholar]
- Qing Z., Dongliu L., Xuedie G., Khoso P.A., Xiaodan H., Shu L. MiR-144-3p targets STC1 to activate PI3K/AKT pathway to induce cell apoptosis and cell cycle arrest in selenium deficiency broilers. J. Inorganic Biochem. 2022;226 doi: 10.1016/j.jinorgbio.2021.111665. [DOI] [PubMed] [Google Scholar]
- Qiu W., Ye J., Su Y., Zhang X., Pang X., Liao J., Wang R., Zhao C., Zhang H., Hu L., Tang Z., Su R. Co-exposure to environmentally relevant concentrations of cadmium and polystyrene nanoplastics induced oxidative stress, ferroptosis and excessive mitophagy in mice kidney. Environ. Poll. (Barking, Essex : 1987) 2023;333 doi: 10.1016/j.envpol.2023.121947. [DOI] [PubMed] [Google Scholar]
- Rivers-Auty J., Bond A.L., Grant M.L., Lavers J.L. The one-two punch of plastic exposure: macro- and micro-plastics induce multi-organ damage in seabirds. J. Hazardous Mater. 2023;442 doi: 10.1016/j.jhazmat.2022.130117. [DOI] [PubMed] [Google Scholar]
- Ryu S.W., Choi K., Park J.H., Park Y.M., Kim S., Choi C. Mitofusin 1 inhibits an apoptosis-associated amino-terminal conformational change in Bax, but not its mitochondrial translocation, in a GTPase-dependent manner. Cancer Lett. 2012;323:62–68. doi: 10.1016/j.canlet.2012.03.038. [DOI] [PubMed] [Google Scholar]
- Shi J., Jiang S., Wang Q., Dong J., Zhu H., Wang P., Meng S., Zhang Z., Chang L., Wang G., Xu X., Xu P., Zhang Y. Spleen-based proteogenomics reveals that Escherichia coli infection induces activation of phagosome maturation pathway in chicken. Virulence. 2023;14 doi: 10.1080/21505594.2022.2150453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shi X., Xu T., Cui W., Qi X., Xu S. Combined negative effects of microplastics and plasticizer DEHP: the increased release of Nets delays wound healing in mice. Sci. Total Environ. 2023;862 doi: 10.1016/j.scitotenv.2022.160861. [DOI] [PubMed] [Google Scholar]
- Sobrido-Cameán D., Barreiro-Iglesias A. Role of caspase-8 and fas in cell death after spinal cord injury. Front. Mol. Neurosci. 2018;11:101. doi: 10.3389/fnmol.2018.00101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Song X., Du L., Sima L., Zou D., Qiu X. Effects of micro(nano)plastics on the reproductive system: a review. Chemosphere. 2023;336 doi: 10.1016/j.chemosphere.2023.139138. [DOI] [PubMed] [Google Scholar]
- Sun W., Xu T., Lin H., Yin Y., Xu S. BPA and low-Se exacerbate apoptosis and autophagy in the chicken bursa of Fabricius by regulating the ROS/AKT/FOXO1 pathway. Sci. Total Environ. 2024;908 doi: 10.1016/j.scitotenv.2023.168424. [DOI] [PubMed] [Google Scholar]
- Tang J., Bu W., Hu W., Zhao Z., Liu L., Luo C., Wang R., Fan S., Yu S., Wu Q., Wang X., Zhao X. Ferroptosis is involved in sex-specific small intestinal toxicity in the offspring of adult mice exposed to polystyrene nanoplastics during pregnancy. ACS nano. 2023;17:2440–2449. doi: 10.1021/acsnano.2c09729. [DOI] [PubMed] [Google Scholar]
- Tang X., Fan X., Xu T., He Y., Chi Q., Li Z., Li S. Polystyrene nanoplastics exacerbated lipopolysaccharide-induced necroptosis and inflammation via the ROS/MAPK pathway in mice spleen. Environ. Toxicol. 2022;37:2552–2565. doi: 10.1002/tox.23618. [DOI] [PubMed] [Google Scholar]
- Turner A., Filella M. Chemical characteristics of artificial plastic plants and the presence of hazardous elements from the recycling of electrical and electronic waste. Sci. Total Environ. 2023;903 doi: 10.1016/j.scitotenv.2023.166083. [DOI] [PubMed] [Google Scholar]
- Vali Y., Gumpenberger M., Konicek C., Bagheri S. Computed tomography of the spleen in chickens. Front. Vet. Sci. 2023;10 doi: 10.3389/fvets.2023.1153582. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang C., Dai X., Xing C., Zhang C., Cao H., Guo X., Liu P., Yang F., Zhuang Y., Hu G. Hexavalent-chromium-induced disruption of mitochondrial dynamics and apoptosis in the liver via the AMPK-PGC-1α pathway in ducks. Int. J. Mol. Sci. 2023;24:17241. doi: 10.3390/ijms242417241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y., Zhao H., Liu Y., Li J., Nie X., Huang P., Xing M. Environmentally relevant concentration of sulfamethoxazole-induced oxidative stress-cascaded damages in the intestine of grass carp and the therapeutic application of exogenous lycopene. Environ Pollut. 2021;274:116597. doi: 10.1016/j.envpol.2021.116597. [DOI] [PubMed] [Google Scholar]
- Wu D., Zhang M., Bao T.T., Lan H. Long-term exposure to polystyrene microplastics triggers premature testicular aging. Particle Fibre Toxicol. 2023;20:35. doi: 10.1186/s12989-023-00546-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wei W., Yang Q., Xiang D., Chen X., Wen Z., Wang X., Xu X., Peng C., Yang L., Luo M., Xu J. Combined impacts of microplastics and cadmium on the liver function, immune response, and intestinal microbiota of crucian carp (Carassius carassius) Ecotoxicol. Environ. Safety. 2023;261:115104. doi: 10.1016/j.ecoenv.2023.115104. [DOI] [PubMed] [Google Scholar]
- Wu H., Xu T., Chen T., Liu J., Xu S. Oxidative stress mediated by the TLR4/NOX2 signalling axis is involved in polystyrene microplastic-induced uterine fibrosis in mice. Sci. Total Environ. 2022;838 doi: 10.1016/j.scitotenv.2022.155825. [DOI] [PubMed] [Google Scholar]
- Xu T., Cui J., Xu R., Cao J., Guo M.Y. Microplastics induced inflammation and apoptosis via ferroptosis and the NF-κB pathway in carp. Aquatic Toxicol. (Amsterdam, Netherlands) 2023;262 doi: 10.1016/j.aquatox.2023.106659. [DOI] [PubMed] [Google Scholar]
- Yang H., Xiong H., Mi K., Xue W., Wei W., Zhang Y. Toxicity comparison of nano-sized and micron-sized microplastics to goldfish carassius auratus larvae. J. Hazardous Mater. 2020;388 doi: 10.1016/j.jhazmat.2020.122058. [DOI] [PubMed] [Google Scholar]
- Yang Y.F., Chen C.Y., Lu T.H., Liao C.M. Toxicity-based toxicokinetic/toxicodynamic assessment for bioaccumulation of polystyrene microplastics in mice. J. Hazardous Mater. 2019;366:703–713. doi: 10.1016/j.jhazmat.2018.12.048. [DOI] [PubMed] [Google Scholar]
- Yin K., Wang D., Zhang Y., Lu H., Wang Y., Xing M. Dose-effect of polystyrene microplastics on digestive toxicity in chickens (Gallus gallus): Multi-omics reveals critical role of gut-liver axis. J. Adv. Res. 2023;52:3–18. doi: 10.1016/j.jare.2022.10.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yin K., Wang D., Zhao H., Wang Y., Zhang Y., Liu Y., Li B., Xing M. Polystyrene microplastics up-regulates liver glutamine and glutamate synthesis and promotes autophagy-dependent ferroptosis and apoptosis in the cerebellum through the liver-brain axis. Environ Pollut. 2022;307:119449. doi: 10.1016/j.envpol.2022.119449. [DOI] [PubMed] [Google Scholar]
- Zhang W., Sun X., Qi X., Liu X., Zhang Y., Qiao S., Lin H. Di-(2-Ethylhexyl) phthalate and microplastics induced neuronal apoptosis through the PI3K/AKT pathway and mitochondrial dysfunction. J. Agric. Food Chem. 2022;70:10771–10781. doi: 10.1021/acs.jafc.2c05474. [DOI] [PubMed] [Google Scholar]
- Zhang Y., Wang X., Zhao Y., Zhao J., Yu T., Yao Y., Zhao R., Yu R., Liu J., Su J. Reproductive toxicity of microplastics in female mice and their offspring from induction of oxidative stress. Environ Pollut. 2023;327:121482. doi: 10.1016/j.envpol.2023.121482. [DOI] [PubMed] [Google Scholar]
- Zhang Y., Yin K., Wang D., Wang Y., Lu H., Zhao H., Xing M. Polystyrene microplastics-induced cardiotoxicity in chickens via the ROS-driven NF-κB-NLRP3-GSDMD and AMPK-PGC-1α axes. Sci. Total Environ. 2022;840 doi: 10.1016/j.scitotenv.2022.156727. [DOI] [PubMed] [Google Scholar]
- Zhou Z.Q., Lv X., Liu S.B., Qu H.C., Xie Q.P., Sun L.F., Li G. The induction of ferroptosis by KLF11/NCOA4 axis: the inhibitory role in clear cell renal cell carcinoma. Hum. Cell. 2023;36:2162–2178. doi: 10.1007/s13577-023-00973-9. [DOI] [PubMed] [Google Scholar]
- Zhu M., Chernick M., Rittschof D., Hinton D.E. Chronic dietary exposure to polystyrene microplastics in maturing Japanese medaka (Oryzias latipes) Aquatic Toxicol. (Amsterdam, Netherlands) 2020;220 doi: 10.1016/j.aquatox.2019.105396. [DOI] [PubMed] [Google Scholar]
- Zhu C., Zhou W., Han M., Yang Y., Li Y., Jiang Q., Lv W. Dietary polystyrene nanoplastics exposure alters hepatic glycolipid metabolism, triggering inflammatory responses and apoptosis in Monopterus albus. Sci. Total Environ. 2023;891:164460. doi: 10.1016/j.scitotenv.2023.164460. [DOI] [PubMed] [Google Scholar]







