ABSTRACT
Bacterial competition may rely on secretion systems such as the type 6 secretion system (T6SS), which punctures and releases toxic molecules into neighboring cells. To subsist, bacterial targets must counteract the threats posed by T6SS-positive competitors. In this study, we used a comprehensive genome-wide high-throughput screening approach to investigate the dynamics of interbacterial competition. Our primary goal was to identify deletion mutants within the well-characterized E. coli K-12 single-gene deletion library, the Keio collection, that demonstrated resistance to T6SS-mediated killing by the enteropathogenic bacterium Cronobacter malonaticus. We identified 49 potential mutants conferring resistance to T6SS and focused our interest on a deletion mutant (∆fimE) exhibiting enhanced expression of type 1 fimbriae. We demonstrated that the presence of type 1 fimbriae leads to the formation of microcolonies and thus protects against T6SS-mediated assaults. Collectively, our study demonstrated that adhesive structures such as type 1 fimbriae confer collective protective behavior against T6SS attacks.
IMPORTANCE
Type 6 secretion systems (T6SS) are molecular weapons employed by gram-negative bacteria to eliminate neighboring microbes. T6SS plays a pivotal role as a virulence factor, enabling pathogenic gram-negative bacteria to compete with the established communities to colonize hosts and induce infections. Gaining a deeper understanding of bacterial interactions will allow the development of strategies to control the action of systems such as the T6SS that can manipulate bacterial communities. In this context, we demonstrate that bacteria targeted by T6SS attacks from the enteric pathogen Cronobacter malonaticus, which poses a significant threat to infants, can develop a collective protective mechanism centered on the production of type I fimbriae. These adhesive structures promote the aggregation of bacterial preys and the formation of microcolonies, which protect the cells from T6SS attacks.
KEYWORDS: bacterial competition, type 6 secretion system, Keio collection, microcolony formation, type 1 fimbriae
INTRODUCTION
Bacteria are often found within complex microbial communities where constant interactions occur. Effective competition strategies are essential for survival, especially in environments where nutrients and micro-elements (e.g., iron) are limited (1). For instance, some microorganisms secrete antimicrobial molecules targeting surrounding microbes (2). In bacteria, competitive interactions are often mediated by secretion systems (3, 4). Secretion systems are protein complexes that allow the passage of proteins across the cell envelope and are involved in bacterial virulence by promoting the invasion of eukaryotic cells or scavenging resources in the environment (5, 6). Twelve secretion systems have been identified in bacteria. Among them, the type 6 secretion system (T6SS) is a potent weapon that delivers toxins into surrounding bacterial cells (7, 8). The T6SS also contributes to virulence by driving the remodeling of microbial communities by pathogenic bacteria and facilitating the establishment of T6SS-positive pathogens (9–11).
The T6SS is a harpoon-like contractile nanomachine that triggers interbacterial competition through the injection of toxic effectors directly into target cells in a contact-dependent manner (12, 13). This nano-harpoon is composed of a membrane complex and a baseplate that serves as a docking station for the assembly of a tail tube/sheath complex (14–16). The tail tube is composed of stacked Hcp hexamers wrapped by a sheath formed by the TssB and TssC proteins (17, 18). The tube is capped by the spike, comprising the VgrG trimer sharpened with the PAAR-domain protein (19). Effector proteins displaying diverse functions [phospholipases (20), amidases (21), DNases (22), etc.] (23) can be loaded within the lumen of the Hcp tube or linked as cargo to VgrG/PAAR domain proteins directly or with the support of specific adaptors (12, 24, 25). The sheath is polymerized in an extended conformation, and upon its contraction, the tail tube is pushed across the envelope of both attacker and target cells, so the antibacterial T6SS effectors can be delivered directly into target cells to kill them.
Target cells can display defense mechanisms against T6SS attacks. The main defense system is orchestrated by immunity proteins that usually specifically bind to the effectors (13). This approach is also used by attacker cells to avoid autointoxication. Immunity-independent resistance to T6SS has also been reported. Indeed, Escherichia coli can sense T6SS effectors through envelope stress-response pathways and resists T6SS attacks from Vibrio cholerae (26). Moreover, target cells can modulate environmental parameters influencing the interaction between attacker and target cells. For example, introducing spatial separation between target and attacker cells is an effective mechanism of resistance to contact-dependent attacks by T6SS (27, 28). This spatial segregation may be due to the production of exopolysaccharides (EPS) to form a physical barrier (29) or biofilm formation (30) which can lead to the formation of microcolonies protecting cells located at the center, by the formation of a barrier of dead cells and debris at the attacker-target interface (28, 31). Collective behaviors are widespread in microbial environment, such as the intestinal microbiota (32, 33), where T6SS performs crucial functions to modulate population dynamics between host-associated microbes, enteric pathogens, and host immune response (34, 35). Despite growing interest in resistance mechanisms, many aspects remain unknown regarding target cell defenses against T6SS assaults.
High-throughput approaches using ordered libraries of mutants allow to rapidly discover and investigate new genetic pathways involved in a phenotype of interest (36, 37), including the regulation of T6SS (38). In this study, we developed a screening method that enabled us to analyze interbacterial competition in a genome-wide high-throughput manner. Using Cronobacter malonaticus, an Enterobacteria highly prevalent in powdered infant formula and known to cause severe infections in newborns and immunocompromised individuals (e.g., meningitis, necrotizing enterocolitis) (39), as a model attacker bacterium, and the single-gene deletion mutants for all nonessential E. coli K-12 genes library (Keio collection) (40) as target cells, we identified that the deletion of the fimE recombinase provides resistance to T6SS attacks. We further showed that a ΔfimE mutant overexpressed type 1 fimbriae leading to the formation of microcolonies. Target cells within these microcolonies were protected from contact-dependent killing mediated by the T6SS, leading to their survival. This defense mechanism could represent a nonspecific resistance mechanism, unlike immunity proteins, which could potentially lead to resistance against a broad range of assailants.
RESULTS
Cronobacter malonaticus 3267 efficiently kills E. coli in a T6SS-dependent manner
A recent study has shown that a conserved T6SS gene cluster among Cronobacter sakazakii strains displays a strong activity in laboratory conditions (41). Based on this study, we hypothesized that Cronobacter malonaticus strain 3267 may also possess a functional T6SS. Sequencing confirmed the presence of a T6SS gene cluster in C. malonaticus 3267, bearing similarities to the T6SS-1 found in C. sakazakii ATCC 12868 (Fig. 1A). A bacterial competition assay validated that C. malonaticus 3267 displays antibacterial activity against E. coli in typical laboratory growth conditions (Fig. 1B). We used E. coli BW25113 ΔyejO from the Keio collection as target cells, which we consider as wild-type (WT) E. coli in our study. yejO is a pseudogene in E. coli, inactivated by an insertion sequence (IS5K) close to its start codon. BW25113 ΔyejO target is eliminated to a similar extent than E. coli BW25113 WT strain, thus making it a suitable target cell in our study (Fig. S1A).
Fig 1.
C. malonaticus 3267 kills E. coli BW25113 in a T6SS-dependent manner. (A) Schematic representation of the T6SS-1 gene cluster in C. sakazakii ATC12868 (from Wang et al. [41]) and of the T6SS gene cluster in C. malonaticus 3267. Structural genes of the membrane complex are displayed in light to dark orange. Genes coding for baseplate proteins are displayed in light to dark blue. The genes tssB and tssC of the tail tube/sheath complex are shown in light and dark green. Genes coding for proteins involved in T6SS post translational regulation are indicated in pink. Genes coding for toxins and antitoxins are displayed in yellow. Open reading frame with unknown function is shown in black. (B) Attackers and kanamycin-resistant target cells were mixed at a concentration of 106 CFU and at a ratio of 1:1 and incubated onto a nitrocellulose filter for 24 h. Surviving target cells at 0 and 24 h were enumerated by plating on selective agar plates. Target survival is presented in log10 CFUs. (C) Representative picture of the target cells selection after the killing assay. One-way ANOVA test was performed to determine statistical significance (ns = nonsignificant, *P ≤ 0.05, **P ≤ 0.005, ****P ≤ 0.0001). Data represent three independent experiments.
To test whether the antibacterial activity of C. malonaticus was T6SS dependent, we quantified the survival of E. coli ΔyejO target cells after co-incubation with a WT or a T6SS-inactive mutant of C. malonaticus 3267 (ΔtssM). When E. coli ΔyejO is incubated with WT C. malonaticus 3267, ~5 × 104 CFUs of target cells were recovered after the competition assay (Fig. 1B and C). However, when co-incubated with the ΔtssM mutant, ~1 × 1012 CFUs of target cells were recovered. The deletion of tssM did not affect the growth of C. malonaticus 3267 (Fig. S1B), and the presence of target cells did not affect C. malonaticus 3267 (Fig. S1C). Collectively, these data suggest that C. malonaticus 3267 employs its T6SS to eliminate E. coli target cells.
A high-throughput interbacterial competition assay identifies E. coli ΔfimE as resistant to T6SS
High-throughput interbacterial competition (HTIC) assays combined with the use of target or attacker libraries of mutants are effective in uncovering new mechanisms involved in T6SS function and biogenesis (38). We performed a high-throughput competition assay between the Keio collection mutants as target cells and C. malonaticus 3267 as the attacker strain (Fig. 2A). We co-cultured targets and attackers on competition plates in a 1,536-colony density format. After 24 h of co-incubation, colonies were replicated on selection plates containing kanamycin, allowing the growth of the Keio mutants that escaped T6SS killing. We expected that the deletion of genes related to T6SS susceptibility would increase survival of prey cells upon interbacterial competition.
Fig 2.
High-throughput interbacterial competition assay identifies E. coli BW25113 ΔfimE mutant as resistant to C. malonaticus 3267 T6SS-mediated killing. (A) Schematic representation of the HITC assay methodology (CM3267: C. malonaticus 3267). (B) Bar plot of mutant survival after the HTIC assay. For each replicate, survival was assessed using binary value; colony growth = 1, no colony growth = 0. In this setting, a mutant is resistant if there is a surviving colony in at least two of the three replicates. (C) Interbacterial competition assay between WT or ΔtssM attackers and ΔyejO or ΔfimE target cells. (D) Complementation of ΔfimE mutant with pCA24N plasmid (empty vector or fimE) to restore the susceptibility to T6SS. (C and D) Target survival is presented in log10 CFU. One-way ANOVA test was performed to determine statistical significance (ns = nonsignificant, *P ≤ 0.05, **P ≤ 0.005, ***P ≤ 0.0005, ****P ≤ 0.0001). Data represent three independent experiments.
To avoid bias in determining which genes confer resistance to the T6SS attack, we used binary values, where 1 means growth and 0 means no growth, instead of measuring colony size or colony density. Keio mutants can display different colony morphologies (e.g., small, mucoid, and sticky) (42), and therefore, measuring colony size on the selection plates does not correlate with the resistance level of target cells. The binary values of three replicates were averaged in order to score the mutants in the Keio collection (Fig. 2B).
Of the ~4,000 Keio mutants, only 49 displayed resistance (Table S2) to T6SS in at least two out of the three replicates as some defense mechanisms can provide only partial resistance to T6SS (27). These resistant mutants included the fimE mutant. In pairwise interbacterial competition assays against the WT attacker, the fimE mutant displayed a difference of almost 4 log CFUs in survival compared to the yejO mutant (Fig. 2C). However, the fimE mutant still showed lower survival than target cells in competition with the ΔtssM attacker (~4 log CFUs), suggesting that the fimE mutant conferred only partial resistance to T6SS attacks (Fig. 2C). Transcomplementation using the high-copy pCA24N-fimE plasmid (43) restored the killing by C. malonaticus 3267 to WT levels (Fig. 2D), confirming that the observed phenotype is the result of the deletion of the fimE gene.
E. coli BW25113 ΔfimE exhibits increased production of type 1 fimbriae
The fim operon is composed of nine genes encoding structural, assembly, and transport components (fimAICDFGH) as well as regulators (fimB and fimE). FimA is the major structural subunit of the fimbriae and is secreted by the FimC chaperone and the FimD usher (44). FimH encodes a mannose-specific adhesin located at the tip of the fimbriae that mediates the attachment to mannosylated receptors at the cell surface. FimB and FimE encode recombinases that control the permutation of an invertible 314 bp element (fim switch) located directly in front of fimA and flanked by two inverted 9 bp repeats (45, 46). This inversion activates or prevents the transcription of type 1 fimbriae genes in a process called phase variation (47). The FimE recombinase preferentially switches from a phase with fimbriae production (ON-phase) to a phase without fimbriae production (OFF-phase), whereas FimB recombinase mediates permutations in both directions, with a preference to an ON-phase orientation (48, 49).
The overall effect of the FimE recombinase on the expression of fimbriae is still debated. Orndorff et al. demonstrated an increase in the number of fimbriae per cell in E. coli when producing the fim operon from a high copy number plasmid containing a deletion of the fimE gene (50). However, another study showed no difference in bacterial fimbriation in the isogenic fimE mutant in E. coli MG1655 compared to the WT strain (51). Therefore, we first analyzed the production of type 1 fimbriae of the E. coli BW25113 fimE mutant. Electron microscopy revealed that 50% of the ΔfimE cells possessed fimbriae compared to only 15% of ΔyejO cells (Fig. 3A and B). Moreover, when ΔfimE cells were fimbriated, there were more fimbriae per cell, with 33% of cells having more than 15 fimbriae on their surface, compared to only 1.4% of ΔyejO cells (Fig. 3B).
Fig 3.
The ΔfimE mutant produces type 1 fimbriae that promote the formation of bacterial microcolonies. (A) Electron microscopy of fimbriated cells. Negatively stained preparation of a 24-h stationary culture of E. coli BW25113 ΔyejO and ΔfimE, grown on Luria Broth agar plate. (B) Proportion of fimbriated and nonfimbriated cells in ΔyejO (n = 74; 14.9% of fimbriated cells) and ΔfimE (n = 60; 50% of fimbriated cells). (C) gfp-Expressing strains were spotted in duplicate after centrifugation and vortex cycle and observed in fluorescence microscopy. Three images were taken at random points for each duplicate for three independent experiments. Microcolonies size was assessed using ImageJ. (D) Box plot of the particle sizes of the ΔyejO and ΔfimE mutants. Box plots extend from the 5th to 95th percentiles. Cross, mean; crossing line, median. Nonparametric Mann Whitney test was performed to determine statistical significance (****P < 0.0001). (E) Box plot of the average size of particles of each random point images (n = 18). Unpaired t-test was performed to determine statistical significance (****P < 0.0001). Box plots extend from the minimum to the maximum, showing all points. Cross, mean; crossing line, median.
We also observed that when centrifuged, the fimE mutant formed aggregates that did not dissociate easily. Shear stress is known to enhance the adhesion of bacteria via the FimH adhesin of type 1 fimbriae (52). Therefore, we next observed by microscopy if the increased production of type 1 fimbriae in the fimE mutant led to the formation of microcolonies (Fig. 3C). Bacterial cultures were centrifuged and vortexed, then spotted onto semi-solid Luria broth (LB) agar, and observed on a confocal microscope. Only the fimE deletion mutant was able to form large microcolonies. The area of all particles was analyzed to assess the size of microcolonies (Fig. 3D). ΔfimE strain had a significantly greater average particle size compared to the ΔyejO strain (Fig. 3E). The observed variability within the size of microcolonies for ΔfimE strains correlates with the electron microscopy findings, showing that 50% of cells produce fimbriae. Overall, these results show that the fimE deletion mutant actively produces type 1 fimbriae and forms microcolonies when subjected to shear forces.
Type 1 fimbriae mediate the formation of microcolonies
We next investigated whether the formation of microcolonies was linked to the FimH adhesin located at the tip of the type 1 fimbrial structure. Our goal was to determine whether the microcolonies were responsible for the resistance to T6SS attacks or whether the fimbriae themselves were sufficient to obstruct T6SS assaults. Because of their length (~1 µm) and their considerable number on the cell surface (>200/cell) (44, 53), type 1 fimbriae could mask direct interactions between cell structures and the environment. One possibility is thus that fimbriated cells are shielded against T6SS by the fimbriae covering their surface.
To confirm that the formation of microcolonies observed was mediated by type 1 fimbriae, we next observed the formation of microcolonies in the fimE mutant with (5%) and without D-mannose (Ctrl) (Fig. 4A). D-mannose binds the FimH adhesin at the tip of type 1 fimbriae inhibiting adhesion (54) and agglutination to yeast (55). Indeed, we observed that adding D-mannose to the fimE mutant bacterial cultures inhibited the formation of microcolonies (Fig. 4A). The ΔfimE strain supplemented with D-mannose led to the reduction of the size of particles in comparison to the ΔfimE mutant without D-mannose (Fig. 4C). The analysis of particle sizes across multiple experiments further showed that the ΔfimE strain had a significantly greater average particle compared to the ΔfimE mutant supplemented with D-mannose (Fig. 4D).
Fig 4.
Type 1 fimbriae adhesin is essential for microcolony formation and T6SS resistance. (A) Visualization of microcolonies using fluorescence microscopy. (B) Yeast agglutination assay with and without D-mannose (competitive ligand binding to FimH). Agglutination phenotype is observed for the ΔfimE mutant. The absence of agglutination is characterized by a cloudy appearance of the mixture. (C) Box plot of the overall size of particles distribution of the ΔfimE mutant with and without 5% of D-mannose. Box plots extend from the minimum to the maximum, showing all points. Cross, mean; crossing line, median. Nonparametric Mann Whitney tests were performed to assess statistical significance using R (****P ≤ 0.0001). (D) Box plot of the average size of particles of each random point images (n = 18). Box plots extend from the 5th to 95th percentiles. Cross, mean; crossing line, median. Unpaired t-test was performed to assess statistical significance using R (**P = 0.005). (E) Interbacterial competition assay between WT or ΔtssM attackers and ΔyejO or ΔfimE (with and without 5% of D-mannose) target cells. Target survival after killing assays is presented in log10 CFUs. One-way ANOVA test was used followed by Tukey post hoc test to determine statistical significance using R (ns = nonsignificant, **P ≤ 0.005, ***P ≤ 0.0005, ****P ≤ 0.0001). Data represent three independent experiments.
In addition, type 1 fimbriated cells are known to promote yeast agglutination (55). Overnight cultures of various bacterial strains were mixed with rehydrated Saccharomyces cerevisiae, spotted on a glass slide, and observed macroscopically. As expected, E. coli ΔyejO did not agglutinate S. cerevisiae cells (Fig. 4B) in contrast to the solution containing the fimE mutant where agglutination was visible. The agglutination phenotype observed with the fimE mutant was inhibited by the addition of D-mannose, as expected.
Finally, we tested whether functional (i.e., adhesive) type 1 fimbriae were needed to promote resistance to T6SS-mediated killing. Therefore, we performed the competition assay in the presence or absence of D-mannose (Fig. 4E). As observed previously, the fimE mutant was protected against T6SS attacks. The addition of D-mannose to ΔfimE cultures to prevent the formation of microcolonies led to the loss of T6SS resistance to the same extent as the ΔyejO strain (Fig. 4E). In these conditions, growth of C. malonaticus and T6SS activity are not affected by the addition of 5% of D-mannose (Fig. S2A and B). We also performed the same experiments using a double fimE fimH deletion mutant and observed similar results (Fig. S3). Collectively, these findings highlight the implication of FimH adhesive interactions in the formation of microcolonies and resistance to T6SS-mediated killing. In addition, the interbacterial killing assays suggest that T6SS resistance exhibited by the fimE mutant is not due to single-cell spatial segregation driven by the fimbriae but more likely attributed to microcolonies formed through FimH.
Formation of microcolonies by type 1 fimbriated target cells leads to their resistance to the T6SS
We have shown that D-mannose inhibited microcolony formation and suppressed the resistance to T6SS-mediated attacks. However, about 50% of the ΔfimE cells expressed type 1 fimbriae. In addition, the fimE deletion does not grant a complete resistance to T6SS attacks. Thus, we hypothesized that target cells inside microcolonies are protected, while individual cells are killed by the attacker. To test our hypothesis, we performed a time course interbacterial competition assay adapted from Granato et al. (29). Co-cultures were spotted directly onto LB-agar in 12-well plates and imaged every hour for 6 h to observe the GFP-positive target cells (Fig. 5A). The susceptibility of GFP-negative and GFP-positive target cells to T6SS killing was similar (Fig. S4). The total fluorescence inside the spot was then evaluated at 0 and 6 h (Fig. 5B), where the fluorescence intensity represents a measurement of target cells survival. When grown with a T6SS-deficient attacker, the ΔyejO target strain multiplied strongly as expected, reaching a 10-fold higher fluorescence intensity ratio at 6 h compared with T0. On the other hand, the ΔyejO target strain was eliminated after 6 h of co-culture with the T6SS-positive attacker. We observed the same result for the ΔfimE target supplemented with 5% of D-mannose, validating our previous assertions that the fimbrial structure by itself is not sufficient to confer resistance to T6SS. In condition without D-mannose supplementation, the ΔfimE mutant was found within microcolonies as well as single cells (i.e., weak fluorescence signal across the entire spot) at T0. Here, however, cells found in microcolonies survived the T6SS attack, while the fluorescence signal from the single cells was not detectable at 6 h. Overall, our results suggest that cells inside type 1 fimbriae-mediated microcolonies are protected from T6SS attacks, while individual cells are not.
Fig 5.
(A) Whole-colony microscopy reveals that type 1 fimbriae-dependent microcolonies confer resistance to the ΔfimE mutant against T6SS-mediated killing. Interbacterial killing was assessed using confocal microscopy and GFP-positive target cells. Attackers and targets grown overnight were mixed with a ratio of 1:1, spotted onto LB 0.8% noble agar in 12-well plates, and incubated at 37°C. The co-cultures were imaged every hour for 6 h. The colonies were delimited using orange dashed circles. (B) The killing rate was evaluated by assessing the total fluorescence inside the spot at 0 and 6 h using ImageJ and compared with the initial fluorescence rate (at 0 h). One-way ANOVA test was performed followed by Games-Howell post hoc test with Welch’s correction to determine statistical significance using R (ns = nonsignificant, **P ≤ 0.005, ****P ≤ 0.0001). Average ± s.d. of n = 6–9 replicates.
DISCUSSION
The discovery, 20 years ago, of the type 6 secretion system, a microbial weapon resembling the contractile tail of bacteriophages, changed our appreciation of bacterial dynamics within complex communities. Most studies on T6SS focus on various aspects of its biology, including biogenesis, assembly, function, and effector characterization. T6SSs inject toxic effectors directly into bacterial target cells. T6SS producers avoid autotoxicity by expressing effector-specific immunity proteins. There has been a growing interest in immunity-independent target cell defense mechanisms after the observations that envelope stress responses (26) and EPS production (29) could promote resistance to T6SS. This last study focused on the concept of spatial separation, which occurs through the formation of microcolonies, as a strategic means to evade T6SS attacks. For example, type 4 pili, which are known to drive the formation of microcolonies (56) in Neisseria species, were shown to promote survival when expressed in target cells through segregation of attacker and target cells (56).
In this work, we developed a high-throughput interbacterial competition assay that allowed us to rapidly identify mutants that were resistant to T6SS-mediated killing of C. malonaticus 3267. C. malonaticus is an interesting model organism to study T6SS biology as its T6SS activity is highly effective under typical laboratory conditions (Fig. 1). The majority of gene deletions identified in our HTIC assay that conferred resistance to T6SS attacks were primarily associated with transport and metabolism (degradation and energy production), but some of our hits were previously associated with cell motility and biofilm formation, including ΔypdB (57) and ΔymgC (58). The product of these genes would thus impact how attacker and target cells interact together. This suggests that the modulation of the interaction dynamics between attacker and target cells could be a main strategy by which target cells can evade T6SS attacks (28, 29, 59, 60). Another hit that exhibited resistance to T6SS activity is the ldtB mutant. LdtB functions as a periplasmic L,D-transpeptidase which cleaves the peptide bond between meso-diaminopimeloyl (mDAP) and D-alanine in the peptidoglycan (61, 62). The T6SS-dependent activity of C. malonaticus is associated with the amidase effector Tae4, which is present in the T6SS cluster. The Tae4 effector is a L,D-transpeptidase that induces cell lysis by cleaving the d-Glu-mDAP bond in gram-negative bacteria (21). A mutant with a slightly compromised cell wall, in which the effector might potentially act, could unexpectedly exhibit resistance. Further research is required to investigate and test this concept.
We focused our analysis on the fimE mutant, a regulator of type 1 fimbriae production, which interestingly, appeared to confer partial protection against T6SS. Notably, the expression of type 1 fimbriae is governed by a phase variation mechanism, resulting in a heterogeneous phenotype within a clonal population. This variability could account for the observed resistance conferred by the fimE mutant in only two out of the three replicates. Consequently, it underscored the necessity for further investigations.
Type 1 fimbriae are rod-shaped structures found at the surface of numerous bacterial species including enteric pathogen such as enteropathogenic and enterohemorrhagic E. coli (63, 64). Some studies have highlighted a link between type 1 fimbriae expression and T6SS in attacker cells (65). For instance, in avian pathogenic Escherichia coli strains, mutations of T6SS genes decrease the expression of type 1 fimbriae, leading to lower adhesion and epithelial cells invasion (66). Our findings demonstrate that type 1 fimbriae also play a defensive role in target cells.
Our initial hypothesis was that the fimE mutant overexpressed type 1 fimbriae genes, resulting in their increased production. Electron microscopy and agglutination assays confirmed that the fimE mutant indeed increased the production of type 1 fimbriae compared to wild type (Fig. 3). The FimH adhesin, located at the tip of the type 1 fimbriae and responsible for adherence to mannose-specific receptors on host cell surfaces (67), has been previously associated with stress response behaviors, such as the internalization of fimbriated E. coli by macrophages in response to lethal concentrations of antibiotics (68). Moreover, adhesion appears to be an important mechanism for protection against environmental stress such as shear stress (52, 69). Adhesion mediated by type 1 fimbriae is the first step in biofilm formation (70, 71), where adherent bacteria organize themselves into microcolonies embedded within a self-produced matrix of exopolysaccharide, extracellular DNA, and proteins (72). Indeed, our whole-colony microscopy assay demonstrated that type 1 fimbriae enabled the establishment of microcolonies (Fig. 3) and that target cells within these microcolonies were protected from T6SS-mediated killing in contrast to individual bacterial cells which were efficiently killed (Fig. 5). Moreover, whole-colony microscopy of ΔfimE mutant in the presence of D-mannose showed that isolated fimbriated cells were killed, leading us to conclude that fimbriae alone are not sufficient to protect against T6SS attack, and emphasized that the formation of microcolonies is providing this resistance.
The synthesis of fimbriae or other adhesins such as autotransporters (73, 74), promoting the formation of microcolonies (73, 74), could represent a widespread and nonspecific defense mechanism against T6SS attacks from diverse bacteria. Accordingly, a fim locked-OFF strain of uropathogenic E. coli CFT073 still demonstrated resistance to T6SS attacks, albeit to a lesser extent than a locked-ON strain (data not shown). E. coli strain CFT073 possesses multiple fimbriae operons that are expressed in a coordinated manner (75). This raises questions about whether other types of fimbriae could also promote the resistance phenotype against T6SS attacks. Additionally, such structures may confer protection against various adverse stresses, including antimicrobials and reactive oxygen species. For instance, Schembri et al. demonstrated that bacterial aggregation induced by the adhesin Ag43 expression enhances survival in the presence of hydrogen peroxide (76), suggesting that the formation of microcolonies may offer broad protection against multiple stresses.
Importantly, the T6SS is not the sole contact-dependent weapon found in gram-negative bacteria. Certain contact-dependent growth inhibitions (CDI) are known to be secreted by T4SS (77) and T5SS (78). Microcolonies formed by type 1 fimbriae may therefore also provide protection to prey cells against attacker cells that use these other CDI systems. Further research is necessary to fully understand the role of type 1 fimbriae in the protection of cells under diverse stress conditions.
One of our hypotheses, supported by electron microscopy findings indicating that 50% of cells are fimbriated in the ΔfimE mutant, is that isolated cells constitute the nonfimbriated cell fraction of the ΔfimE mutant and that microcolonies were formed by the fimbriated cells. It is also possible, however, that nonfimbriated cells are also part of the microcolonies. It would therefore be interesting to identify the fimbriae-producing cells within the population in order to observe if cheaters can profit from this collective behavior. Multicellular lifestyles are prone to the presence of cheaters in the population (79). Because type 1 fimbriae are regulated through phase variation, this represents an intriguing possibility and could represent a selfless defense mechanism against the T6SS assault.
T6SS plays a crucial role in shaping microbial populations in various environments, including the gastrointestinal microbiota (34, 35, 80). Indeed, T6SS are prevalent in enteric bacteria (81). Type 1 fimbriae represent a prevalent adhesive organelle found in various members of the Enterobacteriaceae family and play a significant role as virulence factors (82). In some bacteria, those determinants act simultaneously to adhere and invade host cell (66). Studying the relationship between T6SS and type 1 fimbriae expression and, more broadly, adhesin structures in pathogenic versus host-associated bacteria in vivo would be an interesting line of research to elucidate the networks of genetic interactions involved in competition between bacteria.
MATERIALS AND METHODS
Strains, media, and chemicals
Bacterial strains and plasmids used in this study are listed in Table 1. Bacterial cultures were grown in Luria broth-Lennox medium (10 g/L NaCl, 5 g/L yeast extract, 5 g/L tryptone, and 15 g/L agar when needed). When required, the media were supplemented with kanamycin (50 µg/mL), ampicillin (100 µg/mL), diaminopimelic acid (0.3 mM), spectinomycin (120 µg/mL), chloramphenicol (37 µg/mL), and D-mannose 5%. Liquid cultures of C. malonaticus 3267 and E. coli BW25113 were both grown at 37°C with agitation (180 and 80 rpm, respectively).
TABLE 1.
Bacterial strains and plasmids used in this study
| Strain or plasmid | Description | Source |
|---|---|---|
| Cronobacter malonaticus 3267 | Wild type | This study |
| ΔtssM::aadA(smR) | tssM gene deletion mutant from Cronobacter malonaticus 3267 | This study |
| Keio collection | Mutant collection of all nonessential genes from E. coli K-12 BW25113. F−, Δ(araD-araB)567, λ−, rph-1, Δ(rhaD-rhaB)568, hsdR514 |
KEIO collection (40) |
| ΔyejO::nptII(kanR) | yejO pseudo gene deletion mutant from E. coli K-12 BW25113. Considered as WT | This study |
| ΔfimE::nptII(kanR) | fimE gene deletion mutant from E. coli K-12 BW25113 | This study |
| pCA24N | CmR, IPTG-inducible promotor | ASKA collection (43) |
| pCA24N-fimE | CmR, IPTG-inducible promotor, expression of FimE | ASKA collection (43) |
| pKD3 | Template plasmids for frt-flanked cat cassette. cat cassette originally came from pSC140 | (83) |
| pSIM19 | SmR, pSC101 repAts | (84) |
| pSIM6 | AmpR, pSC101 repAts | (85) |
| pTrcGFP | AmpR, green fluorescent protein expression, pTrc99a backbone | This study |
Strain construction
Gene deletion in C. malonaticus 3267 was done using the lambda red recombinase system protocol (83) with minor modifications. Briefly, a spectinomycin resistance cassette was amplified from plasmid pSIM19 using primers (listed in Table 2) carrying at the 5′ end 30-nucleotide extensions homologous to regions adjacent to the gene to be deleted. PCR products were purified, then 2 µL was transformed into C. malonaticus 3267 electro-competent cells carrying the red recombinase pSIM6 vector. Transformants were selected on spectinomycin plates and verified by colony PCR using primers listed in Table 2.
TABLE 2.
Primers used in this study
| Primer type and gene | F/R | Sequence |
|---|---|---|
| Gene deletion | ||
| tssM | F | taaagcgctgcaaaccaccgccgggcgcgatctcttcagcgtgtaggctggagctgcttc |
| tssM | R | gctaatcgcagggtaatgactcattatccgttccttgcggcatatgaatatcctccttag |
| Colony PCR verification | ||
| tssM | F1 | acgtgattttccaggaagcgg |
| tssM | F2 | ccacggaatgatgtcgtcg |
| tssM | R1 | ggagtgaataccacgacgat |
| tssM | R1 | cgacgacatcattccgtgg |
Growth curves
Growth was assessed using overnight culture and adjusted to an optical density (OD600) of 1, diluted 1/100, and transferred to 96-well plates. The strains were grown at 37°C in a Spark 20M multimode microplate reader (TECAN), where the OD600 was measured every 20 min for each strain.
Particles analysis using confocal microscopy
ΔyejO and ΔfimE prey strains were cultured in liquid overnight and were next adjusted to an OD600 of 1. Then, 5% D-mannose was added to ΔfimE prey culture when required, and 2 µL was spotted onto LB 0.8% noble agar in 12-well plates in duplicate. The particles were observed using a 20 magnification FV3000 Olympus confocal microscope for three independent experiments. For each experiment, strains were spotted in duplicate. Three images were taken at random coordinates for each duplicate. Particle sizes were assessed using the ImageJ “Analyze Particles” function.
Interbacterial competition assay
C. malonaticus 3267 WT and ΔtssM mutants were used as attacker cells. E. coli BW25113 ΔfimE and ΔyejO were used as target cells for interbacterial competition assay. Attackers and targets were grown in liquid media overnight. The cultures were adjusted to an OD600 of 1. And, 5% D-mannose was added to target cultures when required. Approximately 107 bacteria were combined at a ratio of 1:1, then 5 µL was spotted onto sterile nitrocellulose filters on LB agar plate and incubated for 24 h at 37°C. The co-cultures were resuspended in 1 mL of LB broth. Serial dilutions were plated onto LB selective medium to assess the number of CFUs of surviving target cells. The experiment was repeated three times independently. For the complementation assay, E. coli BW25113 ΔyejO pCA24N, ΔfimE pCA24N, and ΔfimE pCA24N-fimE were used as targets, and the expression of genes from pCA24N vector was induced with 10 µM of isopropyl-β-D-thio-galactopyranoside in overnight liquid cultures and competition agar plates used for interbacterial competition.
High-throughput interbacterial competition assay
Attackers C. malonaticus 3267 WT and ΔtssM mutants were grown in overnight liquid cultures at 37°C. Next day, the cultures were pinned on agar plates with 1,536-pin pad using the Rotor HDA (Singer Instruments, United Kingdom), then incubated 1 h at 37°C. The Keio collection was grown, in parallel, for 2 h in 384-well plates at 37°C, directly from 384-well plates stored at −80°C. Keio mutants were then pinned onto competition agar plates and incubated for 24 h at 37°C. Survival was assessed by pinning onto kanamycin selection plates. Surviving was assessed for each replicate using binary value; any growth refers to resistance (=1), no growth means that the mutant is sensitive (=0). In this experiment, a mutant was considered resistant if there was growth in at least two of the three replicates.
Yeast agglutination assay
Strains used in this assay were grown overnight in liquid media. The cultures were adjusted to an OD600 of 6 and then centrifuged at 5,000 rpm for 5 min and then resuspended in 5 mL of phosphate buffered saline (PBS, pH 7.2). Yeast cells were resuspended in 5 mL of PBS. And, 5% D-mannose was added when required. Cells were mixed at a ratio of 1:1, then 20 µL was spotted onto glass slides.
Electron microscopy
Twenty-four-hour colonies grown on agar plates at 37°C for 24 h were resuspended in HEPES buffer and then deposited on carbon-supported grids at room temperature. Samples were negatively stained with 2% of uranyl acetate. Negatively stained bacterial cells were examined with a TECNAI G2 electron microscope. Fifty pictures were acquired for each condition. All bacteria were considered for counting the number of fimbriae per cell.
Interbacterial competition assay in macrocolony and observation using confocal microscopy
Interbacterial competition assays were performed as described by Granato et al. (29) with minor modifications. Briefly, target cells carrying the pTrcGFP strong gfp-expressing vector were grown in liquid media overnight with 100 µg/mL of ampicillin. The cultures were adjusted to an OD600 of 1. D-mannose (5%) was added when required. Approximately 106 bacteria were combined at a ratio of 1:1, then 2 µL was spotted on LB 0.8% noble agar in 12-well plates and incubated at 37°C, and images were acquired every hour for 6 h using a 20 magnification FV3000 Olympus confocal microscope. The killing rate was evaluated by assessing the total fluorescence inside the spot at 0 and 6 h using ImageJ.
Statistical analysis
All experiments were carried out at least three times with at least two biological replicates for each experiment except for the electron microscopy assay. Statistical analyses were made using R. The normal distribution of the data was first assessed, followed by a Levene’s test to examine the homogeneity of standard deviations across samples. The choice of whether to use parametric or nonparametric tests to analyze the data was made in accordance with the results obtained for the normality tests. The choice between ANOVA and two-group comparison tests depended on the number of groups under analysis.
ACKNOWLEDGMENTS
We thank Daphnée Lamarche for insightful comments on the manuscript.
This work was supported by the Natural Science and Engineering Research Council of Canada (RGPIN-2019-06044). J.-P.C. holds a Chercheur boursier junior 1 fellowship from the Fonds de recherche du Québec-Santé (FRQS).
Contributor Information
Jean-Philippe Côté, Email: jp.cote@usherbrooke.ca.
Matthew R. Chapman, University of Michigan-Ann Arbor, Ann Arbor, Michigan, USA
SUPPLEMENTAL MATERIAL
The following material is available online at https://doi.org/10.1128/mbio.02553-23.
Supplemental figures and tables.
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.
REFERENCES
- 1. Hibbing ME, Fuqua C, Parsek MR, Peterson SB. 2010. Bacterial competition: surviving and thriving in the microbial jungle. Nat Rev Microbiol 8:15–25. doi: 10.1038/nrmicro2259 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Künzler M. 2018. How fungi defend themselves against microbial competitors and animal predators. PLoS Pathog 14:e1007184. doi: 10.1371/journal.ppat.1007184 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Bao H, Wang S, Zhao JH, Liu SL. 2020. Salmonella secretion systems: differential roles in pathogen-host interactions. Microbiol Res 241:126591. doi: 10.1016/j.micres.2020.126591 [DOI] [PubMed] [Google Scholar]
- 4. Waksman G. 2012. Bacterial secretion comes of age. Philos Trans R Soc Lond B Biol Sci 367:1014–1015. doi: 10.1098/rstb.2011.0200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Si M, Wang Y, Zhang B, Zhao C, Kang Y, Bai H, Wei D, Zhu L, Zhang L, Dong TG, Shen X. 2017. The type VI secretion system engages a redox-regulated dual-functional heme transporter for zinc acquisition. Cell Rep 20:949–959. doi: 10.1016/j.celrep.2017.06.081 [DOI] [PubMed] [Google Scholar]
- 6. Wan B, Zhang Q, Ni J, Li S, Wen D, Li J, Xiao H, He P, Ou H-Y, Tao J, Teng Q, Lu J, Wu W, Yao Y-F. 2017. Type VI secretion system contributes to Enterohemorrhagic Escherichia coli virulence by secreting catalase against host reactive oxygen species (ROS). PLoS Pathog 13:e1006246. doi: 10.1371/journal.ppat.1006246 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Mougous JD, Cuff ME, Raunser S, Shen A, Zhou M, Gifford CA, Goodman AL, Joachimiak G, Ordoñez CL, Lory S, Walz T, Joachimiak A, Mekalanos JJ. 2006. A virulence locus of Pseudomonas aeruginosa encodes a protein secretion apparatus. Science 312:1526–1530. doi: 10.1126/science.1128393 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Pukatzki S, Ma AT, Sturtevant D, Krastins B, Sarracino D, Nelson WC, Heidelberg JF, Mekalanos JJ. 2006. Identification of a conserved bacterial protein secretion system in Vibrio cholerae using the Dictyostelium host model system. Proc Natl Acad Sci U S A 103:1528–1533. doi: 10.1073/pnas.0510322103 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Chassaing B, Cascales E. 2018. Antibacterial weapons: targeted destruction in the microbiota. Trends Microbiol 26:329–338. doi: 10.1016/j.tim.2018.01.006 [DOI] [PubMed] [Google Scholar]
- 10. Chatzidaki-Livanis M, Geva-Zatorsky N, Comstock LE. 2016. Bacteroides fragilis type VI secretion systems use novel effector and immunity proteins to antagonize human gut Bacteroidales species. Proc Natl Acad Sci U S A 113:3627–3632. doi: 10.1073/pnas.1522510113 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Sana TG, Flaugnatti N, Lugo KA, Lam LH, Jacobson A, Baylot V, Durand E, Journet L, Cascales E, Monack DM. 2016. Salmonella Typhimurium utilizes a T6SS-mediated antibacterial weapon to establish in the host gut. Proc Natl Acad Sci U S A 113:E5044–E5051. doi: 10.1073/pnas.1608858113 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Cianfanelli FR, Monlezun L, Coulthurst SJ. 2016. Aim, load, fire: the type VI secretion system, a bacterial nanoweapon. Trends Microbiol 24:51–62. doi: 10.1016/j.tim.2015.10.005 [DOI] [PubMed] [Google Scholar]
- 13. Yang X, Long M, Shen X. 2018. Effector–immunity pairs provide the T6SS nanomachine its offensive and defensive capabilities. Molecules 23:1009. doi: 10.3390/molecules23051009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Brunet YR, Zoued A, Boyer F, Douzi B, Cascales E. 2015. The type VI secretion TssEFGK-VgrG phage-like baseplate is recruited to the TssJLM membrane complex via multiple contacts and serves as assembly platform for tail tube/sheath polymerization. PLoS Genet 11:e1005545. doi: 10.1371/journal.pgen.1005545 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Durand E, Nguyen VS, Zoued A, Logger L, Péhau-Arnaudet G, Aschtgen MS, Spinelli S, Desmyter A, Bardiaux B, Dujeancourt A, Roussel A, Cambillau C, Cascales E, Fronzes R. 2015. Biogenesis and structure of a type VI secretion membrane core complex. Nature 523:555–560. doi: 10.1038/nature14667 [DOI] [PubMed] [Google Scholar]
- 16. Zoued A, Brunet YR, Durand E, Aschtgen MS, Logger L, Douzi B, Journet L, Cambillau C, Cascales E. 2014. Architecture and assembly of the type VI secretion system. Biochim Biophys Acta 1843:1664–1673. doi: 10.1016/j.bbamcr.2014.03.018 [DOI] [PubMed] [Google Scholar]
- 17. Ballister ER, Lai AH, Zuckermann RN, Cheng Y, Mougous JD. 2008. In vitro self-assembly of tailorable nanotubes from a simple protein building block. Proc Natl Acad Sci U S A 105:3733–3738. doi: 10.1073/pnas.0712247105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Lossi NS, Manoli E, Förster A, Dajani R, Pape T, Freemont P, Filloux A. 2013. The HsiB1C1 (TssB-TssC) complex of the Pseudomonas aeruginosa type VI secretion system forms a bacteriophage tail Sheathlike structure. J Biol Chem 288:7536–7548. doi: 10.1074/jbc.M112.439273 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Shneider MM, Buth SA, Ho BT, Basler M, Mekalanos JJ, Leiman PG. 2013. PAAR-repeat proteins sharpen and diversify the type VI secretion system spike. Nature 500:350–353. doi: 10.1038/nature12453 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Russell AB, LeRoux M, Hathazi K, Agnello DM, Ishikawa T, Wiggins PA, Wai SN, Mougous JD. 2013. Diverse type VI secretion phospholipases are functionally plastic antibacterial effectors. Nature 496:508–512. doi: 10.1038/nature12074 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Benz J, Reinstein J, Meinhart A. 2013. Structural insights into the effector – immunity system Tae4/Tai4 from Salmonella typhimurium. PLoS One 8:e67362. doi: 10.1371/journal.pone.0067362 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Ma LS, Hachani A, Lin JS, Filloux A, Lai EM. 2014. Agrobacterium tumefaciens deploys a superfamily of type VI secretion DNase effectors as weapons for interbacterial competition in planta. Cell Host Microbe 16:94–104. doi: 10.1016/j.chom.2014.06.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Coulthurst S. 2019. The type VI secretion system: a versatile bacterial weapon. Microbiology (Reading) 165:503–515. doi: 10.1099/mic.0.000789 [DOI] [PubMed] [Google Scholar]
- 24. Bai Q, Ma J, Zhang Z, Zhong X, Pan Z, Zhu Y, Zhang Y, Wu Z, Liu G, Yao H. 2020. YSIRK-G/S-directed translocation is required for Streptococcus suis to deliver diverse cell wall anchoring effectors contributing to bacterial pathogenicity. Virulence 11:1539–1556. doi: 10.1080/21505594.2020.1838740 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Whitney JC, Beck CM, Goo YA, Russell AB, Harding BN, De Leon JA, Cunningham DA, Tran BQ, Low DA, Goodlett DR, Hayes CS, Mougous JD. 2014. Genetically distinct pathways guide effector export through the type VI secretion system. Mol Microbiol 92:529–542. doi: 10.1111/mmi.12571 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Hersch SJ, Watanabe N, Stietz MS, Manera K, Kamal F, Burkinshaw B, Lam L, Pun A, Li M, Savchenko A, Dong TG. 2020. Envelope stress responses defend against type six secretion system attacks independently of immunity proteins. Nat Microbiol 5:706–714. doi: 10.1038/s41564-020-0672-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Hersch SJ, Manera K, Dong TG. 2020. Defending against the type six secretion system: beyond immunity genes. Cell Rep 33:108259. doi: 10.1016/j.celrep.2020.108259 [DOI] [PubMed] [Google Scholar]
- 28. Borenstein DB, Ringel P, Basler M, Wingreen NS. 2015. Established microbial colonies can survive type VI secretion assault. PLoS Comput Biol 11:e1004520. doi: 10.1371/journal.pcbi.1004520 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Granato ET, Smith WPJ, Foster KR. 2023. Collective protection against the type VI secretion system in bacteria. ISME J 17:1052–1062. doi: 10.1038/s41396-023-01401-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Lories B, Roberfroid S, Dieltjens L, De Coster D, Foster KR, Steenackers HP. 2020. Biofilm bacteria use stress responses to detect and respond to competitors. Curr Biol 30:1231–1244. doi: 10.1016/j.cub.2020.01.065 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Smith WPJ, Vettiger A, Winter J, Ryser T, Comstock LE, Basler M, Foster KR. 2020. The evolution of the type VI secretion system as a disintegration weapon. PLoS Biol 18:e3000720. doi: 10.1371/journal.pbio.3000720 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Nwoko E-SQA, Okeke IN. 2021. Bacteria autoaggregation: how and why bacteria stick together. Biochem Soc Trans 49:1147–1157. doi: 10.1042/BST20200718 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Lang C, Fruth A, Holland G, Laue M, Mühlen S, Dersch P, Flieger A. 2018. Novel type of pilus associated with a Shiga-toxigenic E. coli hybrid pathovar conveys aggregative adherence and bacterial virulence. Emerg Microbes Infect 7:203. doi: 10.1038/s41426-018-0209-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Allsopp LP, Bernal P, Nolan LM, Filloux A. 2020. Causalities of war: the connection between type VI secretion system and microbiota. Cell Microbiol 22:e13153. doi: 10.1111/cmi.13153 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Zhao W, Caro F, Robins W, Mekalanos JJ. 2018. Antagonism toward the intestinal microbiota and its effect on Vibrio cholerae virulence. Science 359:210–213. doi: 10.1126/science.aap8775 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Paradis-Bleau C, Kritikos G, Orlova K, Typas A, Bernhardt TG. 2014. A genome-wide screen for bacterial envelope biogenesis mutants identifies a novel factor involved in cell wall precursor metabolism. PLoS Genet 10:e1004056. doi: 10.1371/journal.pgen.1004056 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Côté J-P, French S, Gehrke SS, MacNair CR, Mangat CS, Bharat A, Brown ED. 2016. The genome-wide interaction network of nutrient stress genes in Escherichia coli. mBio 7:e01714-16. doi: 10.1128/mBio.01714-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Ben-Yaakov R, Salomon D. 2019. The regulatory network of Vibrio parahaemolyticus type VI secretion system 1. Environ Microbiol 21:2248–2260. doi: 10.1111/1462-2920.14594 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Healy B, Cooney S, O’Brien S, Iversen C, Whyte P, Nally J, Callanan JJ, Fanning S. 2010. Cronobacter (Enterobacter sakazakii): an opportunistic foodborne pathogen. Foodborne Pathog Dis 7:339–350. doi: 10.1089/fpd.2009.0379 [DOI] [PubMed] [Google Scholar]
- 40. Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H. 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2:2006. doi: 10.1038/msb4100050 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Wang M, Cao H, Wang Q, Xu T, Guo X, Liu B. 2018. The roles of two type VI secretion systems in Cronobacter sakazakii ATCC 12868. Front Microbiol 9:2499. doi: 10.3389/fmicb.2018.02499 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Hasman H, Schembri MA, Klemm P. 2000. Antigen 43 and type 1 fimbriae determine colony morphology of Escherichia coli K-12. J Bacteriol 182:1089–1095. doi: 10.1128/JB.182.4.1089-1095.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Kitagawa M, Ara T, Arifuzzaman M, Ioka-Nakamichi T, Inamoto E, Toyonaga H, Mori H. 2005. Complete set of ORF clones of Escherichia coli ASKA library (A complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res 12:291–299. doi: 10.1093/dnares/dsi012 [DOI] [PubMed] [Google Scholar]
- 44. Soto GE, Hultgren SJ. 1999. Bacterial adhesins: common themes and variations in architecture and assembly. J Bacteriol 181:1059–1071. doi: 10.1128/JB.181.4.1059-1071.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Eisenstein BI. 1981. Phase variation of type 1 fimbriae in Escherichia coli is under transcriptional control. Science 214:337–339. doi: 10.1126/science.6116279 [DOI] [PubMed] [Google Scholar]
- 46. Klemm P. 1986. Two regulatory fim genes, fimB and fimE, control the phase variation of type 1 fimbriae in Escherichia coli. EMBO J 5:1389–1393. doi: 10.1002/j.1460-2075.1986.tb04372.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Gally DL, Leathart J, Blomfield IC. 1996. Interaction of FimB and FimE with the fim switch that controls the phase variation of type 1 fimbriae in Escherichia coli K-12. Mol Microbiol 21:725–738. doi: 10.1046/j.1365-2958.1996.311388.x [DOI] [PubMed] [Google Scholar]
- 48. Bessaiah H, Anamalé C, Sung J, Dozois CM. 2021. What flips the switch? Signals and stress regulating extraintestinal pathogenic Escherichia coli type 1 fimbriae (pili). Microorganisms 10:5. doi: 10.3390/microorganisms10010005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Dorman CJ, Higgins CF. 1987. Fimbrial phase variation in Escherichia coli: dependence on integration host factor and homologies with other site-specific recombinases. J Bacteriol 169:3840–3843. doi: 10.1128/jb.169.8.3840-3843.1987 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Orndorff PE, Falkow S. 1984. Identification and characterization of a gene product that regulates type 1 piliation in Escherichia coli. J Bacteriol 160:61–66. doi: 10.1128/jb.160.1.61-66.1984 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Blomfield IC, McClain MS, Princ JA, Calie PJ, Eisenstein BI. 1991. Type 1 fimbriation and fimE mutants of Escherichia coli K-12. J Bacteriol 173:5298–5307. doi: 10.1128/jb.173.17.5298-5307.1991 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Thomas WE, Nilsson LM, Forero M, Sokurenko EV, Vogel V. 2004. Shear-dependent “stick-and-roll” adhesion of type 1 fimbriated Escherichia coli. Mol Microbiol 53:1545–1557. doi: 10.1111/j.1365-2958.2004.04226.x [DOI] [PubMed] [Google Scholar]
- 53. Brinton CC. 1965. The structure, function, synthesis and genetic control of bacterial pili and a molecular model for DNA and RNA transport in Gram negative bacteria. Trans NY Acad Sci 27:1003–1054. doi: 10.1111/j.2164-0947.1965.tb02342.x [DOI] [PubMed] [Google Scholar]
- 54. Krogfelt KA, Bergmans H, Klemm P. 1990. Direct evidence that the FimH protein is the mannose-specific adhesion of Escherichia coli type 1 fimbriae. Infect Immun 58:1995–1998. doi: 10.1128/iai.58.6.1995-1998.1990 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Ofek I, Mirelman D, Sharon N. 1977. Adherence of Escherichia coli to human mucosal cells mediated by mannose receptors. Nature 265:623–625. doi: 10.1038/265623a0 [DOI] [PubMed] [Google Scholar]
- 56. Higashi DL, Lee SW, Snyder A, Weyand NJ, Bakke A, So M. 2007. Dynamics of Neisseria gonorrhoeae attachment: microcolony development, cortical plaque formation, and cytoprotection. Infect Immun 75:4743–4753. doi: 10.1128/IAI.00687-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Kim K, Lee S, Ryu C-M. 2013. Interspecific bacterial sensing through airborne signals modulates locomotion and drug resistance. Nat Commun 4:1809. doi: 10.1038/ncomms2789 [DOI] [PubMed] [Google Scholar]
- 58. Lee J, Page R, García-Contreras R, Palermino J-M, Zhang X-S, Doshi O, Wood TK, Peti W. 2007. Structure and function of the Escherichia coli protein YmgB: a protein critical for biofilm formation and acid-resistance. J Mol Biol 373:11–26. doi: 10.1016/j.jmb.2007.07.037 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Rudzite M, Subramoni S, Endres RG, Filloux A. 2023. Effectiveness of Pseudomonas aeruginosa type VI secretion system relies on toxin potency and type IV pili-dependent interaction. PLoS Pathog 19:e1011428. doi: 10.1371/journal.ppat.1011428 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Lin L, Capozzoli R, Ferrand A, Plum M, Vettiger A, Basler M. 2022. Subcellular localization of type VI secretion system assembly in response to cell–cell contact. EMBO J 41:e108595. doi: 10.15252/embj.2021108595 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Magnet S, Bellais S, Dubost L, Fourgeaud M, Mainardi J-L, Petit-Frère S, Marie A, Mengin-Lecreulx D, Arthur M, Gutmann L. 2007. Identification of the L,D-transpeptidases responsible for attachment of the Braun lipoprotein to Escherichia coli peptidoglycan. J Bacteriol 189:3927–3931. doi: 10.1128/JB.00084-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62. Braun V, Wolff H. 1970. The murein-lipoprotein linkage in the cell wall of Escherichia coli. Eur J Biochem 14:387–391. doi: 10.1111/j.1432-1033.1970.tb00301.x [DOI] [PubMed] [Google Scholar]
- 63. Kaper JB, Nataro JP, Mobley HLT. 2004. Pathogenic Escherichia coli. Nat Rev Microbiol 2:123–140. doi: 10.1038/nrmicro818 [DOI] [PubMed] [Google Scholar]
- 64. Hannan TJ, Totsika M, Mansfield KJ, Moore KH, Schembri MA, Hultgren SJ, Stoever HL. 2012. Host-pathogen checkpoints and population bottlenecks in persistent and intracellular uropathogenic E. coli bladder infection. FEMS Microbiol Rev 36:616–648. doi: 10.1111/j.1574-6976.2012.00339.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Hsieh P-F, Lu Y-R, Lin T-L, Lai L-Y, Wang J-T. 2019. Klebsiella pneumoniae type VI secretion system contributes to bacterial competition, cell invasion, type-1 fimbriae expression, and in vivo colonization. J Infect Dis 219:637–647. doi: 10.1093/infdis/jiy534 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66. de Pace F, Nakazato G, Pacheco A, de Paiva JB, Sperandio V, da Silveira WD. 2010. The type VI secretion system plays a role in type 1 fimbria expression and pathogenesis of an avian pathogenic Escherichia coli strain. Infect Immun 78:4990–4998. doi: 10.1128/IAI.00531-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Duan Q, Nandre R, Zhou M, Zhu G. 2017. Type I fimbriae mediate in vitro adherence of porcine F18ac+ enterotoxigenic Escherichia coli (ETEC). Ann Microbiol 67:793–799. doi: 10.1007/s13213-017-1305-z [DOI] [Google Scholar]
- 68. Avalos Vizcarra I, Hosseini V, Kollmannsberger P, Meier S, Weber SS, Arnoldini M, Ackermann M, Vogel V. 2016. How type 1 fimbriae help Escherichia coli to evade extracellular antibiotics. Sci Rep 6:18109. doi: 10.1038/srep18109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69. Wang L, Keatch R, Zhao Q, Wright JA, Bryant CE, Redmann AL, Terentjev EM. 2018. Influence of type I fimbriae and fluid shear stress on bacterial behavior and multicellular architecture of early Escherichia coli biofilms at single-cell resolution. Appl Environ Microbiol 84:e02343-17. doi: 10.1128/AEM.02343-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70. Lasaro MA, Salinger N, Zhang J, Wang Y, Zhong Z, Goulian M, Zhu J. 2009. F1C fimbriae play an important role in biofilm formation and intestinal colonization by the Escherichia coli commensal strain Nissle 1917. Appl Environ Microbiol 75:246–251. doi: 10.1128/AEM.01144-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71. Liu Q, Zhu J, Liu N, Sun W, Yu B, Niu H, Liu D, Ouyang P, Ying H, Chen Y, Zhao G, Chen T. 2022. Type I fimbriae subunit fimA enhances Escherichia coli biofilm formation but affects L-threonine carbon distribution. Front Bioeng Biotechnol 10:904636. doi: 10.3389/fbioe.2022.904636 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72. Penesyan A, Paulsen IT, Kjelleberg S, Gillings MR. 2021. Three faces of biofilms: a microbial lifestyle, a nascent multicellular organism, and an incubator for diversity. NPJ Biofilms Microbiomes 7:80. doi: 10.1038/s41522-021-00251-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73. Sherlock O, Vejborg RM, Klemm P. 2005. The TibA adhesin/invasin from enterotoxigenic Escherichia coli is self recognizing and induces bacterial aggregation and biofilm formation. Infect Immun 73:1954–1963. doi: 10.1128/IAI.73.4.1954-1963.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74. Côté J-P, Mourez M. 2011. Structure-function analysis of the TibA self-associating autotransporter reveals a modular organization. Infect Immun 79:1826–1832. doi: 10.1128/IAI.01129-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75. Snyder JA, Haugen BJ, Lockatell CV, Maroncle N, Hagan EC, Johnson DE, Welch RA, Mobley HLT. 2005. Coordinate expression of fimbriae in uropathogenic Escherichia coli. Infect Immun 73:7588–7596. doi: 10.1128/IAI.73.11.7588-7596.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76. Schembri MA, Hjerrild L, Gjermansen M, Klemm P. 2003. Differential expression of the Escherichia coli autoaggregation factor antigen 43. J Bacteriol 185:2236–2242. doi: 10.1128/JB.185.7.2236-2242.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77. Souza DP, Oka GU, Alvarez-Martinez CE, Bisson-Filho AW, Dunger G, Hobeika L, Cavalcante NS, Alegria MC, Barbosa LRS, Salinas RK, Guzzo CR, Farah CS. 2015. Bacterial killing via a type IV secretion system. Nat Commun 6:6453. doi: 10.1038/ncomms7453 [DOI] [PubMed] [Google Scholar]
- 78. Aoki SK, Pamma R, Hernday AD, Bickham JE, Braaten BA, Low DA. 2005. Contact-dependent inhibition of growth in Escherichia coli. Science 309:1245–1248. doi: 10.1126/science.1115109 [DOI] [PubMed] [Google Scholar]
- 79. Smith P, Schuster M. 2019. Public goods and cheating in microbes. Curr Biol 29:R442–R447. doi: 10.1016/j.cub.2019.03.001 [DOI] [PubMed] [Google Scholar]
- 80. Chen C, Yang X, Shen X. 2019. Confirmed and potential roles of bacterial T6SSs in the intestinal ecosystem. Front Microbiol 10:1484. doi: 10.3389/fmicb.2019.01484 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81. Coyne MJ, Comstock LE. 2019. Type VI secretion systems and the gut microbiota. Microbiol Spectr 7. doi: 10.1128/microbiolspec.PSIB-0009-2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82. Pakbin B, Brück WM, Rossen JWA. 2021. Virulence factors of enteric pathogenic Escherichia coli: a review. Int J Mol Sci 22:9922. doi: 10.3390/ijms22189922 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640–6645. doi: 10.1073/pnas.120163297 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84. Sharan SK, Thomason LC, Kuznetsov SG, Court DL. 2009. Recombineering: a homologous recombination-based method of genetic engineering. Nat Protoc 4:206–223. doi: 10.1038/nprot.2008.227 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85. Datta S, Costantino N, Court DL. 2006. A set of recombineering plasmids for gram-negative bacteria. Gene 379:109–115. doi: 10.1016/j.gene.2006.04.018 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplemental figures and tables.





