Skip to main content
Avicenna Journal of Medical Biotechnology logoLink to Avicenna Journal of Medical Biotechnology
. 2024 Apr-Jun;16(2):130–135. doi: 10.18502/ajmb.v16i2.14864

CYP21A2 Gene Analysis in Southern Iranian CAH Patients and a Brief Review of the Mutation Spectrum

Danial Zangene 1, Hossein Moravej 2, Homa Ilkhanipoor 3, Anis Amirhakimi 3, Zhila Afshar 3, Mona Entezam 1,*
PMCID: PMC11007372  PMID: 38618509

Abstract

Background:

CYP21A2 gene mutations are responsible for more than 95% of Congenital Adrenal Hyperplasia (CAH) disorders with autosomal recessive inheritance. Most of these pathogenic mutations originate from the CYP21A1P, a neighboring pseudogene with 98% homology, due to unequal crossing over or gene conversion events. Mutation identification of the gene could be beneficial for accurate diagnosis and outcome prediction.

Methods:

Twelve unrelated patients with CAH diagnosis were recruited for genetic counseling. To ensure distinct amplification of the CYP21A2 gene rather than its pseudogene, the complete sequence of the gene was amplified through two overlapping fragments by specific primers. The entire sequences were screened by direct Sanger sequencing using new sequencing primers.

Results:

Only two pathogenic point mutations were identified. The c.293-13C>G, also known as In2G, and the c.955C>T mutations were found in 37.5 and 33.3% of alleles, respectively. One patient showed homozygous gene deletion. We also reviewed recent reports on CYP21A2 gene mutations in Iran.

Conclusion:

Evaluating the ethnicity-specific gene mutation data is significant for populations with diverse ethnic groups including the Iranian population. Although several common mutations have been reported as causative mutations among CAH patients, identifying only two common point mutations in Fars province would help prioritize exon sequencing and reduce the cost and time of genotyping.

Keywords: Adrenal hyperplasia, Congenital, Genotyping techniques, Mutation

Introduction

Congenital Adrenal Hyperplasia (CAH; MIM: 201910) is a group of common autosomal recessive disorders that interrupts normal steroidogenesis in the cortex of the adrenal glands 1. These steroid hormones, including cortisol, aldosterone, and adrenal androgens, develop from cholesterol in multistep enzymatic pathways 2.

21-hydroxylase deficiency (21-OHD) caused by CYP21A2 gene mutations, is responsible for more than 95% of CAH cases and has distinct clinical classifications 3. The classic form is a life-threatening condition, with a prevalence of 1 in every 16,000 newborns worldwide 4. The prevalence of the nonclassic form is 1 case per 600 persons; although it is generally asymptomatic, it may cause infertility in females 5.

In many laboratories, evaluating 17-hydroxyprogesterone (17-OHP) is the main approach to CAH diagnosis, and the accumulation of 17-OHP is interpreted as 21-OHD 6. Some studies suggest that replacing 17-OHP with 21-deoxycortisol as the CAH biomarker can reduce false-positive test results 7. However, based on the EMQN guideline, CYP21A2 genotyping is the best approach for 21-OHD testing and CAH diagnoses 8.

The CYP21A2 gene (MIM: 613815) which encodes the 21-hydroxylase enzyme and its pseudogene, CYP-21A1P, are located approximately 30 kb apart in the high-gene-density HLA III region on chromosome 6p21.3 9. The gene and pseudogene along with their neighbor genes are located in a genetic unit called RCCX unit 10. There are usually two RCCX modules on each chromosome; One RCCX module includes RP1, C4A, CYP21A1P, and TNX A, and the other RCCX includes PR2, C4B, CYP21A2, and TNX B genes, (Figure 1) 11,12. Furthermore, the CYP21A2 gene and its pseudogene show 98% homology in their sequence 13. These situations accelerate gene conversions and unequal crossing-over events in this region, resulting in transferring mutations of pseudogene to active CYP21A2, and even partial or complete deletion of the gene and neighboring regions 5.

Figure 1.

Figure 1.

Bimodular form (RP1C4ACYP21PXARP2C4BCYP21TNXB) of the RCCX region of chromosome 6p21.3. Cyp-21A2 gene and its pseudogene are shown in the gray boxes.

According to previous studies, a group of nine mutations is responsible for 21-OHD in the majority of CAH patients in the world; but the frequency of each mutation is different in every ethnicity 14,15. Thus, prioritizing mutations and related gene regions would make CYP21A2 genetic analysis more feasible and cheaper. Moreover, the CYP21A2 gene analysis is a valuable complement for predicting phenotype as well as confirming the diagnosis 16. Here, we evaluate the CYP21A2 variants in Iranian families from the south of the country. We also reviewed the prevalence and type of CYP21A2 mutations in different parts of the country based on previous studies.

Materials and Methods

Patients and sampling

Twelve families were referred for genetic analysis by endocrinologists. CAH diagnosis was confirmed clinically according to medical examination and para-clinical findings. Patients were selected from various regions in the south of Iran. Peripheral blood samples were collected from all patients and their parents. DNA was extracted using Parstous Kit (ca.t number A101201) according to the manufacturer’s instructions. The quality and quantity of DNA were assessed by the NanoDrop spectrophotometer (ND-1000) as well as agarose gel electrophoresis. The research project has been approved by the Ethics Committee of Shiraz University of Medical Sciences (Approval ID: IR.SUMS. REC.1400.378). Informed consent was obtained from all of the participants.

PCR amplification and the sanger sequencing

To ensure specific amplification of CYP21A2 gene rather than its pseudogene, the complete sequence of the gene was amplified through two overlapping fragments by specific primers. All coding sequences and exon-intron boundaries were screened by direct Sanger sequencing of fragments with an average size of 600 bp, using new sequencing primers. Table 1 shows the characteristics of primers.

Table 1.

Primer sequences for amplification of CYP21A2 gene

Name Sequence (5′ → 3′) Primer Tm°C Product size
Fragment-1-F TGGGCGGGTCGGTGGGAGGGT 71 1535
Fragment-1-R GCCTCAGCTGCATCTCCACGATGTGA 71
Fragment-2-F TACTCCCTCCTTTTCTGGCATGAC 65 2072
Fragment-2-R TTAAGCCTCAATCCTCTGCAGCG 65
Sequencing-EX2-R CCCAACCCCTGCTTTCTCCCCACC 72
Sequencing-EX3-F GCTCTTGGGGGGGCATATCTGGTGGG 74
Sequencing-EX9-R GCCTGGCTCCAGGAAGCGAT 74

All fragments were amplified in a final reaction volume of 25 μl using PCR Master Mix (Ampliqon, A140303) and 0.6 mol/L of each primer, along with 30 ng of DNA. The MgCL2 final concentration was 1.5 mmol/L. The fragment-1 PCR cycling parameters were as follows: initial denaturation of 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 70°C for 30 s, 72°C for 60 s, and a final extension of 72°C for 5 min. The fragment-2 cycling parameters were as follows: initial denaturation of 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 64°C for 30 s, 72°C for 90 s, and a final extension of 72°C for 7 min. All PCR products were controlled by Agarose gel electrophoresis (Figure 2).

Figure 2.

Figure 2.

Gel electrophoresis results. A) PCR products of the first fragment (exons 1–6). B) PCR products of the second fragment (exons 5–10).

Sanger Sequencing was provided by the Codon Biotech Company, Tehran, Iran. Gene deletion analysis was performed as previously described 17 by the Pishgam Biotech Company, Tehran, Iran, (www.pishgambc.com).

Data analysis

All sequences were aligned to the CYP21A2 sequence (NM_000500.9) and CYP21A1P sequence (Transcript: ENST00000342991.10) to ensure the specific amplification of the CYP21A2 gene. The potential effect and pathogenicity of observed single nucleotide variants were then evaluated using online tools including SIFT, Provean 18, PolyPhen2 19, Mutation Taster and Combined Annotation Dependent Depletion (CADD), as well as Clinvar and HGMD.

Furthermore, we performed a PubMed, Google Scholar, and Web of Science search to review the spectrum of reported CYP21A2 mutations in Iran, and extracted the frequencies of mutations from studies on 244 CAH-affected families.

Results

According to family history 10 (83%) of marriages were consanguineous, among them 70% were first-cousin. There was a positive history of CAH in only one pedigree. Patients comprised six girls and seven boys ranging from 1 to 10 years old from the south of the country. They had ambiguous genitalia (simple virilizing) at the delivery time or Salt-Wasting problems in the initial weeks or suffered from precocious puberty in childhood (Table 2).

Table 2.

clinical features and genotyping results of studied patients

Sex Age SW SV PP Consanguineous marriage Pathogenic variant 1 Pathogenic variant 2
1P F 9 - No c.955C>T c.955C>T
2P M 5 - - Yes c.293-13C>G c.293-13C>G
3P F 3 - Yes c.293-13C>G c.293-13C>G
4P F 4 - Yes c.293-13C>G c.293-13C>G
5P M 3 - - Yes c.955C>T c.955C>T
6P M 2 - - Yes Gene deletion Gene deletion
7P M 3 - - Yes c.293-13C>G c.955C>T
8P F 1 - Yes c.955C>T c.955C>T
9P M 2.5 - - Yes - -
10P M 9 - - Yes c.293-13C>G c.293-13C>G
11P F* 3 - - Yes - -
12P** M 1 - - No c.955C>T ?

P= Proband, F= Female, M= Male, SW= Salt-Wasting, SV= Simple virilizing, PP= Precocious puberty.

* Identical female twins.

** Adrenal Crisis was diagnosed.

Mutation analysis was performed for all individuals. Direct sequencing of the entire region of CYP21A2 gene by overlapping specific primers identified causative mutations in 17 out of 24 alleles. One patient (family 6P) showed whole gene deletion in a homozygous state. In one patient only a single mutation was identified, and in the two remaining families no mutation was detected. Figure 3 shows the chromatograms of identified mutations in each family. The c.293-13C>G-SNP code rs6467, also known as In2G- in the second intron was the most frequent photogenic variant with a frequency of 37.5%. After that, the c.955C>T -SNP code rs7755898, also known as Gln318*- in the 8th exon was the only pathogenic variant among the studied patients (Table 2). A total of 22 polymorphisms were also observed through the analysis.

Figure 3.

Figure 3.

Families’ pedigrees and images of founding mutations.

According to previous studies on 244 families with CAH disease in Iran, eight different DNA mutations as well as gene deletions and chimeras were responsible for CAH pathogenesis (Table 3). Most of the families were from Tehran; the capital city in the center of the country and consisted of different ethnicities.

Table 3.

characteristics of various mutations reported in previous studies

Mutation common name SNP ID Location mRNA position Protein position Number Frequency in Iran % Frequency in the world % (18)
del-CYP21A2 - - - - 30 9.5 % 21.5%
Chimera - - - - 26 8.3 %
P30L rs9378251 Exone 1 c.92C>T p.Pro31Leu 0 0 % 1.8%
In2G rs6467 Intron 2 c.293-13C>G - 53 16.8 % 25.3%
G110Δ8nt rs387906510 Exone 3 c.332_339del p.Gly111fs 22 7 % 1.8%
I172N rs1776095671 Exone 4 c.515T>A p.Ile172Asn 35 11.1 % 11.4%
Cluster E6 rs1554299737 c.710T>A p.Ile237Asn 2.1%
rs12530380 Exone 6 c.713T>A p.Val238Glu 26 8.3 %
rs6476 c.719T>A p.Met240Lys
V281L rs6471 Exone 7 c.844G>T p.Val282Leu 27 8.5 % 15.7%
Q318X rs7755898 Exone 8 c.955C>T p.Gln319Ter 59 18.7 % 4.2%
R356W rs7769409 Exone 8 c.1069C>T p.Arg357Trp 22 7 % 4.5%
Complex alleles * - - - - 15 4.8 % -
Total 315 100 % 7101
alleles alleles

* Each complex allele has a couple of mutations. These alleles are: I172N+V281L, I172N+I2G, I2G+V281L, I2G+G110Δ8nt, I2G+Q318X, V281L+Q318X, G110Δ8nt+Q318X, Cluster E6+Q318X, and R356X+P453S.

Discussion

Herein, we evaluated the entire CYP21A2 gene in 12 unrelated families from south of Iran and found two deleterious mutations, In2G and Q318X as the most frequent pathogenic mutations in the studied families. Each of these mutations has its specific mutagenesis mechanism and origin, as well as different distributions in any population. Although several common mutations have been reported as causative mutations among CAH patients, identifying only two common point mutations in Fars province is interesting. The patients were ethnically Persian and Lur. This could help prioritize exon sequencing and reduce the cost and time of genotyping.

Until 2022 several studies have performed genotyping approaches to investigate CYP21A2 alleles in Iranian CAH patients. According to previous studies reviewed in table 3, In2G and Q318X are the most reported mutations in Iranian families 2027. Our findings coincide with previous studies. Besides, I172N and In2G are among the most prevalent mutations which cause the classic form of CAH worldwide, and V281L mutation is the most common mutation causing the nonclassic form 20,28,30.

The c.293-13A/C>G (In2G) mutation makes an adverse splicing site and disrupts the CYP21A2 premRNA 31,32. In this case, the patient 21-OH enzyme will have only 0–1% residual function, and the classic form of CAH disease will emerge 33. Overall, the In2G allele is the world’s most frequent pathogenic point mutation in the CYP21A2 gene. Studies on the origin of this mutation suggest that the In2G mutagenesis can spontaneously occur due to conversion events; so the frequency of this mutation is nearly the same in every population 34,35. We found In2G mutation in 9/24 studied CYP21A2 alleles (37%).

The c.955C>T (Q318X) nonsense substitution turns the glutamine codon (CAG) into a termination codon (TAG). This mutation leads to a completely nonfunctional 21-OH enzyme, and the patient manifests the classic symptoms of the CAH disease 36. HLA haplo-typing and segregation studies reveal the old origin of this mutation. So, the frequency of this mutation can be very diverse in every population. Moreover, it is suggested as a founder mutation in some populations 35,37. Nevertheless, this pathogenic variant is rare in many countries. In the USA and middle Europe, the frequency of this mutation is only 2.6 and 3.7%, respectively among all CYP21A2 pathogenic variants 38. In Iran however, the Q318X is one of the main reasons for the CYP21A2 gene corruption and CAH disease. We found the Q318X mutation in 7/24 studied CYP21A2 alleles (29%).

Iran had a specific geographical location throughout history and comprises various ethnic groups, suggesting high genetic heterogeneity. However, founder mutations and other factors mainly consanguineous marriage result in homogeneity in some genetic loci and mutations 39,40. Albeit, more studies are needed to better clarify the mutation origin.

Conclusion

Evaluating the ethnicity-specific gene mutation data is significant for populations with diverse ethnic groups including the Iranian population. Although the study is limited by the small number of patients, according to our findings we recommended to sequence exons 3 and 8 (In2G and Q318X mutations) as the first step for CYP21A2 genotyping.

Acknowledgement

This manuscript was supported by a grant from Shiraz University of Medical Sciences under the Agreement No. 22941. The ethical code of the research project by the Ethics Committee of Shiraz University of Medical Sciences was: IR. SUMS.REC.1400.378. We would like to express our deepest gratitude to Dr. Saman Nahid and Farzanegan Laboratory for doing biochemical tests and blood sampling as well as Pishgam Biothech Company for confirming deleted alleles. We are also, very thankful to all the patients and their families for their kind collaboration.

Footnotes

Conflict of Interest

The authors declare no conflict of interest for this article.

References

  • 1.Carvalho B, Marques CJ, Santos-Silva R, Fontoura M, Carvalho D, Carvalho F. Congenital adrenal hyperplasia due to 21-hydroxylase deficiency: An update on genetic analysis of CYP21A2 gene. Exp Clin Endocrinol Diabetes 2021. Jul;129(7):477–81. [DOI] [PubMed] [Google Scholar]
  • 2.Kanczkowski W, Sue M, Bornstein SR. The adrenal gland microenvironment in health, disease and during regeneration. Hormones (Athens) 2017;16(3):251–65. [DOI] [PubMed] [Google Scholar]
  • 3.Espinosa Reyes TM, Collazo Mesa T, Lantigua Cruz PA, Agramonte Machado A, Domínguez Alonso E, Falhammar H. Molecular diagnosis of patients with congenital adrenal hyperplasia due to 21-hydroxylase deficiency. BMC Endocr Disord. 2020;20(1):165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Turcu AF, Auchus RJ. The next 150 years of congenital adrenal hyperplasia. J Steroid Biochem Mol Biol Sep 1; 153:63–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Dumić M. [Congenital adrenal hyperplasia due to 21-hydroxylase enzyme deficiency]. Lijec Vjesn 1996. Mar: 118 Suppl 1: 13–6. Croatian. [PubMed] [Google Scholar]
  • 6.Held PK, Bird IM, Heather NL. Newborn screening for congenital adrenal hyperplasia: Review of factors affecting screening accuracy. Int J Neonatal Screen 2020;6(3):67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Miller WL. Congenital adrenal hyperplasia: Time to replace 17OHP with 21-deoxycortisol. Horm Res Paediatr 2019;91(6):416–20. [DOI] [PubMed] [Google Scholar]
  • 8.Baumgartner-Parzer S, Witsch-Baumgartner M, Hoeppner W. EMQN best practice guidelines for molecular genetic testing and reporting of 21-hydroxylase deficiency. Eur J Hum Genet 2020;28(10):1341–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Xu Z, Chen W, Merke DP, McDonnell NB. Comprehensive mutation analysis of the CYP21A2 gene: An efficient multistep approach to the molecular diagnosis of congenital adrenal hyperplasia. J Mol Diagn 2013. Nov; 15(6):745–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gitelman SE, Bristow J, Miller WL. Mechanism and consequences of the duplication of the human C4/P450c21/gene X locus. Mol Cell Biol 1992;12(5):2124–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yang Z, Mendoza AR, Welch TR, Zipf WB, Yung Yu C. Modular variations of the human major histocompatibility complex class III genes for serine/threonine kinase RP, complement component C4, steroid 21-hydroxylase CYP21, and tenascin TNX (the RCCX module): A mechanism for gene deletions and disease associat. J Biol Chem 1999;274(17):12147–56. [DOI] [PubMed] [Google Scholar]
  • 12.Lee HH. The chimeric CYP21P/CYP21 gene and 21-hydroxylase deficiency. J Hum Genet 2004;49(2):65–72. [DOI] [PubMed] [Google Scholar]
  • 13.Higashi Y, Yoshioka H, Yamane M, Gotoht O, Fujm-Kuriyama Y. Complete nucleotide sequence of two steroid 21-hydroxylase genes tandemly arranged in human chromosome: A pseudogene and a genuine gene. Proc Natl Acad Sci USA 1986. May;83(9):2841–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Falhammar H, Nordenström A. Nonclassic congenital adrenal hyperplasia due to 21-hydroxylase deficiency: clinical presentation, diagnosis, treatment, and outcome. Endocrine 2015. Sep;50(1):32–50. [DOI] [PubMed] [Google Scholar]
  • 15.Ghizzoni L, Cappa M, Chrousos G, Loche S, Maghnie M. Molecular Genetics of 21-Hydroxylase Deficiency. Vol. 20, Endocr Dev. Basel, Karger. 2011. P. 80–7. [DOI] [PubMed] [Google Scholar]
  • 16.Speiser PW, Arlt W, Auchus RJ, Baskin LS, Conway GS, Merke DP, et al. Congenital adrenal hyperplasia due to steroid 21-hydroxylase deficiency: An endocrine society* clinical practice guideline. J Clin Endocrinol Metab 2018. Nov 1;103(11):4043–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lee HH, Lee YJ, Lin CY. PCR-based detection of the CYP21 deletion and TNXA/TNXB hybrid in the RCCX module. Genomics 2004. May 1;83(5):944–50. [DOI] [PubMed] [Google Scholar]
  • 18.Choi Y, Sims GE, Murphy S, Miller JR, Chan AP. Predicting the functional effect of amino acid substitutions and indels. PLoS One 2012. Oct 8;7(10):e46688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, et al. A method and server for predicting damaging missense mutations. Nat Methods 2010. Apr;7(4):248–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Vakili R, Baradaran-Heravi A, Barid-Fatehi B, Gholamin M, Ghaemi N, Abbaszadegan MR. Molecular analysis of the CYP21 gene and prenatal diagnosis in families with 21-hydroxylase deficiency in Northeastern Iran. Horm Res 2005. Apr;63(3):119–24. [DOI] [PubMed] [Google Scholar]
  • 21.Ramazani A, Kahrizi K, Razaghiazar M, Mahdieh N, Koppens P. The frequency of eight common point mutations in CYP21 gene in Iranian patients with congenital adrenal hyperplasia. IBJ 2008;12(1): 49–53. [PubMed] [Google Scholar]
  • 22.Rabbani B, Akbari MT, Mahdieh N, Zaridust E, Ashtiani MTH, Lee HH, et al. Homozygous complete deletion of CYP21A2 causes a simple virilizing phenotype in an Azeri child. Asian Biomedicine 2011. Dec;5(6):889–92. [Google Scholar]
  • 23.Rabbani B, Mahdieh N, Ashtiani MTH, Larijani B, Akbari MT, New M, et al. Mutation analysis of the CYP-21A2 gene in the Iranian population. Genet Test Mol Biomarkers 2012. Feb 1;16(2):82–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Forouzanfar K, Seifi M, Hashemi-Gorji F, Karimi N, Estiar MA, Karimoei M, et al. Mutation analysis of the CYP21A2 gene in congenital adrenal hyperplasia. Cell Mol Biol 2015;61(4):51–5. [PubMed] [Google Scholar]
  • 25.Kolahdouz M, Hashemipour M, Khanahmad H, Rabbani B, Salehi M, Rabbani A, et al. Mutation detection of CYP21A2 gene in nonclassical congenital adrenal hyperplasia patients with premature pubarche. Adv Biomed Res 2016;5(1):33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kollahi NA, Rohani F, Baghbani-Arani F, Shojaei A. Complex alleles of cyp21a2 are the most frequent causes of congenital adrenal hyperplasia in Iranian population. Iran J Pediatr 2019. Dec 1;29(6). [Google Scholar]
  • 27.Soveizi M, Mahdieh N, Setoodeh A, Sayarifard F, Abbasi F, Bose HS, et al. P.Gln318X and p.Val281Leu as the Major Variants of CYP21A2 Gene in Children with Idiopathic Premature Pubarche. Int J Endocrinol 2020; 2020:4329791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Claahsen - van der Grinten HL, Speiser PW, Ahmed SF, Arlt W, Auchus RJ, Falhammar H, et al. Congenital adrenal hyperplasia-current insights in pathophysiology, diagnostics, and management. Endocr Rev 2022. Jan 12;43(1):91–159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Narasimhan ML, Khattab A. Genetics of congenital adrenal hyperplasia and genotype-phenotype correlation. Fertil Steril 2019;111(1):24–9. [DOI] [PubMed] [Google Scholar]
  • 30.Witchel SF, Azziz R. Nonclassic congenital adrenal hyperplasia. Int J Pediatr Endocrinol 2010;2010:625105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Higashi Y, Tanaet A, Inoue H, Hiromasa T, Fujii-Kuriyama Y. Aberrant splicing and missense mutations cause steroid 21-hydroxylase [P-450(C21)] deficiency in humans: Possible gene conversion products. Proc Natl Acad Sci USA 1988. Oct;85(20):7486–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lee HH, Chang SF, Tsai FJ, Tsai LP, Lin CY. Mutation of IVS2-12A/C>G in combination with 707-714del-GAGACTAC in the CYP21 gene is caused by deletion of the C4-CYP21 repeat module with steroid 21-hydro-xylase deficiency. J Clin Endocrinol Metab 2003. Jun;88(6):2726–9. [DOI] [PubMed] [Google Scholar]
  • 33.Riedl S, Röhl FW, Bonfig W, Brämswig J, Richter-Unruh A, Fricke-Otto S, et al. Genotype/phenotype correlations in 538 congenital adrenal hyperplasia patients from Germany and Austria: Discordances in milder genotypes and in screened versus prescreening patients. Endocr Connect 2019;8(2):86–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tajima T, Fujieda K, Fujii-Kuriyama Y. de novo mutation causes steroid 21-hydroxylase deficiency in one family of HLA-identical affected and unaffected siblings. J Clin Endocrinol Metab 1993. Jul;77(1):86–9. [DOI] [PubMed] [Google Scholar]
  • 35.Ezquieta B, Cueva E, Oyarzábal M, Oliver A, Varela JM, Jariego C. Gene conversion (655G splicing mutation) and the founder effect (Gln318Stop) contribute to the most frequent severe point mutations in congenital adrenal hyperplasia (21-hydroxylase deficiency) in the Spanish population. Clin Genet 2002. Aug;62(2):181–8. [DOI] [PubMed] [Google Scholar]
  • 36.Globerman H, Amor M, Parker KL, New MI, White PC. Nonsense mutation causing steroid 21-hydroxylase deficiency. J Clin Invest 1988;82(1):139–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kleinle S, Lang R, Fischer GF, Vierhapper H, Wald-hauser F, Födinger M, et al. Duplications of the functional CYP21A2 gene are primarily restricted to Q318X alleles: Evidence for a founder effect. J Clin Endocrinol Metab 2009;94(10):3954–8. [DOI] [PubMed] [Google Scholar]
  • 38.Prado MJ, de Castro SM, Kopacek C, de Mello MP, Rispoli T, Grandi T, et al. Development of CYP21A2 Genotyping Assay for the Diagnosis of Congenital Adrenal Hyperplasia. Mol Diagn Ther 2017;21(6):663–75. [DOI] [PubMed] [Google Scholar]
  • 39.Saadat M, Ansari-Lari M, Farhud DD. Consanguineous marriage in Iran. Ann Hum Biol 2004;31(2):263–9. [DOI] [PubMed] [Google Scholar]
  • 40.Koohiyan M, Azadegan-Dehkordi F, Koohian F, Hashemzadeh-Chaleshtori M. Genetics of hearing loss in north Iran population: An update of spectrum and frequency of GJB2 mutations J Audiol Otol 2019. Oct;23(4): 175–180. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Avicenna Journal of Medical Biotechnology are provided here courtesy of Avicenna Research Institute

RESOURCES