Identification, Characterization, Cloning, and Cross-Reactivity of Zan b 2, a Novel Pepper Allergen of 11S Legumin

Abstract

Protein from Sichuan peppers can elicit mild to severe allergic reactions. However, little is known about their allergenic proteins. We aimed to isolate, identify, clone, and characterize Sichuan pepper allergens and to determine its allergenicity and cross-reactivities. Sichuan pepper seed proteins were extracted and then analyzed by SDS-PAGE. Western blotting was performed with sera from Sichuan pepper-allergic individuals. Proteins of interest were purified using hydrophobic interaction chromatography and gel filtration and further analyzed by analytical ultracentrifugation, circular dichroism spectroscopy, and mass spectrometry (MS). Their coding region was amplified in the genome. IgE reactivity and cross-reactivity of allergens were evaluated by dot blot, enzyme-linked immunosorbent assay (ELISA), and competitive ELISA. Western blot showed IgE binding to a 55 kDa protein. This protein was homologous to the citrus proteins and has high stability and a sheet structure. Four DNA sequences were cloned. Six patients’ sera (60%) showed specific IgE reactivity to this purified 11S protein, which was proved to have cross-reactivation with extracts of cashew nuts, pistachios, and citrus seeds. A novel allergen in Sichuan pepper seeds, Zan b 2, which belongs to the 11S globulin family, was isolated and identified. Its cross-reactivity with cashew nuts, pistachios, and citrus seeds was demonstrated.

1. Introduction

Sichuan pepper (Zanthoxylum bungeanum Maxim.), Hua Jiao in Chinese, which is primarily grown in China, is an agricultural crop with nearly three thousand years of cultivation and application history.¹ There are nearly 250 varieties of Z. bungeanum that have been widely distributed in Asian countries.² Because of its edibleness and medicinal value, Z. bungeanum is widely consumed worldwide. As a traditional herbal medicine, Sichuan pepper is widely used to treat various diseases, especially stomachache, diarrhea, dyspepsia, and toothache.² Sichuan pepper is often hidden in various dishes, pastries, snacks, and instant foods, making it easy to consume and causing food allergies accidentally.

Our team’s preliminary research^3,4 found that Sichuan pepper is a potential source of food allergens and can be life-threatening for patients. Sichuan pepper seeds can induce mild to severe allergic reactions. In our previous research, there were 15 Sichuan pepper-allergic patients presented with rapid-onset anaphylactic reactions, which occurred within 30 min of Sichuan pepper intake, and 14 of them were diagnosed as anaphylaxis, of which 5 had anaphylactic shock (with loss of consciousness in 2 cases). The allergic symptoms involve skin redness, swelling and plaques, abdominal pain, laryngeal edema, dyspnea, anaphylactic shock, and other typical allergic reactions. Individuals who are allergic to Sichuan peppers often have allergic reactions to multiple foods, the most common of which are cashew nuts, pistachios, and citrus.⁵

Storage proteins constitute the major relevant protein fraction of plant foods. Many members of the seed storage proteins were identified as allergens.⁶ 11S legumin is an important allergen in this family, and approximately 13.2% of atopic children were allergic to 11S globulins.⁷ The 11S legumin is usually a hexameric protein composed of six monomeric subunits (around 50–60 kDa) with a hydrophobic signal peptide that was removed post-translationally. Each monomer is formed by a disulfide bond between an acidic (∼30–40 kDa) and an alkaline (∼20–30 kDa) subunit. Several 11S legumins, including those from almond (amandin, Pru du 6),⁸ cashew (Ana o 2),⁹ hazelnut (Cor a 9),¹⁰ pistachio (Pis v 2),¹¹ pecan (Car i 4),¹² walnut (Jug r 4),¹³ and peanut (Ara h 3),¹⁴ are characterized as allergens. However, whether the 11S protein from Sichuan peppers is a main allergen component is still unexplored. Our group has already isolated a 2S albumin allergen, Zan b 1.01, which is around 10 kDa from Sichuan peppers.¹⁵ In this study, we aimed to isolate, identify, clone, and characterize Sichuan pepper 11S protein and to determine its allergenicity and cross-reactivities. It is hoped that this will contribute to the clinical development of better diagnostic and therapeutic methods.

2. Materials and Methods

2.1. Patients and Samples

Sichuan pepper-allergic/sensitive subjects were recruited by the Allergy Department of the Peking Union Medical College Hospital (PUMCH). Skin prick tests (SPT) were performed with ground-dried Sichuan pepper seeds (Allergen Manufacturing and Research Center, PUMCH, Beijing, China). Total and specific IgE (sIgE) levels were quantified by ImmunoCAP (Thermo Fisher Scientific, Uppsala, Sweden). SPT and sIgE results were considered positive when the reaction wheal diameter was ≥3 mm and sIgE levels were ≥0.35 kUA/L, respectively. Diagnosis of Sichuan pepper allergy was based on a convincing history of allergic reactions to a single ingestion of Sichuan peppers, and Sichuan pepper-specific IgE and/or SPT results were positive. Healthy subjects were recruited to be used as negative controls. Serum samples were collected from each participant, and the sera were frozen at −80 °C until use. The study was approved by the Ethical Committee of Peking Union Medical College Hospital (NO.JS-3443).

2.2. Preparation of the Protein Extracts

Raw Sichuan pepper seeds (Piperis Dahongpao) were purchased from Sichuan Hanyuan, China. Twenty grams of shelled Sichuan pepper seeds were crushed to obtain finely ground flour. The crushed flour was defatted by stirring in 200 mL hexane for 4 h and subjected to centrifugation at 14,000 rpm for 20 min at 25 °C. Soluble proteins were extracted in 200 mL of buffer (1 M NaCl, 20 mM Tris-HCl, pH 8.0)¹⁶ and were then filtered through a 0.45 μm pore-size filter, collected, and stored at −20 °C for further use. Extracts of citrus, pistachio, cashew seeds, and peanuts were prepared using the same method. Protein concentrations were determined by the Bradford Protein Assay Kit (Sangon Biotech, China) according to the manufacturer’s protocol.¹⁶

2.3. SDS-PAGE Analysis

Sichuan pepper seed extract was mixed with SDS sample buffer (nonreducing SDS sample buffer: 250 mM Tris pH 6.8, 2% SDS, 25% glycerol, 20 mM DTT, 0.01% bromophenol blue; reducing SDS sample buffer: nonreducing SDS sample buffer containing 0.5 M 2-Mercaptoethanol) at a ratio of 5:1, and then heated at 100 °C for 8 min. Molecular weight markers (Bio-Rad, Hercules, CA) were used to estimate sample MW. Electrophoresis was carried out by using 4–15% gradient sodium dodecyl sulfate polyacrylamide gels, and the gels were run in a Tris-MES-SDS running buffer (50 mM Tris, 50 mM MES, 0.1% SDS, and 1 mM EDTA). After electrophoresis, the gels were stained in Coomassie blue staining buffer (0.1% Coomassie brilliant blue R250, 40% ethanol, and 10% acetic acid) and imaged with the Clinx GenoSens gel imaging system (Clinx Science Instruments Co., Ltd., Genosens 1880, Shanghai, China).

2.4. Western Blotting Analysis

Proteins were separated by SDS-PAGE: protein samples were loaded onto 4–20% gradient sodium dodecyl sulfate polyacrylamide preformed gels (FuturePAGE, ET12420Gel, Nanjing ACE Biotechnology Co., Ltd., Nanjing, China), and the gels were run in a MOPS-SDS running buffer (FuturePAGE, F00004Gel, Nanjing ACE Biotechnology Co., Ltd., Nanjing, China). Western blot was performed by transferring the proteins from the gels to a 0.45 μm poly(vinylidene difluoride) (PVDF) membrane (Millipore, Bedford, MA). PageRuler prestained protein ladder (Thermo Fisher Scientific Baltics UAB, Vilnius, Lithuania) was used as a protein marker. The PVDF membrane was then blocked with QuickBlock blocking buffer for Western Blot (Beyotime, Songjiang District, Shanghai) on a shaker at room temperature for 30 min. Subsequently, the membrane was incubated with 1:20 diluted sera (QuickBlock primary antibody dilution buffer for Western Blot, Beyotime, Songjiang District, Shanghai) at 4 °C overnight. After washing three times, the membrane was incubated with a 1:500-diluted HRP-conjugated antihuman IgE (epsilon) antibody (Sigma, St. Louis, MO). After that, the optical signals were visualized by an ECL substrate (Beijing Aoqiang Biotechnology CO., Ltd., Beijing, China) using a ChemiDoc Touch chemiluminescence imaging system (Bio-Rad, Hercules, CA).

2.5. Purification of Protein from Sichuan Pepper Seed Extract

The extracted proteins of Sichuan pepper seeds were loaded onto a 120 mL Superdex 200 column (GE Healthcare) pre-equilibrated and eluted with buffer A (200 mM NaCl and 20 mM Tris-HCl, pH 8.0). The major protein peak was pooled, and ammonium sulfate powder was added to the final concentration of 1.5 M. The sample was then loaded onto a 5 mL Phenyl Sepharose hydrophobic interaction column (GE Healthcare) pre-equilibrated with buffer B (1.5 M ammonium sulfate, 20 mM Tris–HCl, pH 8.0). The bound protein was eluted with an 80 mL linear gradient of (1.5–0 M) ammonium sulfate by mixing buffer B and buffer C (20 mM Tris–HCl, pH 8.0). The proteins were then collected and loaded onto a 24 mL Superdex 200 10/300 GL column (GE Healthcare) pre-equilibrated with buffer A. The gel filtration column was calibrated with a protein standard kit (Bio-Rad, Hercules, CA).

2.6. Liquid Chromatography Multistage Mass Spectrometry

The protein extracts were separated by SDS-PAGE and analyzed by Western blotting. The 55 kDa IgE-binding protein was then excised from the gel. The gel was sliced into 1 mm² cubes and decolored with 1 mL of 30% acetonitrile 50 mM NH₄HCO₃ several times until the gel was colorless and transparent. Then, it was reduced with 500 l of 100 mM DTT at 56 °C for 15 min. After removing the DTT, 500 μL of 30 mM iodoacetamide was added in the dark at room temperature for 15 min. Next, 1 mL of 50 mM NH₄HCO₃ was added to each tube and vortexed for 30 s to remove the liquid and then dried by centrifugation concentrator. Next, the gel was cleavaged in 200 μL of 50 mM NH₄HCO₃ solution containing 0.2 μg trypsin at 37 °C for 7 h. After that, 200 μL of 50 mM NH₄HCO₃ solution containing 0.1 μg trypsin was added to each tube at 37 °C for 12 h. Tryptic peptide mixtures were first extracted with 200 μL of 60% acetonitrile/5% trifluoroacetic acid solution twice and then with the same volume of 100% acetonitrile.

The extracted solutions were mixed and lyophilized before MS analysis. Peptide samples were detected on a Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific, Pittsburgh, PA) connected with an EASY-nLC 1200 instrument (Thermo Fisher Scientific, Massachusetts). The PEAKS Studio X+ (Thermo Fisher Scientific, Pittsburgh, PA) was used to analyze the raw file of mass spectrometry results to obtain the amino acid sequences of the peptides. The data acquisition mode was data-dependent analysis (DDA). Precolumns with 100 μm × 2 cm C18 (2 μm, 100 Å) and analytical columns with 75 μm id × 150 mm (2 μm, 100 Å) were used. Mobile phase A was deionized water/0.1% FA, mobile phase B was 80% ACN/0.1% FA, and the flow rate was 300 nL/min. The elution gradient was 60 min in total. The positive ion scan mode was used. For MS1, the mass scan range was 350–2000 Da. The automatic gain control (AGC) was set to 1e6 with a resolution of 70,000 and a maximum ion injection time of 50 ms. For MS2, the AGC target value was set to 1e5 with a resolution of 17,500 and the maximum ion injection time of 50 ms. The top 20 most intensive precursor ions were selected for the MS/MS analysis. The normalized collision energy value was set as 27.

2.7. Analytical Ultracentrifugation

The sedimentation velocity (SV) experiments were carried out according to the method of Ni et al.,¹⁷ using a Proteomelab XL-A analytical ultracentrifuge (Beckman Coulter) with a four-hole An-60 Ti analytical rotor. An aliquot of 410 μL of reference buffer and 400 μL of protein solution (0.5 mg/mL) was loaded into a 12 mm double-sector cell and span at a speed of 35,000 rpm, and the absorbance at different radial positions was monitored at a wavelength of 280 nm at 20 °C. The data during the sedimentation processes were obtained and analyzed by SEDFIT using the c(s) model, while the viscosity and density of the buffer solution were calculated by SEDNTERP.

2.8. Measurement of Specific IgE by Dot Blot, ELISA, and Competitive ELISA Test

For dot blot, the purified protein (1 μg/μL) from Sichuan pepper seeds was blotted to BioTrace NT nitrocellulose membranes (Pall Corporation), followed by air-drying for 30 min at room temperature. After blocking with 10% skim milk in TBST for 2 h, the membranes were incubated with serum samples (1:50 dilution) at 4 °C overnight with gentle shaking. Then, the membranes were washed three times with TBST before incubation with Goat antihuman IgE antibodies (Abcam, Ab9159, Shanghai, China) (diluted 1:1000). The membranes were washed and incubated with HRP-donkey antigoat IgG antibodies (Abcam, Ab97110, Shanghai, China) (diluted 1:4000) for 1 h at room temperature. The membranes were visualized by an enhanced ECL chemiluminescence substrate (ABP Biosciences) using a ChemiDoc Touch chemiluminescent imaging system (Bio-Rad, Hercules, CA).

For Immunoreactivity of sera with the purified protein from Sichuan pepper seeds by enzyme-linked immunosorbent assay (ELISA), A 96-well microplate (Thermo Fisher Scientific, Pittsburgh, PA) was precoated with purified proteins (50 μg/mL) in 50 mM NaHCO₃ (pH 9.6) at 4 °C overnight. Then, the plate was blocked with 10% skim milk in PBST (PBS containing 0.1% Tween-20) at room temperature for 2 h. Serum samples (diluted 1:50) were added to the plate and incubated at room temperature for 2 h. After washing 3 times with PBST, goat antihuman IgE antibodies (Abcam, Ab9159, Shanghai, China) (diluted 1:1,000) were added for 1 h incubation. Then, 1:4000 diluted HRP-donkey antigoat IgG antibodies (Abcam, Ab97110, Shanghai, China) were added for another incubation of 1 h. After that, the color was developed using a tetramethylbenzidine (TMB) substrate (Beyotime, Shanghai, China). Subsequently, the reaction was stopped by adding 50 μL of 1 M H2SO4, and the absorbance was measured at 450 nm using a SynergyTM H1 microplate reader (Biotek). The cutoff values were presented as 3 times of mean optical density (OD) values of negative controls. The IgE reactivity tests in ELISA for crude extracts of cashew nuts, pistachios, orange seeds, and peanuts were performed in the same steps described above.

ELISA IgE-inhibition tests were performed to analyze the cross-reactivity between the purified protein from Sichuan pepper seeds and crude extracts of cashew nuts, pistachios, orange seeds, and peanuts. A 4 μL amount of human serum (diluted 1:50) was premixed with the same volume of crude extracts (1 mg/mL) of cashew nuts, pistachios, or orange seeds for 1 h at room temperature. The mixed sera were then added to the 96-well microplates, which had been precoated with purified proteins (50 μg/mL). The remaining steps are the same as those previously described in the ELISA analysis section. The inhibition percentage was calculated by (1–absorbance with inhibitors/absorbance without inhibitors) × 100.

2.9. Genomic Cloning of the Purified Proteins from Sichuan Pepper Seeds

The genes of purified protein from Sichuan pepper seeds were extracted using a Hipure tissue DNA kit (Magen, Guangdong, China) according to the manufacturer’s protocol. Briefly, 50 mg Sichuan pepper seeds were ground in liquid nitrogen and digested overnight with Buffer ATL, which is a component of the Hipure tissue DNA kit, before 250 μL of absolute alcohol was added to the sample and loaded onto a HiPure gDNA Mini column. The genomic DNA was eluted with 100 μL of Buffer AE (Magen, Guangdong, China). Forward primer CDS1-F (GAAGCTGGCGTCACAGAGTTCTG) and reverse primer CDS4-R (GTTCTGGATAACGTCCAACGGCAGC) were designed based on master protein accession (Uniprot: V4S993) were obtained by mass spectrometry. Blunt-end PCR products were ligated into a pUCm-T vector (Sangon Biotech) after A-Tailing. Positive clones were screened on X-gal (Sango, B541006, Shanghai, China) plates and sequenced in both directions.

2.10. Circular Dichroism Spectroscopy

The secondary structures and thermal stability of purified proteins from Sichuan pepper seeds were determined by using a Chirascan circular dichroism spectrometer (Applied Photophysics, Ltd., Surrey, U.K.). Proteins were displaced into Tris buffer by 24 mL of molecular sieve purification and diluted to 0.18 mg/mL. To reduce the sample, dithiothreitol (DTT) was added to a 2 mM final concentration. 400 μL of protein was added to the cuvette for each scan. The scanning wavelength range was set to 190–250 nm, and the temperature was set to 25 °C before measuring the protein samples. The air was scanned directly to detect the stability of the instrument first (the line in the range of 0.1 was normal), and then, the Tris buffer was scanned twice as the background control. The target protein was scanned three times, and the average value was used to fit the secondary structure curve.

3. Results

3.1. Clinical Characteristics of the Study Subjects

A total of 10 patients were recruited in this study. The mean age was 51.4 years (range 31–62 years). Ten patients were allergic or sensitive to Sichuan pepper with or without other allergic diseases (Table 1). Nine patients had allergic symptoms when eating Sichuan peppers. Of these, seven patients have experienced anaphylaxis for Sichuan peppers, and two patients (P4, P6) had symptoms of urticaria or oral allergic reactions. One subject (P10), whose sIgE of Sichuan pepper seeds was positive but without allergic symptoms, is sensitive to Sichuan peppers. Moreover, nine Sichuan pepper-allergic patients were all found to have allergic symptoms to citrus, cashew seed, or pistachios. All ten patients had positive results for Rf602 with sIgE >0.35 KUA/L, and nine of them had positive sIgE results for citrus, cashew seed, or pistachios. SPT results and sIgE levels of f202, f203, and f302 are listed in Table 1. Nine healthy subjects with no allergic symptoms and showed total IgE <60 KU/L, and sIgE of the phadiatop, fx5, and mx2 <0.35 kUA/L were used as negative controls.

Table 1. Characteristics of Sichuan Pepper-Allergic/Sensitive Patient^a.

general information			clinical features				specific IgE values (kUA/L)
sample	gender	age (years)	allergic symptoms to ScPS	SPT to ScPS	citrus, cashew seed, pistachio allergies*	other allergic diseases	Rf602	f33	f202	f203
P1	F	59	anaphylaxis	+++	citrus, cashew seed, pistachio	AR, AS	3.63	2.55	8.54	6.72
P2	M	46	anaphylaxis	ND	citrus, cashew seed, pistachio	AR, AS, AA	17	3.39	45.9	45.9
P3	M	31	anaphylaxis	++++	cashew seed	AR, AS, AU	21.4	4.4	52.4	54.1
P4	F	57	urticaria	++++	cashew seed, pistachio	None	1.83	0.75	11.6	13.6
P5	F	62	anaphylaxis	ND	citrus, cashew seed, pistachio	None	33.7	7.23	68.1	52.4
P6	F	60	urticaria, oral allergic reactions	ND	cashew seed, pistachio	none	4.97	0.58	11.4	12.6
P7	M	51	anaphylaxis	++++	citrus, cashew seed, pistachio	AR, AS	1.14	0.49	5.02	5.04
P8	F	46	anaphylaxis	++++	cashew seed, pistachio	AR	72.7	6.16	>100	>100
P9	F	58	anaphylaxis	ND	citrus, cashew seed, pistachio	AR	6.62	3.98	8.83	0.52
P10	M	44	none	ND	none	AR, AS	3.5	0.05	0.01	0.03

^aAbbreviations: ScPS: Sichuan pepper seed; SPT: skin prick test; *: Patients with combined citrus, cashew seed, or pistachio allergies. ND: not done; AR: allergic rhinitis, AS: asthma, AA: amoxicillin allergy, AU: acute urticaria; MWD: mean wheal diameter. Rf602: Sichuan pepper seed; f33: citrus; f202: cashew seed; f203: pistachio. Note: The positive or negative SPT results are represented by the ″+″ or “–″, respectively. + (MWD > NC, ≥1/3 and <2/3 PC); ++ (MWD ≥2/3 and <1 PC); +++ (MWD = 1 PC); ++++ (MWD > 1 PC, or with pseudopods); - (MWD < 3 mm).

3.2. Purification and Characterization of the 55 kDa Protein in Sichuan Pepper Seeds

SDS-PAGE analysis showed strong protein bands separated from the crude extracts of Sichuan pepper seeds with molecular weights of about 10 to 35 and 40 to 55 kDa, respectively (Figure 1A). Western blot analysis of the extract showed that the sera pool from Sichuan pepper-allergic subjects recognized the 55 kDa protein (Figure 1B).

Figure 1.

Purification and characterization of the 55 kDa protein in Sichuan pepper seeds. (A): SDS-PAGE results for the extracts from Sichuan pepper seeds. M: marker. (B): Western blot results for extracts from Sichuan pepper seeds. A: sera pool from Sichuan pepper-allergic subjects. NA: sera pool from nonallergic subjects. (C) Superdex 200G 16/600 gel filtration of high salt-extracted proteins. (D) Hydrophobic interaction chromatography. B%: % of elution buffer. The protein was eluted as a major peak from the column with a 1.5–0 M ammonium sulfate linear gradient. (E) Superdex 200 10/300 gel filtration of 11S legumin. (F) Normalized sedimentation coefficient distributions of the purified proteins. (G) SDS-PAGE and Western blot of purified 11S legumin. Lane NR, nonreduced; Lane R, reduced.

To isolate this 55 kDa protein, Sichuan pepper seeds were ground and solubilized in a high salt buffer (1 M NaCl, 20 mM Tris-HCl, pH 8.0).¹⁸ Then, hydrophobic chromatography combined with gel filtration chromatography was selected to purify the extracted proteins. This protein was eluted as a single peak at ∼80 mL in the first gel filtration step (Figure 1C) and further purified by hydrophobic interaction chromatography (Figure 1D). Bound proteins were eluted by mixing buffer B and buffer C (20 mM Tris-HCl, pH 8.0) with a linear gradient of 80 mL (1.5–0 M) of ammonium sulfate. Finally, the state of aggregation was determined by analytical size exclusion chromatography. The major protein peak eluted at 13 mL and an apparent molecular weight of about 250 kDa, indicating that it exists as a hexamer in solution. This result is consistent with the 11S legumin from peanuts (Figure 1E).¹⁹ Furthermore, after the normalized sedimentation coefficient distribution c(s) of the purified proteins was measured using analytical ultracentrifugation sedimentation velocity and SEDFIT software, a major 13S sedimentation coefficient peak was observed (Figure 1F). The class of sedimentation coefficients (in seconds) between 10.5 and 13S is called 11S. Therefore, we conclude that the protein fraction isolated by this protocol is the 11S legume protein of Z. bungeanum.

Nonreducing SDS-PAGE analysis (Figure 1G) showed two major peptide bands for purified proteins. The apparent molecular weights of these two bands were about 42 and around 53 kDa, respectively. The SDS-PAGE under reduced conditions also showed two bands, and the protein mobilized at around 22 kDa is the most abundant. Western blot with pooled sera and the reduced (R) purified 11S protein from Sichuan pepper seeds showed that the pooled sera from Sichuan pepper-allergic subjects recognized only the approximately 22 kDa protein. So, the allergenic fragment in this purified 11S protein is about a 22 kDa protein. The different patterns of the same sample under reduced (R) and nonreduced (NR) conditions indicate the presence of at least one disulfide bond between the subunits, which is also characteristic of 11S seed storage proteins.

3.3. Identification of the 11S Legumin by 2DLC-MS

Protein extracts were separated by SDS-PAGE and analyzed by immunoblot; IgE-binding proteins of 55 kDa were excised from the gel, digested by trypsin, and analyzed by 2DLC-MS to further verify the identity of this 11S legumin. Mass spectrometric data with those in the Rutaceae database were then matched to identify the proteins. A total of 17 peptides were discovered to match the 11S legumin of the Rutaceae family. The scores of the matched peptides were 221.54, 188.01, and 83.54 in descending order, which corresponded to the 11S protein of Citrus clementina (Uniprot: V4S993, V4S3W1) and Citrus unshiu (Uniprot: A0A2H5NJH3), respectively (Table 2). The two most reliable peptides were highly conserved in C. clementina, Citrus sinensis, and C. unshiu (Figure 2). These results reveal that this purified protein shares high homology with 11S proteins from different citrus species, which further confirms that the purified proteins are 11S legumin of Z. bungeanum.

Table 2. Purified 11S Protein Peptides from MS Matched 11S Legumin from the Rutaceae Family^a.

master protein	peptide sequences	Theo. MH+ [Da]
V4S993 (C. clementina)	TSQLAGR	732.3999
	VESEAGVTEFWDQNDDQLQCANVAVFR	3127.406
	ASNRGLEWISFK	1407.738
	EGQLIVVPQGFAVVK	1583.916
	EGQLIVVPQGFAVVKR	1740.017
	FQTQCNIQDLNALEPQQR	2203.056
	GLEWISFK	979.5247
	GLPLDVIQNSFQVSR	1672.902
	HRIQQR	837.4802
V4S3W1 (C. clementina)	VESEAGVTEFWDQNNEQLQCANVAVFR	3140.438
	EGQLIVVPQGFAVVK	1583.916
	EGQLIVVPQGFAVVKR	1740.017
	FQTQCNIQNLNALEPR	1945.955
	GLEWISFK	979.5247
	GLLVPAYTNTPEIFYVVQGR	2237.196
	GLPLDVIQNSFQVSR	1672.902
	HRIQQR	837.4802
A0A2H5NJH3 (C. unshiu)	ARGSEFEWISFK	1456.722
	TNDNAMISPLSGR	1391.658
	TNDNAMISPLSGR	1375.663
	LRENIGDPSK	1128.601
	ARGSEFEWISFKTNDNAMISPLSGR	2829.362
	GSEFEWISFK	1229.584
	GSEFEWISFKTNDNAMISPLSGR	2602.224
	ILAEAFNVDER	1276.653

^aNote: Theo. MH+ [Da]: theoretical molecular weight.

Figure 2.

Mass spectrometric results for purified 11S protein. (A, B) Conserved peptide map of 2DLC-MS. (C) Protein sequence alignments of 11S protein from C. clementina, C. sinensis, and C. unshiu.

3.4. Secondary Structure and Biochemical Stability Analysis

The secondary structure and biochemical stability of the 11S protein were determined by using circular dichroism spectroscopy. The circular dichroism revealed a well-folded protein with a predominant β-sheet feature, as indicated by one lowest value at 208 nm and one maximum value at 197 nm. The curves of the secondary structure of the 11S protein at different temperatures showed that the 11S protein presented strong thermal stability from 25 to 95 °C: the CD values did not change apparently during the temperature increase from 20 to 95 °C and then cooling to 20 °C (Figure 3A). And the characterization of the 11S protein with DTT is the same as the samples without a reducing agent (Figure 3B). This result suggested that DTT cannot change the secondary structure of 11S legumin in Z. bungeanum.

Figure 3.

Secondary structure and biochemical stability analysis of 11S legumin. (A) Circular dichroism of 11S legumin without reducing agent. X-axes: wavelength from 190 to 250 nm, y-axes: circular dichroism (mdeg), red line: at 20 °C, green line: at 95 °C, blue line: sample heated from 20 to 95 °C and cooled to 20 °C. (B) Circular dichroism of 11S legumin with DTT.

3.5. Cloning of the 11S Gene in Z. bungeanum

First, a set of primers matching different regions in the coding sequence of the C. clementina 11S protein (GenBank: ESR33481.1) was designed based on master protein accession (Uniprot: V4S993) obtained by mass spectrometry. PCR experiments were carried out with different primer pair combinations using genomic DNA isolated from Sichuan pepper seeds as a template. Unfortunately, none of the reactions yielded any full-length DNA with the expected size (data not shown). After several attempts, we chose to design primers in the conservative regions so that they would be highly matched with the template and have a better chance of annealing. One pair of primers for segmental cloning was based on the conservative regions of the BLAST result and the coding sequence of the C. clementina 11S protein. PCR products with dA-tailing were directly ligated into a pUCm-T vector (Sangon Biotech). Positive clones were screened on X-gal plates, followed by Sanger sequencing. Four DNA sequences of 11S legumin in Sichuan peppers were obtained (Figure 4). When these four isoform sequences cloned from the genome of Sichuan pepper were used as a comparison library and compared with mass spectrometry results of the purified 11S protein peptides, the results showed that the isoform MZ293069 and MZ293070 matched the most peptides with the same highest coverage of 81% compared to the 71% for MZ33534, and 65% for MZ293068. MZ293069, MZ293070, MZ293068, and MZ33534 were designated Zan b 2.0101, Zan b 2.0102, Zan b 2.02, and Zan b 2.03 by the Allergen Nomenclature Subcommittee.

Figure 4.

Partial nucleotide and deduced amino acid sequences of 11S legumin in Sichuan peppers. (A) Partial nucleotide sequences of four isoforms of 11S legumin. MZ293068, MZ293069, MZ293070, and MZ33534 are GenBank accession numbers of Sichuan pepper 11S legumin isoform X1, X2, X3, X4. (B) Partial deduced amino acid sequences of four isoforms of 11S legumin.

3.6. IgE Reactivity Analysis

To determine the allergenicity of the proteins, ELISA and dot blot analyses were performed. Immunoblot analysis was carried out to analyze the IgE-binding capacity of the purified proteins in the sera of 10 patients and 2 negative controls. The purified natural 11S legume proteins were used as antigens. The binding results showed that among the 10 sera from allergic and sensitized individuals, 9 (except P6) displayed clear IgE-binding reactivities, which were apparently different from the sera from nonallergic individuals (Figure 5A).

Figure 5.

IgE reactivity and cross-reactivity of Zan b 2. (A) Dot blot results of Zan b 2. P1–P10: serum numbers of patients who are allergic/sensitive to Sichuan peppers; N1–N2: serum numbers of 2 negative healthy subjects. (B) ELISA results of Zan b 2. NC: negative control; BC: blank control; CO: cutoff value (which is three times of negative control). (C) ELISA results of citrus seeds, pistachio, cashew seeds, and peanuts. P2–P9: serum numbers of patients who are allergic/sensitive to Sichuan peppers. (D) Inhibition rates of citrus seeds, pistachio, and cashew seeds, when Zan b 2 was used as the solid protein, and citrus seeds, pistachio, and cashew seeds were used as inhibitors. P2–P9: serum numbers of patients who are allergic/sensitive to Sichuan peppers.

In ELISA, sera from ten patients allergic/sensitized to Sichuan peppers and pooled sera from nine healthy individuals were used as the primary antibodies. And the 11S legume proteins were used as antigens. The ELISA results showed that the purified proteins were recognized by 60% (6/10) sera of the Sichuan pepper-allergic/sensitive patients (Figure 5B). These results suggest that the purified 11S legume protein is a newly crucial allergen of Sichuan peppers. Therefore, this novel allergen was named Zan b 2 by the Allergen Nomenclature Subcommittee.

Then, the IgE reactivity between patients’ sera and the extracts of citrus, pistachio, and cashew seeds was analyzed. Six representatively positive sera of Zan b 2 based on the ELISA results above were used as the primary antibodies, and the extracts of citrus, pistachio, and cashew seeds were used as antigens in the ELISA assay. The results showed that the sera from Sichuan pepper-allergic individuals recognized naturally purified 11S legumin from Sichuan pepper seeds, which was named Zan b 2, also reacted with the extracts of citrus seeds, pistachios, and cashew seeds but not peanuts (Figure 5C). These data revealed that citrus, pistachio, and cashew seeds may have potential IgE cross-reactivity with Zan b 2.

3.7. Cross-Reactivity between Zan b 2 and Allergens in Citrus, Pistachios, and Cashew Seeds

To further investigate the cross-reactivity between Zan b 2 and crude extracts of citrus seeds, pistachios, and cashew seeds, competitive ELISA was performed using the same six positive serum samples as Zan b 2. The sera were premixed with the crude extracts of citrus seeds, pistachios, and cashew seeds before, as a primary antibody, incubating with the Zan b 2 in ELISA tests. The IgE-binding rates between positive sera and Zan b 2 were proved to be inhibited in various extents (Figure 5D).

4. Discussion

In our study, we identified and characterized a new allergen, 11S legumin, from Sichuan pepper seeds. The pooled sera of the patients recognized it as a 55 kDa protein. Six out of ten (60%) sera from Sichuan pepper-allergic and sensitive patients recognized this 55 kDa purified 11S legumin in ELISA tests. Moreover, nine out of ten (90%) positive patients’ sera recognized it in dot blot assay. Those results verified that it is a main allergen of Sichuan peppers. Thus, this new allergen was named Zan b 2 by the Allergen Nomenclature Subcommittee. As the genome sequence of the Sichuan pepper has not been published, it is not possible to design primers for the amplification of target genes directly. Therefore, we did not obtain full-length DNA of the expected size. Finally, we acquired four DNA sequences of this 11S protein (MZ293068:1158bps; MZ293069:1167bps; MZ293070:1164bps; MZ333534:1167bps) and found that the isoforms MZ293069 and MZ293070 matched the most peptides, with the highest coverage of 81%.

Mass spectrometry results of this newly discovered 11S protein showed two short peptides that were identical to the regions corresponding to the 11S proteins of C. clementina, C. sinensis, and C. unshiu (Figure 2C). Therefore, we expect that the full-length protein amino acid sequence of the Sichuan pepper 11S protein is very similar to that of the 11S proteins of the three citrus proteins. On SWISS-MODEL, a Web site for protein structure modeling, the protein structures found to have the highest sequence similarity to V4S993 were 3QAC (11S proglobulin seed storage protein from Amaranthus hypochondriacus L.), 2E9Q (recombinant pro-11S globulin of pumpkin), 3KGL (11S globulin from Brassica napus), and 3KSC (11S seed globulin from Pisum sativum L.).²⁰ They are all 11S proteins like Zan b 2. In addition to this, Zan b 2 was proved to have a predominant sheet structure and high thermal stability, relying on at least one disulfide bond in our study. The structure of 2E9Q is mainly composed of β-sheets, which are similar to the 11S protein of Sichuan pepper seeds. Subsequently, we also try to obtain the crystal structure of this purified 11S protein to further analyze its relevant biochemical properties.

We reported for the first time the clinical characteristics of a group of patients with Sichuan pepper allergy (SPA) in 2009, discovering that the main allergenic component in Z. bungeanum originated from the seeds rather than the peel and a high prevalence of SPA combined with cashew, pistachio, and citrus allergies. Among the Sichuan pepper-allergic patients, 86.7% (13/15) were combined with cashew nut allergy, 66.7% (10/15) were allergic to pistachios, and 53.3% (8/15) had citrus allergy.⁵ In this study, we demonstrated serological IgE cross-reactivity between Zan b 2 and citrus, pistachio, and cashew seeds. In ELISA inhibition analysis, each serum from allergic individuals showed a different level of cross-reactivity between Zan b 2 and citrus seeds, pistachio, and cashew seeds allergens. The binding of sIgE from all six patients’ sera to Zan b 2 was inhibited from 21.52 to 61.44% by cashew seeds, from 19.37 to 72.39% by pistachio, and from 52.87 to 77.43% by citrus extracts, which were greater than that of cashews and pistachios in all six patients (Figure 5D). Our study also found the purified 11S allergen from Sichuan pepper seeds shares a high homology with different citrus species by 2DLC-MS. This may also be the reason that citrus has the highest inhibition rate of 11S protein in Sichuan pepper seeds. In addition, in botanical classification, Sichuan peppers are closer to citrus, which belong to the same Sapindales and the same Rutaceae; they also belong to the same order of Sapindales as cashews and pistachios but in different families.

Cashew nuts, pistachios, and peanuts have been studied more internationally, and allergenic protein fractions have been reported considerably.^21,22 Peanut and tree nut allergies are often comorbid and prone to cross-reactivity, possibly because of the structural features, the Vicilin-buried peptides (VBP) scaffolding in peanuts and tree nuts.²³ Despite the considerable structural homology and amino acid sequence identity between nuts and peanuts,^24,25 and the potential cross-reactivity between nuts and Sichuan peppers, our study showed that serum IgE from Sichuan pepper-allergic patients binds to the 11S legume protein, as well as to the two nuts of cashews and pistachios apparently, but they did not bind to peanut extracts (Figure 5B,C). This indicates little potential for cross-reactivity between Sichuan peppers and peanuts at the serologic level.

Tree nut allergy prevalence ranges from less than 1% to around 3% worldwide.²⁶ Cashew (Anacardium occidentale) is one of the most common tree nut allergens, which has a high risk of anaphylaxis and is associated with a cross-reactivity of approximately 80% with pistachio.^26,27 What is more, several reports described allergic reactions to citrus seeds in patients who are at risk for sensitivity to cashew or pistachio.²⁸⁻³¹ Those are consistent with our finding that patients with Sichuan pepper allergy have a high rate of allergic reactions to cashews and pistachio, as well as citrus. In addition to this, individuals who are allergic or highly sensitive to Sichuan peppers may be susceptible to allergic reactions when chewing citrus seeds accidentally or ingesting citrus juice, which may be contaminated with citrus seed traces during the juice production process. In our study, we found that the citrus seeds have a high IgE reactivity with the serum samples from Sichuan pepper-allergic individuals, indicating that there are indeed potential allergenic proteins in citrus seeds. A recent study³² has found that citrin seems to be the culprit antigen in citrus seeds because it is highly homologous with Ana o 2 in cashews and Pis v 2 in pistachio. It is now unknown, however, whether citrin is the main allergen responsible for the cross-reactivity among citrus, Zan b 2, cashews, and pistachio, and further studies are needed.

Allergen immunotherapy (AIT) is an extensively researched allergy treatment method.^33,34 The purpose of AIT is to desensitize patients to specific allergens and increase the threshold to protect them. In the AIT process, allergen extract-based vaccination is mainly performed. But, because of its limitations of long treatment duration and severe allergic reactions, several research groups have begun to develop new generations of molecular allergen-based vaccines, which are proven to have lower allergenicity.³⁵⁻³⁷ Those novel molecular vaccines also offer many advantages over the traditional vaccine counterparts in terms of production, safety, and simplicity of treatment protocols,³⁸ which will bring the AIT into the molecular vaccine era. Fusion vaccines that derive from multiple allergenic protein peptides appear to be more advantageous. A recombinant protein, AB-PreS, consisting of a nonallergenic peptide derived from the IgE-binding site of Bet v 1 and the cross-reactive apple allergen Mal d 1, is currently hypoallergenic and superior to currently registered allergen extract-based vaccines.³⁹ The recombinant grass pollen allergy vaccine BM32, a PreS fusion protein mixture containing hypoallergenic peptides from four major grass pollen allergens, has been evaluated in clinical trials and was effective in reducing the symptoms of allergic rhinoconjunctivitis and medication intake in patients with grass pollen allergy.^40,41 It is of significance for AIT therapy at the advanced molecular level to identify and clarify allergen fractions and their epitope characteristics. In this study, we isolated the novel allergen component Zan b 2 in Sichuan pepper seeds and identified partial genes encoding this allergen. There are future opportunities to create hybrid vaccines based on allergen components from Sichuan peppers, cashews, pistachios, or citrus to improve and enhance the efficiency and safety of the AIT treatment.

In conclusion, we isolated a novel allergen in Sichuan pepper seeds, Zan b 2, which belongs to the 11S globulin family, and identified the partial genes encoding this allergen. Its cross-reactivity with cashew nuts, pistachios, and citrus seeds was demonstrated. Based on our findings, this new food allergen Zan b 2 might play an active role in further clinical development of better accurate diagnosis and treatment for Sichuan pepper allergy. Those results may provide a basis for the in-depth analysis of food allergy mechanisms and facilitate food safety management.

Author Contributions

^∥ J.H. and L.P.Z. contributed equally to this work and are co-first authors of the article. H.L.: Conceptualization, project administration, supervision, funding acquisition, and writing—review and editing. T.J.: Methodology, project administration, supervision, and writing—review and editing. J.H. and L.P.Z.: Investigation, formal analysis, data curation, validation, visualization, writing—original draft, and writing—review and editing. R.q.W.: Resources, investigation, and writing—review and editing. L.Z., F.C., Y.H., K.N., S.D., S.R., S.L., and W.Y.: Resources and investigation. J.L.S.: Resources and writing—review and editing.

H.L. was supported by the National Natural Science Foundation of China (Grant No.: 31972189). T.J. was supported by the National Natural Science Foundation of China (Grant Nos.: 31870731 and U1732109); the Strategic Priority Research Program of the Chinese Academy of Sciences (Grant No. XDB29030104); and the Fundamental Research Funds for the Central Universities and the 100 Talents Program of The Chinese Academy of Sciences.

The authors declare no competing financial interest.