Skip to main content
NCBI home page
Zoological Studies logoLink to Zoological Studies
. 2023 Dec 13;62:e54. doi: 10.6620/ZS.2023.62-54

Coevolutionary Implications of Obligate Commensalism in Sea Turtles: the Case of the Genus Hyachelia Barnard, 1967 (Crustacea, Amphipoda)

Tammy Iwasa-Arai 1,2,3,*, Sónia CS Andrade 3, Camila Miguel 4, Silvana GLb Siqueira 2, Max Rondon Werneck 5, Fosca PP Leite 2, Lara Moraes 3, Marcelo Renan D Santos 4, Luciana S Medeiros 6,7, Uylia H Lopes 7, Cristiana Serejo 8
PMCID: PMC11019367  PMID: 38628163

Abstract

Obligate commensalism in the marine environment and its evolutionary role are still poorly understood. Although sea turtles may serve as ideal substrates for epibionts, within amphipods, only the genus Hyachelia evolved in obligate commensalism with turtles. Here, we report a new host record for Hyachelia lowryi on the hawksbill turtle and describe a larger distribution of the genus in the Atlantic Ocean on green and loggerhead turtles. Hyachelia spp. were sampled from nesting sites of Caretta caretta and feeding grounds of Eretmochelys imbricata and Chelonia mydas along the Brazilian coast. Insights regarding the coevolution of this remarkable genus with its hosts based on molecular analyses are inferred based on mitochondrial (COI) and nuclear (18SrRNA) genes using new and previously available sequences from the infraorder Talitrida. Divergence times for Hyachelia are around the Cretaceous (~127.66 Mya), corresponding to an ancient origin and in agreement with modern green turtle (Chelonioidea) radiation. Later, diversification of Hyachelia species is dated at about 26 Mya, suggesting a coevolutionary association between amphipods and Carettini/Chelonini sea turtles.

Keywords: Distribution; Epibiosis; Invertebrate; Marine; Molecular evolution; New record; Talitrida, Taxonomy

BACKGROUND

Sea turtles can host a wide diversity of epibionts, from algae to macro-and microinvertebrates (Corrêa et al. 2014). According to Frick and Pfaller (2013), the variability of turtle epibiont communities depends on the geographic and ecological overlap of hosts and epibionts, with the likelihood of epibiosis resulting from a trade-off between the costs and benefits of the epibionts involved. The majority of these organisms are normally found in the surrounding marine environment (such as coral reefs, rocky shores and algal beds) (Frick and Pfaller 2013) and behave as facultative commensals (Wahl and Mark 1999). More rarely, some of the epibionts are found exclusively in association with sea turtles, and are thus referred to as obligate commensals (Frick and Pfaller 2013). The evolutionary roles of such strict associations are still poorly understood.

Among turtles and other large marine vertebrates, crustaceans represent one of the most diverse groups of epibionts, and amphipods show a great variety of ecological adaptations (Barnard 1967; Serejo and Sittrop 2009; Iwasa-Arai and Serejo 2018). Several species of amphipods are known as facultative commensals, such as Caprella andreae Mayer, 1890 and Protohyale (Protohyale) grimaldii (Chevreux, 1891), frequently found in association with sea turtles (Table 1). In contrast, only three species of amphipods are known as obligate commensals of sea turtles: Podocerus chelonophilus (Chevreux and Guerne, 1888), Hyachelia tortugae Barnard, 1967 and H. lowryi Serejo and Sittrop, 2009. Podocerus chelonophilus is a subcosmopolitan epibiont found on loggerhead [Caretta caretta (Linnaeus, 1758)], green [Chelonia mydas (Linnaeus, 1758)], olive ridley [Lepidochelys olivacea (Eschscholtz, 1829)] and hawksbill turtles [Eretmochelys imbricata (Linnaeus, 1766)] (Baldinger 2001; Lazo-Wasem et al. 2011; Iwasa-Arai et al. 2020). The genus Podocerus Leach, 1814 comprises over 60 species (Horton et al. 2021), but only three have particularly broad distributions(Hughes 2016), and the wide distribution of P. chelonophilus might be associated with its epibiont lifestyle.

Table 1.

Records of amphipods associated with sea turtles

graphic file with name zoolstud-62-054-t001.jpg

Open in a new tab

The other two amphipod obligate commensal species, H. tortugae and H. lowryi, have a much more restricted distribution and host specificity. H. tortugae has been documented on green turtles while H. lowryi has been found on green and loggerhead turtles, and both amphipod species are found only in the Pacific Ocean (Serejo and Sittrop 2009; Yabut et al. 2014). In contrast with Podocerus, the genus Hyachelia Barnard, 1967 comprises only two species, and its evolution is likely correlated with sea turtle evolution. Due to its conspicuous morphological differentiation, Hyachelia was transferred to its own subfamily Hyacheliinae Bousfield and Hendrycks 2002 within Hyalidae Bulyčeva, 1957 (Bousfield and Hendrycks 2002). In contrast, Hyalinae Bulyčeva, 1957 is composed of 148 species distributed among 11 genera (Horton et al. 2021). Free-living hyalids are predominantly found among algae and biofouling substrates in the intertidal and shallow infralittoral areas of tropical and subtropical zones (Serejo and Sittrop 2009).

While relationships within Hyalidae are yet to be elucidated, studies on the crown sea turtle evolutionary histories mostly agree on the species relationships and divergence times (Naro-Maciel et al. 2008; Duchene et al. 2012). Within sea turtles (Chelonioidea), the most speciose family is Cheloniidae Oppel, 1811, which comprises six of the seven extant species, and is divided into Chelonini and Carettini (sensu NaroMaciel et al. 2008). Chelonini is composed by the green [Chelonia mydas (Linnaeus, 1758)] and the flatback sea turtles [Natator depressus (Garman, 1880)], which diverged around 34 Mya (Naro-Maciel et al. 2008). Carettini includes the hawksbill [Eretmochelys imbricata (Linnaeus, 1766)], separated from the remaining Carettini clade around 29 Mya (Naro-Maciel et al. 2008), the loggerhead [Caretta caretta (Linnaeus, 1758)], that diverged from Lepidochelys around 16 Ma (Bowen et al. 1991), the olive ridley [Lepidochelys olivacea (Eschscholtz, 1829)] and the Kemp’s ridley (Lepidochelys kempii Garman, 1880), separated around 5 Mya (Bowen et al. 1991).

In the present study we report the first record of H. lowryi on a hawksbill turtle (E. imbricata), as well as the first records of both H. lowryi and H. tortugae for the Atlantic Ocean. In order to provide insights into the evolution of Hyachelia, we propose a phylogenetic hypothesis based on molecular analyses, including species within Talitrida (Brevitalitridae, Hyalidae, Hyalellidae and Talitridae). According to the new host association and the currently accepted sea turtle phylogeny, we hypothesize the emergence of Hyachelia ancestor species on the crown Cheloniidae, and further speciation into H. tortugae on Chelonini and H. lowryi on Carettini, with posterior dispersal togreen turtles. Based on the data, we estimate the divergence times of H. lowryi and discuss its association with hosts and biogeographical aspects.

MATERIALS AND METHODS

Living sea turtles were sampled on nesting and feeding grounds from the hosts C. caretta, C. mydas and E. imbricata, in the municipalities of Feliz Deserto (10°17'59.0"S, 36°17'25.6"W), Arembepe (12°45'54.8"S, 38°10'11.5"W) and Santa Cruz (19°57'40.3"S, 40°07'57.5"W), in the states of Alagoas, Bahia and Espírito Santo, Brazil, respectively. Epibionts were manually collected in situ with tweezers, fixed in a 70–99% alcohol solution, stored at room temperature and then later analysed under a stereomicroscope for species identification. Specimens were identified according to the original description from Barnard (1967) and Serejo and Sittrop (2009), and remarks from Yabut et al. (2014). One specimen of each species was dissected and mounted on permanent slides. All materials were deposited at the Zoology Museum at Universidade Estadual de Campinas (ZUEC).

Two specimens of H. lowryi and two of H. tortugae,and speciesof Hyalidae present in the southeast Brazilian coast [Hyale macrodactyla Stebbing, 1899, Parhyale hawaiensis (Dana, 1853), Ptilohyale littoralis (Stimpson, 1853) and Serejohyale youngi (Serejo, 2001)] were subjected to molecular analyses. Total genomic DNA was obtained using a CTAB extraction protocol (Doyle and Doyle 1987). Fragments of the mitochondrial gene cytochrome oxidase I (COI, ~720 bp) and the nuclear gene 18SrRNA (~1500 bp) were amplified using the UCOIF (5’ TAW ACT TCD GGR TGR CCR AAA AAY CA 3’) and UCOIR (5’ ACW AAY CAY AAA GAY ATY GG 3’) primers for COI (Costa et al. 2009) and the 18SGF (5’ GGATAACTGTGGTAATTCCAGAGCT 3’) and 18SGR-2 (5’ TAGTAGCGACGGGCGGTGTGTA 3’) primers for 18SrRNA (Hou et al. 2007). Amplification reactions included approximately 50 ng of genomic DNA, 1 U of DNA polymerase (QIAGEN), 1.5 μL of QIAGEN DNA Polymerase Buffer (5×), 0.2 mM of dNTPs, 2.5 mM of MgCl2 and 0.3 μM of each primer. PCR conditions were: one cycle of 3 min at 95°C followed by 35 cycles of 30 s at 95°C, 45 s at 48°C, and 1 min at 72°C. All PCR products were purified using the PEG purifying protocol (http://labs.icb.ufmg.br/lbem/protocolos/peg.html) and sequenced in both directions using ABI 3500 automated DNA Sanger sequencers (Applied Biosystems).

The obtained sequences were trimmed using GeneStudio 2.2.0.0. (GeneStudio Inc.). Multiple sequence alignment of all markers was performed with MAFFT v.7 using the strategy G-INS-i (Katoh et al. 2005), with the following parameters: gap penalty of 1.53 for COI and 3.0 for 18S rRNA; scoring matrix for nucleotide sequences of 200PAM ⁄ K2; offset value of 0.0. Sequences were deposited in GenBank (Table S1).

Sequences available for both COI and 18SrRNA of other Talitroidea families were also included in the analyses. The best partition schemes and models were determined in ModelFinder 1.5.4 (Kalyaanamoorthy et al. 2017) based on the modified Akaike Information Criterion (AICc) available on IQ-TREE 2 web server (Nguyen et al. 2015). The optimal partitioning strategy and evolutionary models consisted of GTR+F+I+G4 for the three COI codon partitions and 18SrRNA. A maximum likelihood gene tree was inferred using IQTree web server (Nguyen et al. 2015; http://iqtree. cibiv.univie.ac.at/), and the support of the nodes was evaluated with 1000 ultrafast bootstrap replications. Bayesian Inference analyses were conducted in BEAST 1.10.4 (Drummond et al. 2012) on the CIPRES server (Miller et al. 2010) using 108 generations, sampling every 1000 generations. Quadrimaera inaequipes (A. Costa in Hope 1851) (Hadziida: Maeridae) was used to root the phylogeny based on previous analyses by Copilaş-Ciocianu et al. (2020), whereas three species of Corophiida, Gammaridae and Crangonyctidae were also used as outgroups (Table S1).

Divergence times were calculated with BEAST 1.10.4 (Drummond et al. 2012) using the COI+18SrRNA dataset with an uncorrelated relaxed clock with a lognormal distribution (Drummond et al. 2006) and codon partitioning for COI. For the tree model, a random starting tree was used, and speciation was modelled using the Birth-Death Process. The MCMC chain was run for 108 iterations, with a thinning of 1000. Estimated divergence times were based on the fossil calibration scheme described in detail by CopilaşCiocianu et al. (2019 2020) with three calibration points on fossil Crangonyctidae (minimum age of 35 Ma), Gammaridae (minimum age of 9 Ma) and Talitridae (minimum age of 25 Ma). Effective sample sizes of parameters and convergence were checked with Tracer 1.7.1 (Rambaut et al. 2018) after discarding 20% of the trees as burn-in. Two independent runs were performed with concordant results. The resulting files were then combined using LogCombiner 1.8 (Drummond et al. 2012), and the maximum clade credibility tree was produced using TreeAnnotator 1.8 (Drummond et al. 2012). Sea turtle phylogenetic relationships and their estimated ages were used based on the molecular phylogeny proposed by Naro-Maciel et al. (2008).

RESULTS

TANONOMY

Order Amphipoda Latreille, 1816

Family Hyalidae BulyĊeva, 1957

Subfamily Hyacheliinae Bousfield and Hendrycks, 2002

Genus Hyachelia J. L. Barnard, 1967

Hyachelia lowryi Serejo and Sittrop, 2009

(Figs. 1 and 2)

Hyachelia lowryi Serejo and Sittrop, 2009: 441–444, figs. 1–2; Yabut et al. 2014: 5–6, figs. 1B, 5B, 6.

Material examined: 5 males, Feliz Deserto, Alagoas, Brazil (10°17'59.0"S, 36°17'25.6"W), ZUEC CRU 4385; 13 males, 9 females and 4 juveniles, Arembepe, Bahia, Brazil (12°45'54.8"S, 38°10'11.5"W).

Distribution: Type locality: Mon Repos, Queensland, Australia (~24°48'S, 152°26'E), on loggerhead turtle Caretta caretta (Linnaeus, 1758) and green turtle Chelonia mydas (Linnaeus, 1758) (Serejo and Sittrop 2009). Palmyra Atoll National Wildlife Refuge (5°53'N, 162°5'W), on C. mydas (Yabut et al. 2014). Atlantic Ocean: Feliz Deserto, Alagoas (10°17'59.0"S, 36°17'25.6"W), Brazil, on hawksbill turtle Eretmochelys imbricata (Linnaeus, 1766) (present study) (Fig. 2). Arembepe, Bahia (12°45'54.8"S, 38°10'11.5"W), Brazil, on C. caretta (present study).

Fig. 1.

Fig. 1.

Open in a new tab

a, Hawksbill turtle (Eretmochelys imbricata) stranded in Alagoas, northeast Brazil. b, Amphipods (Hyachelia lowryi) associated to E. imbricata, arrow indicates H. lowryi specimens. c, Hyachelia lowryi Serejo and Sittrop, 2009 (ZUEC CRU 4385). d, Hyachelia tortugae Barnard, 1967 (ZUEC CRU 4386).

Remarks: The genus Hyachelia presents two species, Hyachelia lowryi and H. tortugae that are obligate commensals of marine turtles. Hyachelia lowryi is very distinct from H. tortugae and the Brazilian material displayed the overall morphology of the original description from Queensland, Australia provided by Serejo and Sittrop (2009). Differences between H. lowryi and H. tortugae (in parentheses) are: palp of maxilla 1 reaching the base of outer lobe setalteeth (vs vestigial); presence of a long whip-like seta on the male palp of maxilliped (vs short seta); coxa 4 wider, about 1.2x wider than long (vs as long as wide); propodus of pereopods 3–7 with 7 robust setae (vs 4 robust setae); and the inner ramus of uropods 1–2 with 4–5 setae (vs lacking setae) (Serejo and Sittrop 2009). Previous records from the Palmyra Atoll National Wildlife Refuge reported both Hyachelia species, H. lowryi and H. tortugae on green turtles (Chelonia mydas), where they can co-occur in the same turtle host (Yabut et al. 2014). In our study, H. lowryi were absent on the sampled green turtles. This is the first record of H. lowryi on a hawksbill turtle [Eretmochelys imbricata (Linnaeus, 1766)], as well as the first observation in the Atlantic Ocean for both hawksbill and loggerhead turtles.

Fig. 2.

Fig. 2.

Open in a new tab

Hyachelia lowryi Serejo and Sittrop, 2009 (ZUEC CRU 4385). a, Maxilliped, scale bar: 0.1 mm. b, Gnathopod 2, scale bar: 1.0 mm. c, Uropod 3, scale bar: 0.1 mm. d, Gnathopod 1, scale bar: 0.5mm; e) Uropod 1, scale bar: 0.5 mm. f, Pereopod 4, scale bar: 0.5 mm. g, Pereopod 7, scale bar: 0.5 mm; h) Uropod 2, scale bar: 1.0 mm.

Hyachelia tortugae Barnard, 1967

(Figs. 1 and 3)

Hyachelia tortugae Barnard, 1967: 120–125, figs. 1–4; Aguirre et al. 1998: 93; Yabut et al. 2014: 5, figs. 1A, 3, 4, 5A; Robinson et al. 2016: 1235–1237; Valencia et al. 2018: 86–88, figs. 1, 2.

Material examined: 8 males, 5 females, 2 juveniles, Santa Cruz, Aracruz, Espírito Santo, Brazil (19°57'40.3"S, 40°07'57.5"W), ZUEC CRU 4386.

Distribution:Type locality: Porto Nuñez, Santa Cruz Island, Galapagos (~0°45'S, 90°20'W), on green turtle Chelonia mydas (Barnard, 1967). Palmyra Atoll National Wildlife Refuge (5°53'N, 162°5'W), on C. mydas (Yabut et al. 2014). Parque Nacional Marino Las Baulas, Guanacaste, Costa Rica (10°20'N, 85°51'W), on C. mydas (Robinson et al. 2017). Gorgona Island, Colombia (2°58'00"N, 78°11'24"W), on C. mydas (Valencia et al. 2018). Atlantic Ocean: Santa Cruz, Aracruz, Espírito Santo, Brazil (10°17'59.0"S, 36°17'25.6"W), on C. mydas (present study).

Remarks: Hyachelia tortugae from the Brazilian green turtles displayed the overall morphology found in the original description provided by Barnard (1967) and remarks from Yabut et al. (2014). This species was observed only on green turtle hosts.

Fig. 3.

Fig. 3.

Open in a new tab

Hyachelia tortugae Barnard, 1967 (ZUEC CRU 4386). a, Maxilliped, scale bar: 0.1 mm. b, Gnathopod 2, scale bar: 1.0 mm. c, Uropod 3, scale bar: 0.1 mm. d, Gnathopod 1, scale bar: 0.5 mm. e, Uropod 1, scale bar: 0.5 mm. f, Pereopod 4, scale bar: 0.5 mm. g, Pereopod 7, scale bar: 0.5 mm. h, Uropod 2, scale bar: 1.0 mm.

Phylogenetic analysis

Sequences of species found on the Brazilian southeastern coast (H. macrodactyla, P. hawaiensis, P. littoralis and S. youngi) as well as H. lowryi and H. tortugae are newly available. Due to the low sampling of Talitrida, which comprises more than 700 spp (Horton et al. 2023), we resume our discussion of the relationships among Hyachelia spp. Within the infraorder Talitrida, there are four families represented in the present analysis: Brevitalitridae (terrestrial), Hyalidae (marine, shallow infralittoral and commensal), Hyalellidae (freshwater) and Talitridae (terrestrial or marine supralittoral). Hyalidae includes two subfamilies: The possibly polyphyletic Hyalinae (Fig. 4); and Hyachelinae. Hyachelinae, comprised by H. lowryi and H. tortugae,was recovered both in ML and BI trees (Figs. 4 and S1). The Hyachelia clade showed long branch attraction, suggesting phylogenetic uncertainty, especially for 18SrRNA (Fig. S1), complicating attempts to map the evolution of the gene (Lindgren and Daly 2007). Therefore, a more comprehensive view of the evolutionary history requires knowledge of other molecular markers and inclusion of more sibling taxa to help understand the relationships.

Fig. 4.

Fig. 4.

Open in a new tab

COI+18SrRNA tree of Talitrida based on available sequences. Node values correspond to the estimated divergence time of Hyachelia. Red bars show the 95% highest posterior density. Bootstraps and posterior probability values are represented above branches for the Talitrida, Hyachelia, H. lowryi and H. tortugae. Red horizontal bars correspond to the 95% highest posterior density intervals (HPD). The gray vertical bar corresponds to Chelonioidea radiation according to Kear and Lee (2006).

Divergence time estimates are in agreement with the ages of the infraorder Amphipoda inferred by Copilaş-Ciocianu et al. (2020). According to our analyses, the ancestor of the genus Hyachelia originated in the Cretaceous around 127.66 Mya [95% highest posterior density intervals (HPD): 87.00–174.64] and possibly represents the very first split of the infraorder Talitrida (Fig. 1). Within the genus, Hyachelia tortugae and H. lowryi split in the Miocene, around 26.16 Mya (95% HPD: 9.36–46.43 Mya, Fig. 4).

DISCUSSION

This is the first approach on the phylogeny of Talitrida with molecular data, including new data on Brazilian species. Thirty-two species of amphipods are facultative commensals of sea turtles worldwide (Table 1). The unique morphology of Hyachelia lowryi and H. tortugae includes the presence of several synapomorphies, including: coxae 1–4 longer than wide, without posterior processes; propodi of pereopods 3–7 prehensile and with distal robust setae; and uropod 3 lacking rami, which are believed to result from its obligate commensal habit (Serejo and Sittrop 2009).

The first observation of the association between the genus Hyachelia, and sea turtles dates back to its description, based on the conspicuous morphological differences from the extant Hyalidae and Talitridae amphipods. Despite its morphological adaptations to the commensal lifestyle, there are only a few records of Hyachelia worldwide, regardless of the widespread distribution of sea turtle hosts, while facultative commensal species are more commonly found (Pfaller et al. 2008; Zakhama-Sraieb et al. 2010; Domènech et al. 2014; Iwasa-Arai et al. 2020). Cleaning behaviours performed by fishes on sea turtles might change the epibiont fauna, as observed by Sazima et al. (2004) and Grossman et al. (2006) for C. mydas and E. imbricata in the oceanic island of Fernando de Noronha, northeastern Brazil.

Hyachelia is an intriguing genus that was originally described within Hyalidae by Barnard (1967), and later transferred to Ceinidae J.L. Barnard, 1972 by Barnard and Karaman (1991), based on the absence of a ramus on uropod 3 (Serejo 2004). Afterwards, Bousfield and Hendrycks (2002) returned Hyachelia to Hyalidae due to the presence of a preamplexing notch in mature females of H. tortugae,as well as morphological similarities to Hyale,particularly in uropod 3 and the telson, and proposed the subfamily Hyacheliinae. Later on, Serejo (2004) studied the superfamily Talitroidea based on cladistic analyses and recovered Hyachelia as part of the subfamily Hyacheliinae, family Hyalidae, suggesting that Hyachelia evolved from free-living hyalid-like ancestors. In a more recent revision that dealt with the phylogeny and establishment of the suborder Senticaudata, Hyacheliinae (Hyachelia) was again recovered as part of the Hyalidae family (Lowry and Myers 2013).

In order to provide insights into the evolution of Hyachelia (Hyalidae), we propose a phylogenetic hypothesis based on molecular analyses, including species within the families Hyalidae, Hyalellidae and Talitridae, historically known as sister groups (Bulycheva 1957; Serejo 2004; Lowry and Myers 2013). In the present phylogenetic analysis, Hyalidae is paraphyletic, as species of Brevitalitridae, Talitridae and Hyalellidae are grouped together. As a large and complex group, the infraorder Talitrida includes 768 species within 4 superfamilies (Caspicoloidea Birstein, 1945; Hyaloidea BulyĊeva, 1957; Kurioidea Barnard, 1964; Talitroidea Rafinesque, 1817) (Horton et al. 2021), and we need a much more inclusive analysis to discuss it. Moreover, Hyachelia is recovered as a monophyletic group in both the ML and BI trees with an early divergence from the sister clade that includes the remaining Talitrida (Hyalidae, Hyalellidae and Talitridae) (Figs. 1 and S1). Species relationships were mainly recovered in both the ML and BI analyses for P. frequens and H. macrodactyla, S. youngi and P. littoralis, and T. martensii, O. gammarellus, M. japonica and T. topitotum (Figs. 1 and S1).

Divergence times of Hyachelia were estimated in the Cretaceous, around 127.66 Ma (95% HPD: 87.00–174.64 Mya, Fig. 1). Five distinct sea turtle lineages existed around 100 Ma (Kear and Lee 2006), which included the two lineages correspondent to the modern cheloniids and dermocheliids (leatherback turtles). Thus, Hyachelia ancestors could be associated with older Chelonioidea ancestors, or as free-living amphipods. In contrast, H. lowryi and H. tortugae showed a more recent split in the Paleogene, around 26.16 Mya (95% HPD: 9.36–46.43 Mya). According to the divergence times estimated by Naro-Maciel et al. (2008), Chelonini separated from Carettini about 63 Mya (95% HPD: 35.59–91.38 Mya), whereas Eretmochelys split from Caretta and Lepidochelys about 29 Mya, and Pacific and Atlantic Chelonia populations split around 7 Mya. Therefore, a coevolutionary pattern between the split of Chelonini/Carettini and H. lowryi/H. tortugae is evidenced (Fig. 5). As the analysis inferred an ancient colonisation of sea turtles by these specialised amphipods, our initial hypothesis of emergence of the Hyachelia ancestor species followed by speciation into H. tortugae in Chelonini and H. lowryi in Carettini, and later dispersion to C. mydas,is therefore plausible.

Fig. 5.

Fig. 5.

Open in a new tab

Currently accepted Cheloniidae relationships and divergence times. The red bar corresponds to the Hyachelia lowryi and H. tortugae divergence time of 26.16 Ma. (95% HPD: 9.36–46.43).Species in bold represent Hyachelia occurrences. Turtle drawings are adapted from Vecta.io and Biorender. Orange triangles represent known H. lowryi hosts and blue dots represent known H. tortugae hosts.

The presence of H. lowryi in the three sea turtle species (Chelonia mydas, Caretta caretta and Eretmochelys imbricata) is corroborated by the known interspecific interactions and even hybridization between them (Bowen and Karl 2007; Reis et al. 2010a b; Vilaça et al. 2012; Kelez et al. 2016). During these interactions, both Hyachelia species could be transmitted from one host to another; however, possible competition between commensal species might favour the prevalence of H. lowryi in green, loggerhead and hawksbill turtles, while H. tortugae remains restricted to green turtles.

The new record of H. lowryi in the Atlantic Ocean reveals an important step to uncover the geographic distribution of this singular genus. With the cosmopolitan distribution of the marine turtles, it is expected that Hyachelia is a much more widespread genus, but more sampling is needed to understand this pattern (Fig. 6). For now, partnerships between carcinologists and local sea turtle monitoring organisations are the best option for obtaining more information regarding biogeographic patterns and other aspects of this unusual genus. Our study also broadens the knowledge of the association between the obligate commensal genus Hyachelia and its host the sea turtles. We also shed light on the molecular evolution of Hyachelia and related species within the families Hyalidae, Hyalellidae and Talitridae. Further investigation on the genomics, ecology and systematics of Talitrida may help to elucidate the evolutionary processes that drove Hyachelia into an obligatory commensal lifestyle, essential knowledge since they are useful indicators of sea turtle health and migration.

Fig. 6.

Fig. 6.

Open in a new tab

Current known distribution of Hyachelia. Stars correspond to new records, and stars with black outlines correspond to new host records.

CONCLUSIONS

The genus Hyachelia, previously agreed only in the Pacific Ocean, was herein documented for the first time in the Atlantic Ocean, with the first record of Hyachelia lowryi on the hawksbill turtle, showing broad distribution worldwide. The first molecular data of both Hyachelia lowryi and H. tortugae suggest the origin of the genus around the Cretaceous, possibly in ancestors of green turtles, while H. lowryi and H. tortugae diverged about 26 Ma, suggesting a coevolutionary association between amphipods and Carettini/Chelonini sea turtles.

Supplementary materials

Fig. S1.

Maximum likelihood tree of COI+18SrRNA of Hyalidae and outgroups Ampithoidae, Caprellidae, Crangonyctidae, Gammaridae, Hyalellidae and Talitridae. Numbers above branches correspond to bootstrap values above 80%.

(download) (579.3KB, tiff)
Table S1.

Species used in the phylogenetic analyses and accession numbers.

(download) (28KB, ods)

Acknowledgments

We are extremely grateful to the Instituto Biota and Projeto Chelonia mydas (Instituto Marcos Daniel) team that collected the samples. We hank Pedro Longo (Unicamp) for Hyalidae sequences. We are thankful to R. B. Bressan for English review. We thank FAPESP for TI-A’s scholarship (2018/00488-7) and TI-A, SS and FL grant (2018/10313-0). This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) grants no. 2018/004887 and 2018/10313-0.

Footnotes

Authors’ contributions: TI-A conceived this study, performed morphological identification, molecular analyses, and drafted the manuscript. SS performed the morphological dissection and provided microscopy figures. CM, MS, MW, UL and LM provided the specimens. LM performed molecular analyses. FL, CS and SA supervised and acquired funding. All authors read and approved the final manuscript.

Competing interests: The authors declare that they have no competing interests.

Availability of data and materials: The data that support this study are available in the article and accompanying online supplementary material.

Consent for publication: Not applicable.

Ethics approval consent to participate: Not applicable.

References

  1. Aguirre AA, Spraker TR, Balazs GH, Zimmerman B. 1998. Spirorchidiasis and fibropapillomatosis in green turtles from the Hawaiian Islands. J Wildlife Dis 34(1):91–98. doi:10.7589/00903558-34.1.91. [DOI] [PubMed]
  2. Baldinger AJ. 2001. An additional record of Podocerus chelonophilus (Chevreux and de Guerne, 1888) (Crustacea: Amphipoda: Podoceridae) from a sea turtle off the coast of Ecuador. p. 441–455. In: K. Jazdzewski; A. Baldinger; C.O. Coleman; C. De Broyer; M.F. Gable and W. Plaiti (eds), Proceedings of the Xth International Colloquium on Amphipoda, Heraklion, Crete, Greece, 16–21 April 2000. Polskie Archiwum Hydrobiologii.
  3. Barnard JL. 1964. Revision of some families, genera and species of gammaridean Amphipoda. Crustaceana 7:49–74.
  4. Barnard JL. 1967. New genus of Galapagan amphipod inhabiting the buccal cavity of the sea-turtle, Chelonia mydas.In: Proceedings of Symposium on Crustacea Part 1:119–125. Mandapam Camp: Marine Biological Station of India.
  5. Barnard JL, Karaman GS. 1991. The families and genera of marine Amphipoda (except marine Gammaroids). Rec Austr Mus 13:1–866. doi:10.3853/j.0812-7387.13.1991.91.
  6. Birstein JA. 1945. Revision of the systematics of Caspian Sea Gammaridae. Doklady Akademiia Nauk SSSR 50:517–529.
  7. Bousfield EL, Hendrycks EA. 2002. The talitroidean amphipod family Hyalidae revised, with emphasis on the North Pacific fauna: systematics and distributional ecology. Amphipacifica 3:17–134.
  8. Bowen BW, Karl SA. 2007. Population genetics and phylogeography of sea turtles.Mol Ecol 16:4886–4907. doi:10.1111/j.1365-294X. 2007.03542.x. [DOI] [PubMed]
  9. Bowen BW, Meylan AB, Avise JC. 1991. Evolutionary distinctiveness of the endangered Kemp’s ridley sea turtle. Nature 352:709–711. doi:10.1038/352709A0. [DOI] [PubMed]
  10. BulyĊheva AI. 1957. Beach-fleas of the seas of the USSR and adjacent waters (Amphipoda — Talitroidea).Akademiia Nauk SSSR, Opredeliteli po Faune SSSR 65:1–185.
  11. Cabezas MP, Navarro-Barranco C, Ros M, Guerra-García JM. 2013. Long-distance dispersal, low connectivity and molecular evidence of a new cryptic species in the obligate rafter Caprella andreae Mayer, 1890 (Crustacea: Amphipoda: Caprellidae). Helgoland Mar Res 67:483–497. doi:10.1007/s10152-012-0337-9.
  12. Caine EA. 1986. Carapace epibionts of nesting loggerhead sea turtles: Atlantic coast of USA. J Exp Mar Biol Ecol 95:15–26. doi:10.1016/0022-0981(86)90084-5.
  13. Corrêa GVV, Ingels J, Valdes YV, Fonsêca-Genevois VG, Farrapeira CMR, Santos GAP. 2014. Diversity and composition of macro-and meiofaunal carapace epibionts of the hawksbill sea turtle (Eretmochelys imbricata Linnaeus, 1822) in Atlantic waters. Mar Biodiv 44:391–401. doi:10.1007/s12526-013-0189-9.
  14. Domènech F, Badillo FJ, Tomás J, Raga JA, Aznar FJ. 2014. Epibiont communities of loggerhead marine turtles (Caretta caretta) in the western Mediterranean: influence of geographic and ecological factors. J Mar Biol Assoc UK 95:851–861. doi:10.1017/S0025315414001520.
  15. Horton T, Lowry J, De Broyer C, Bellan-Santini D et al. 2021. World Amphipoda Database. Podocerus. Available at: https://www. marinespecies.org/amphipoda/aphia.php?p=taxdetails&id= 158318. Accessed on 15 Nov. 2021.
  16. Horton T, Lowry J, De Broyer C, Bellan-Santini D, Coleman CO, Corbari L et al. 2022a. World Amphipoda Database. Hyalidae Bulyceva, 1957. World Register of Marine Species. Available at: http://www.marinespecies.org/aphia.php?p=taxdetailsandid= 490602. Accessed 2 June 2022.
  17. Horton T, Lowry J, De Broyer C, Bellan-Santini D, Coleman CO, Corbari L et al. 2022b. World Amphipoda Database. Talitrida. World Register of Marine Species. Available at: http://www. marinespecies.org/aphia.php?p=taxdetailsandid=490602. Accessed 2 Feb. 2023.
  18. Hou Z, Fu J, Li S. 2007. A molecular phylogeny of the genus Gammarus (Crustacea: Amphipoda) based on mitochondrial and nuclear gene sequences. Mol Phylogenet Evol 45:596–611. doi:10.1016/J.YMPEV.2007.06.006. [DOI] [PubMed]
  19. Hughes LE. 2016. Designation of neotypes for Cyrtophium orientale Dana, 1853, Podocerus brasiliensis (Dana, 1853) and P. cristatus (Thomson, 1879) and the description of a new species Podocerus cyrenensis (Crustacea: Amphipoda: Podoceridae). Raffles Bull Zool 34:312–330.
  20. Frick MG, Williams KL, Markesteyn EJ, Pfaller JB, Frick RE. 2004. New records and observations of epibionts from loggerhead sea turtles. Southeastern Naturalist 3(4):613–620.
  21. Frick MG, Williams KL, Robinson M. 1998. Epibionts associated with nesting loggerhead sea turtles (Caretta caretta) in Georgia, USA. Herpetological Rev 29:211–214.
  22. Fuller WJ, Broderick AC, Enever R, Thorne P, Godley BJ. 2010. Motile homes: a comparison of the spatial distribution of epibiont communities on Mediterranean sea turtles. J Nat Hist 44:1743–1753. doi:10.1080/00222931003624820.
  23. Iwasa-Arai T, Serejo CS. 2018. Phylogenetic analysis of the family Cyamidae (Crustacea: Amphipoda): a review based on morphological characters. Zool J Linn Soc 184:66–94. doi:10.1093/zoolinnean/zlx101.
  24. Iwasa-Arai T, Gallo Neto H, Beneton Ferioli R, Werneck MR. 2020. Notes on amphipods associated with loggerhead marine turtle Caretta caretta (Linnaeus, 1758) in south-eastern Brazil. Nauplius 28:e2020034. doi:10.1590/2358-2936e2020034.
  25. Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. 2017. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat Methods14:587–589. doi:10.1038/nmeth.4285. [DOI] [PMC free article] [PubMed]
  26. Kear BP, Lee MSY. 2006. A primitive protostegid from Australia and early sea turtle evolution. Biol Lett 2:116–119. doi:10.1098/rsbl. 2005.0406. [DOI] [PMC free article] [PubMed]
  27. Kelez S, Velez-Zuazo X, Pacheco AS. 2016. First record of hybridization between green Chelonia mydas and hawksbill Eretmochelys imbricata sea turtles in the Southeast Pacific. PeerJ 4:1712. doi:10.7717/peerj.1712. [DOI] [PMC free article] [PubMed]
  28. Kitsos MS, Christodoulou M, Arvanitidia C, Mavidis M, Kirmitzoglou I, Koukouras A. 2005. Composition of the organismic assemblage associated with Caretta caretta. J Mar Biol Assoc UK 85:257–261. doi:10.1017/S0025315405011136h.
  29. Lazo-Wasem E, Pinou T, Peña de Niz A, Feuerstein A. 2011. Epibionts associated with the nesting marine turtles Lepidochelys olivacea and Chelonia mydas in Jalisco, Mexico: a review and field guide. B Peabody Mus Nat Hi 52:221–240. doi:10.3374/014.052.0203.
  30. Latreille PA. 1816. Amphipodes. In: Nouveau Dictionnaire d’histoire naturelle, appliquée aux arts, à l’Agriculture, à l’Economic rurale et domestique, à la Médecine, etc.Vol. 1. Par une Société de Naturalistes et d’Agriculteurs. Nouvelle Édition. Paris, Deterville, pp. 467–469.
  31. Lindgren AR, Daly M. 2007. The impact of length‐variable data and alignment criterion on the phylogeny of Decapodiformes (Mollusca: Cephalopoda). Cladistics 23(5):464–476. doi:10.1111/j.1096-0031.2007.00160.x.
  32. Loghmannia J, Nasrolahi A, Rezaie-Atagholipour M, Kiabi BH. 2021. Epibiont Assemblages on Nesting Hawksbill Turtles Show Site-Specificity in the Persian Gulf. Front Ecol Evol 9:690022. doi:10.3389/fevo.2021.690022.
  33. Lowry JK, Myers AA. 2013. A phylogeny and classification of the Senticaudata subord. nov. Crustacea: Amphipoda). Zootaxa 3610(1):1–80. doi:10.11646/zootaxa.3610.1.1. [DOI] [PubMed]
  34. Myers AA. 1989. Genus Jassa Leach, 1814. The Amphipoda of the Mediterranean. Memoires de ‘l Institut Oceanographique 13(2):434–438.
  35. Naro-Maciel E, Le M, FitzSimmons NN, Amato G. 2008. Evolutionary relationships of marine turtles: a molecular phylogeny based on nuclear and mitochondrial genes. Mol Phylogenet Evol 49:659–662. doi:10.1016/j.ympev.2008.08.004. [DOI] [PubMed]
  36. Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ. 2015. IQTREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol 32:268–274. doi:10.1093/molbev/msu300. [DOI] [PMC free article] [PubMed]
  37. Pfaller JB, Frick MG, Reich KJ, Williams KL, Bjorndal KA. 2008. Carapace epibionts of Loggerhead Sea turtles (Caretta caretta) nesting at Canaveral National Seashore, Florida. J Nat Hist 42:1095–1102. doi:10.1080/00222930701877565.
  38. Rafinesque CS [-Schmaltz]. 1817. Analyse de la nature outableau de I'universitet des corps organises par C.S. Rafinesque. Palerme.
  39. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA. 2018. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Syst Biol 67(5):901–904. doi:10.1093/sysbio/syy032. [DOI] [PMC free article] [PubMed]
  40. Reis EC, Soares LS, Lôbo-Hajdu G. 2010b. Evidence of olive ridley mitochondrial genome introgression into loggerhead turtle rookeries of Sergipe, Brazil. Conserv Genet 11:1587–1591. doi:10.1007/s10592-009-9973-2.
  41. Reis EC, Soares LS, Vargas SM, Santos FR, Young RJ, Bjorndal KA et al. 2010a. Genetic composition, population structure and phylogeography of the loggerhead sea turtle: colonization hypothesis for the Brazilian rookeries. Conserv Genet 11:1467–1477. doi:10.1007/s10592-009-9975-0.
  42. Robinson NJ, Lazo-Wasem EA, Paladino FV, Zardus JD, Pinou T. 2016. Assortative epibiosis of leatherback, olive ridley and green sea turtles in the Eastern Tropical Pacific. J Mar Biol Assoc UK 97(6):1233–1240. doi:10.1017/S0025315416000734.
  43. Serejo CS. 2004. Cladistic revision of talitroidean amphipods (Crustacea, Gammaridea), with a proposal of a new classification. Zool Scr 33:551–586. doi:10.1111/j.0300-3256.2004.00163.x.
  44. Serejo CS, Sittrop DJ. 2009. Hyalidae. Zootaxa 2260:440–452.
  45. Valencia B, Sampson L, Giraldo A. 2018. New record of Hyachelia tortugae Barnard, 1967, an amphipod epibiont on green turtles Chelonia mydas (Linnaeus, 1758) from Gorgona island (Colombian Pacific). Boletín Cientifico del Museo de Historia Natural 22(2):84–89. doi:10.17151/bccm.2018.22.2.7.
  46. Vilaça ST, Vargas SM, Lara-Ruiz P, Molfetti E, Reis EC, Lobo-Hadju G et al. 2012. Nuclear markers reveal a complex introgression pattern among marine turtle species on the Brazilian coast. Mol Ecol 21:4300–4312. doi:10.1111/j.1365-294X.2012.05685.x. [DOI] [PubMed]
  47. Wahl M, Mark O. 1999. The predominately facultative nature of epibiosis: Experimental and observational evidence. Mar Ecol Progr Ser 187:59–66.
  48. Yabut MG, Lazo-Wasem EA, Sterling EJ, Gómez A. 2014. New Records of Hyachelia tortugae Barnard, 1967, and H. lowryi Serejo and Sittrop, 2009 (Amphipoda: Gammaridea: Hyalidae), from Palmyra Atoll National Wildlife Refuge: Cooccurrence on Pacific Green Turtles (Chelonia mydas). Am Mus Novit 3809:1–12. doi:10.1206/3809.1.
  49. Zakhama-Sraieb R, Karaa S, Bradai MN, Jribi I, Charfi-Cheikhrouha F. 2010. Amphipod epibionts of the sea turtles Caretta caretta and Chelonia mydas from the Gulf of Gabès (central Mediterranean). Mar Biodivers Rec 3:e38. doi:10.1017/S1755267210000333.

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Fig. S1.

Maximum likelihood tree of COI+18SrRNA of Hyalidae and outgroups Ampithoidae, Caprellidae, Crangonyctidae, Gammaridae, Hyalellidae and Talitridae. Numbers above branches correspond to bootstrap values above 80%.

(download) (579.3KB, tiff)
Table S1.

Species used in the phylogenetic analyses and accession numbers.

(download) (28KB, ods)

Articles from Zoological Studies are provided here courtesy of Biodiversity Research Center, Academia Sinica

RESOURCES