Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2024 Apr 16.
Published in final edited form as: Methods Mol Biol. 2023;2658:145–165. doi: 10.1007/978-1-0716-3155-3_10

Chemical-Genetic Approaches for Exploring Mode of Action of Antifungal Compounds in the Fungal Pathogen Candida albicans

Nicole Robbins 1, Troy Ketela 2, Sang Hu Kim 1, Leah E Cowen 1,*
PMCID: PMC11019913  NIHMSID: NIHMS1981701  PMID: 37024700

Summary

Candida albicans is a prevalent fungal pathogen of humans that can cause both superficial and life-threatening disease, primarily in immunocompromised populations. Currently, antifungal drug classes available to treat fungal infections remain limited and the emergence of drug-resistant strains threatens antifungal efficacy, necessitating the discovery and development of additional therapeutics. The construction of the C. albicans double-barcoded heterozygous deletion collection (DBC) enables the rapid and systematic assessment of haploinsufficiency phenotypes in a pooled format. Specifically, this functional genomics resource can be used to identify heterozygous deletion mutants that are hypersensitive to compounds in order to define putative cellular targets and/or other modifiers of compound activity. Here, we describe protocols to characterize the mode of action of small molecules using the C. albicans DBC, including how to prepare compound-treated cultures, isolate genomic DNA, amplify strain-specific barcodes, and prepare DNA libraries for high-throughput sequencing. This technique provides a powerful approach to elucidate compound mechanism of action in order to bolster the antifungal pipeline.

Keywords: Candida albicans, haploinsufficiency profiling, chemical genomics, antifungal, molecular barcodes, high-throughput sequencing, PCR

1. Introduction

The threat fungal pathogens pose to human health continues to grow at an alarming pace, with the incidence of invasive mycotic disease increasing by over 200% in recent decades [1, 2]. One of the primary etiological agents of these life-threatening infections is Candida albicans, a commensal that is able to cause life-threatening systemic infections with mortality rates of ~40%, even with current treatments [3]. The surge in fungal disease has unfortunately been coupled with a stagnant antifungal discovery pipeline. Currently, there are four main antifungal drug classes available to treat invasive infections: polyenes, azoles, pyrimidines, and echinocandins, each of which are plagued with issues of drug resistance or host toxicity [4, 5]. Thus, there remains an urgent need to bolster the antifungal discovery pipeline.

Fortunately, recent methodological advances in functional genomics and chemical biology have accelerated the transition from identification of bioactive molecules to target deconvolution. One such approach, termed haploinsufficiency profiling (HIP), operates under the principle that deletion of one allele of an essential target gene in a diploid organism confers hypersensitivity to chemical inhibition [6]. Drug-induced loss of activity of the remaining gene product mimics target depletion, which is observed as a quantifiable growth defect (Figure 1) [7]. Beyond proximal compound targets, reduced expression of other factors involved in a biological process that is targeted by a compound can also confer hypersensitivity to compound inhibition [8]. To maximize the utility of this assay, a double-barcoded heterozygous deletion collection (DBC) was generated in C. albicans where one allele of each gene in the diploid organism is systematically replaced with a HIS3 selectable marker that is flanked with strain-specific molecular barcodes to enable the quantification of individual strains in a mixed population (Figure 2) [9, 10]. Specifically, the molecular barcodes contain common DNA sequences that flank unique 20 base pair sequences specific to a particular strain (Figure 3). These molecular tags are based on those used in the generation of the Saccharomyces cerevisiae deletion collection [6, 11]. In C. albicans, the DBC now includes 5,296 unique heterozygous deletion strains, covering ~83% of the genome and reflecting continued efforts to expand the collection since the foundational publication of the original set of 2,868 strains [9]. In support of its utility, this functional genomics resource has been extensively used in recent years to investigate interactions between genes and small molecules and identify the mechanism of action for compounds with activity against C. albicans [12–16]. Benefits of the pooled chemogenomic format include the consumption of relatively little compound, the efficiency of processing pooled samples compared with profiling thousands of individual mutants, as well as the minimization of technical variation [17–21].

Figure 1:

Figure 1:

Open in a new tab

Haploinsufficiency profiling (HIP) identifies putative compound targets. In C. albicans HIP employs the C. albicans double-barcoded heterozygous deletion collection (DBC), which encompasses both essential and non-essential genes. Individual strains are tagged with two unique DNA barcodes that permit simultaneous analysis within a single pool. The DBC is grown competitively in the absence and presence of a compound of interest. Genomic DNA is isolated after a duration of pooled growth, and PCR amplification of strain-identifying barcodes is performed using universal primers for the upstream or downstream barcodes. High-throughput barcode sequencing and normalization to the untreated pool is used to quantify strain representation.

Figure 2:

Figure 2:

Open in a new tab

The C. albicans double-barcoded heterozygous deletion collection (DBC) was constructed by systematically transforming a wild-type C. albicans strain with a PCR-generated disruption cassette containing a HIS3 selectable marker flanked with appropriate homologous sequence to precisely replace one allele of the target gene. Two distinct barcodes (UP, ‘UPTAG’ and DOWN, ‘DNTAG’) were introduced into the cassette during PCR amplification. Two primer pairs that anneal to the common arms flanking each ‘UPTAG’ (pink) and ‘DNTAG’ (green), enable PCR amplification of the strain-identifying barcodes

Figure 3:

Figure 3:

Open in a new tab

Example of plate layout for genomic DNA quantification using the PicoGreen DNA quantification kit. Red numbers indicate standard DNA concentrations in ng/mL. Coloured wells indicate those containing gDNA samples with blue representing one replicate and green a second replicate for the same gDNA sample.

In this protocol, we provide detailed instructions on how to perform haploinsufficiency profiling experiments with the C. albicans DBC. We systematically describe how to generate a pooled version of the collection, prepare drug-treated cultures, isolate genomic DNA, PCR amplify strain-specific barcodes, prepare DNA for high-throughput sequencing, and analyze sequencing samples. Finally, we provide recommendations for assay optimization and troubleshooting suggestions to help maximize the likelihood of success.

2. Materials

Freshly arrayed copy of C. albicans DBC

YPD medium, sterile: 1% yeast extract, 2% bactopeptone, 2% glucose

50% glycerol, sterile: 50 % glycerol, 50 % ddH2O

Compounds of interest

Solvent used to dissolve compounds of interest (ex. DMSO, methanol)

Zymolase buffer: 1 M sorbitol, 10 mM sodium EDTA, 14 mM β-mercaptoethanol, made fresh

Zymolase

PureLink Genomic DNA kit: Thermo Fischer Scientific cat. no. K182001

PicoGreen DNA quantification kit

Takara Ex-Taq Enzyme: Clonetech cat. no. RR001

dNTP stock from Ex-Taq kit

10X Ex-Taq buffer

Barcode PCR primer mixes

DNA loading dye: Thermo Fischer Scientific cat. no. R0611

Low molecular weight DNA ladder

29:1 30% acrylamide/bis solution

10X TBE

10% Ammonium persulphate

TEMED

SYBR Safe DNA gel stain

10mM Tris-HCl pH8.0

100% ethanol

ddH2O

Ice

96-well cell culture plate, sterile

96-well solid black plates

Plastic pinners, sterile: Singer Instruments cat. no. REP-001

Cryovials

Plastic cuvettes

15 mL falcon tubes

1.5 mL microcentrifuge tubes

0.5 mL microcentrifuge tube

26-gauge needle

Disposable reagent boat

PCR strip tubes

Plastic pipettes, various volumes

2 X 500 mL beaker, sterile (opening should be larger than width of multichannel pipettor)

Sterile 250 mL Erlenmeyer flask

Glass culture tubes, sterile

Saran wrap

Pipettor tips, sterile: p10, p100, p200, p1000

Plugged pipettor tips: p1000, p200, p10

Pipettors

Multichannel pipettor

Clean pipettors exclusively used for DNA isolation and PCR applications

Electronic pipettor

30 °C incubator

Spectrophotometer

Shaking 30 °C incubator

Microcentrifuge

Incubator

Heat block

Thermocycler

Transilluminator

3. Methods

3.1. Preparing Pooled Aliquots of the C. albicans DBC

  1. To prepare pooled aliquots of the C. albicans DBC, dispense 100 μL of YPD medium into each well of a 96-well plate. Repeat until you have 59 plates filled with YPD, enough to pin the entire library. Label each plate from 1–59. It is important to ensure that aliquots of the pooled C. albicans DBC are always prepared from an arrayed copy of the library. Never propagate an existing aliquot of the pool to generate additional aliquots.

  2. Using a freshly arrayed copy of the C. albicans DBC that has been pinned on YPD agar, pin strains using sterile plastic 96-well pinners from agar into YPD liquid medium. Incubate at 30 °C for 24 hours.

  3. Carefully examine the arrayed plates to ensure: i) there are no signs of contamination and ii) all wells that are supposed to contain a strain have adequate growth on the YPD agar. Throughout the library blank wells are present, which can serve as sterility controls. (Ssee Note 1).

  4. Starting with plate 1 column 1, use a multichannel pipettor to gently mix each well. Remove 50 μL of culture (ensuring each pipette tip has picked up the appropriate volume) and dispense into a sterile beaker.

  5. Repeat with columns 2–12 on plate 1.

  6. Repeat steps 4–5 with the remaining plates (2–59) from the library.

  7. Using a 50 mL pipette, mix the pooled culture by aspirating up and down several times. Transfer desired volume (recommended 50–100 mL) into a second sterile beaker.

  8. Aspirate the same volume transferred in step 7 of sterile 50% glycerol. Add this to the second beaker. Mix well.

  9. Aliquot pooled culture-glycerol mixture to cryovials. Store at −80 °C.

  10. Before you dispose of the extra culture from the first beaker, combine 50 μL culture with 950 μL water in a plastic cuvette. Read the OD600 and record. This represents 2X the starting culture OD600 when you thaw aliquots of the C. albicans DBC in the subsequent step.

3.2. Preparing Compound-Treated Cultures

  1. Gently thaw frozen glycerol aliquot of C. albicans DBC pool on ice.

  2. While aliquot is thawing, calculate the volume of culture you will need to set up your experiment. In total 8 mL will be needed per condition (2.5 mL per sample x 3 replicates per condition plus dead volume).

  3. Fill an Erlenmeyer flask with a volume of YPD you have calculated in step 2. Dilute pool to an OD600 equal to 0.05 in the flask. Incubate the culture at 30 °C with shaking for 90 minutes.

  4. While your culture is shaking, prepare 15-mL falcon tubes with 8 mL of YPD containing 2X the desired compound concentration that you predict will cause a 20–30% reduction in growth relative to solvent controls. This can be hard to achieve and at times requires multiple concentrations to be tested (see Note 2). Include a sample with 8 mL of YPD that contains an equal volume of the solvent that your compound is dissolved in. Mix well with vortexing.

  5. Carefully aliquot 2.5 mL of each compound solution into one of three glass culture tubes. These will serve as your technical replicates for each condition.

  6. Once the C. albicans pool has been shaking for 90 minutes, remove from the incubator and carefully add 2.5 mL of culture to each of the glass culture tubes containing compound.

  7. Place all culture tubes back in 30 °C incubator and incubate for ~18 hours with shaking.

  8. After 18 hours, measure the OD600 of each sample. To do so, place 950 μL of water in a disposable plastic cuvette and add 50 μL of culture. Ensure culture should be well mixed prior to removing the 50 μL and ensure the diluted sample is well suspended within the cuvette prior to reading the optical density on the spectrophotometer.

  9. Calculate the average OD600 of your solvent control samples, being sure to take into account the 1:20 dilution that was used to ensure an accurate OD600 reading.

  10. Calculate the average percent inhibition of compound treated samples. The desired inhibition range is 20–30%.

  11. Pellet 500 μL of culture by centrifuging for 1 minute at 13,000 g at room temperature. Aspirate all growth medium to make a dry pellet. This can be performed manually with a pipette or with a vacuum aspirator. Pellets may be frozen at −80°C for later processing or proceed to genomic DNA isolation. Place remaining culture aside in case of extraction failure.

3.3. Genomic DNA Isolation

  1. Resuspend the cell pellet in 500 μl Zymolase Buffer. Add 15 units Zymolase enzyme and incubate at 37 °C for 1 hour to generate spheroplasts.

  2. Centrifuge at 3,000 g for 10 minutes at room temperature to pellet the spheroplasts. Discard the supernatant.

  3. Resuspend the spheroplasts in 180 μL PureLink Genomic Digestion Buffer. Add 20 μL Proteinase K (supplied with the kit). Mix well by brief vortexing (see Note 3).

  4. Incubate at 55 °C for 45 minutes.

  5. Add 20 μL RNase A (supplied in the kit) to the lysate. Mix well by brief vortexing and incubate at room temperature for 2 minutes.

  6. Add 200 μL PureLink Genomic Lysis/Binding Buffer. Mix well by brief vortexing to obtain a homogenous solution.

  7. Add 200 μL 100% ethanol to the lysate. Mix well by vortexing for 5 seconds to yield a homogenous solution. Note, if there is still debris, spin down at max speed and use the supernatant.

  8. Add the lysate to the PureLink Spin Column. Centrifuge the column at 10,000 x g for 1 minute at room temperature.

  9. Discard the collection tube and place the spin column into a clean collection tube supplied with the kit. Add 500 μL Wash Buffer 1 to the column. Centrifuge column at room temperature at 10,000 x g for 1 minute.

  10. Discard the collection tube and place the spin column into a clean collection tube supplied with the kit. Add 500 μL Wash Buffer 2 to the column. Centrifuge the column at maximum speed for 3 minutes at room temperature. Discard collection tube.

  11. Place the spin column in a sterile 1.5-mL microcentrifuge tube. Add 50 μL of PureLink Genomic Elution Buffer to the column. Incubate at room temperature for 1 minute. Centrifuge the column at maximum speed for 1 minute at room temperature. The tube contains purified genomic DNA.

  12. Freeze and store DNA at −20 °C or proceed immediately to DNA quantification.

3.4. Genomic DNA Quantification

  1. Calculate the total number of sample wells that you will be quantifying. For example, 10 standard curve wells, experimental samples in duplicate, 3 extra wells for reagent dead volume (see Note 4).

  2. Prepare 1X TE buffer from the 20X kit stock using DNase-free deionized water. Volume required is 200 μL x the number of wells calculated in Step 1 + 2 mL.

  3. Prepare a working solution of PicoGreen reagent by making a 200-fold dilution of the concentrated PicoGreen solution into an aliquot of the 1X TE prepared in step 2. The volume required is 100 μL x the number of wells required + 100 μL of dead volume. Make this solution in a 15-mL falcon tube and wrap in foil. Use within a few hours of preparation.

  4. Label 5 microcentrifuge tubes as follows: 1000, 100, 10, 1, 0. These tubes will hold the standard curve samples.

  5. Add 294 μL of 1X TE to the tube labeled “1000”. Add 270 μL of 1X TE to the remaining 4 tubes.

  6. Add 6 μL of the kits 100 μg/mL DNA standard stock to the tube labeled “1000”. Mix by vortexing.

  7. Transfer 30 μL from the “1000” tube to the “100” tube. Vortex the “100” tube, then repeat the 10-fold dilution twice more from “100” to “10” and “10” to “1”, using a fresh tip each time. Do not dilute anything into the tube labeled “0”. This serves as the assay blank.

  8. Create a well map for the assay plate as shown in Figure 3. Put your sample replicates side by side or stacked vertically.

  9. Dispense 100 μL from each of the standard tubes into the appropriate wells on the plate. Dispense 99 μL of 1X TE into each well required for your samples.

  10. Using plugged tips and a clean pipettor, aliquot 1 μL from each gDNA sample to the relevant assay well.

  11. Pour the diluted PicoGreen reagent into a disposable reagent boat. Using a multichannel pipettor, aliquot 100 μL of the PicoGreen reagent into wells containing standards and samples. Mix by gentle pipetting 3 times. Use fresh tips between samples.

  12. Cover the plate with foil to avoid exposing the wells to light. Let stand at room temperature for at least ~5 minutes and up to a maximum of 30 minutes.

  13. Using a plate reader, measure the fluorescence of your plate using an excitation wavelength of 480 nm and an emission wavelength of 520 nm. Ensure you set the gain of the instrument so that the sample containing the highest DNA concentration from your standard curve yields a fluorescence reading near the fluorometer’s maximum.

  14. Many plate readers have software containing pre-programmed PicoGreen settings. These can be used to generate a standard curve and to calculate the concentration of your samples. If you are using these software features, ensure that the template standard curve is set with the proper concentrations, 1 ng/mL, 10 ng/mL, 100 ng/mL, 1000 ng/mL. Alternatively, you can take the fluorescence readings obtained from the plate reader, generate your own standard curve, and using the line of best fit calculate the concentration of each sample. When calculating the actual concentration of the gDNA samples, make sure to apply the dilution factor (1 in 200 in this case).

3.5. Barcode PCR

  1. Prepare working stocks of primer mixes by systematically diluting the universal UPTAG PCR primer with each of the UPTAG indexed PCR primers (Figure 4 and Table 1). The final concentration of each primer should be 10 μM. Repeat to generate working stocks of DOWNTAG primer mixes. Clean pipettors, plugged tips, and distilled deionized water used only for PCR assays should be used.

  2. Normalize all of the gDNA samples going into the PCR reactions to the same concentration. 25 ng/μL is recommended (see Note 5).

  3. Use an Excel spreadsheet to record sample and index information (Table 2).

  4. Pre-label PCR strip tubes and place them into a rack on ice to pre-cool before setting up master mixes.

  5. Prepare master mixes in 1.5 mL microcentrifuge tubes on ice using the following recipe. Depending on the number of samples you may need to use a separate tube for UP and DOWN tag master mixes if volume will exceed 1.5 mL.

    Master mix Recipe per sample:
    1. 10X amplification buffer: 5 μL
    2. ExTaq dNTP Mix: 4 μL
    3. ExTaq Enzyme: 0.25 μL
    4. ddH2O: 34.25 μL (this volume may change if the amount of DNA used in step 8 changes).

  6. Aliquot 43.5 μL of master mix into each PCR tube. Be sure to include a negative control (water instead of template).

  7. Add 2.5 μL of primer mix generated in step 1 to the appropriate tube. For each gDNA sample, there should be a PCR tube with an UPTAG primer mix and a separate PCR tube with a DOWNTAG primer mix. These primers need to contain the same Index.

  8. Add gDNA to the appropriate PCR tube. Based on a gDNA dilution of 25 ng/μL generated in step 2 and based on using 100 ng of DNA per reaction, you will add 4 μL of DNA to each well. If the concentration of gDNA or the total amount of DNA per reaction deviate, you will have to adjust the volume of water used to prepare the master mixes is step 5 so the total volume in the PCR tube will still equal 50 μL.

  9. Cap then briefly centrifuge PCR strip tubes to collect all stray liquids. Place them in the thermocycler.

  10. Amplify the barcodes using the following program:

    94 °C 2 minutes.

    94 °C 20 seconds.

    53 °C 20 seconds.

    72 °C 14 seconds.

    Go to 2) 28x

    72 °C 1 minutes.

    4 °C ∞

  11. After the program ends, either begin to process immediately (keeping samples cold) or store at −20 °C for later processing.

Figure 4:

Figure 4:

Open in a new tab

Schematic of strain-specific PCR fragments generated during protocol. A) Universal primers are paired with distinct indexed primers to amplify strain-specific molecular barcodes. Primers anneal to conserved sequences that flank the unique molecular barcodes (pink for UPTAG and green for DOWNTAG). These primers also contain Illumina adapter sequences. B) The resultant PCR fragments that are generated along with a general schematic of where the sequencing primers anneal. C) A more detailed view of the UPTAG PCR amplicon that is generated and where sequencing primers anneal in order to analyze the pooled samples.

Table 1:

Primers Used in Protocol

Primer Name Sequence
Universal UPTAG primer (containing Illumina P5 adapter) AATGATACGGCGACCACCGAGATCTACACCGAGGTCGAGAATGATGTCCACGAGGTCTCT
UPTAG indexed (XXXXXX) primer (containing Illumina P7 adapter) CAAGCAGAAGACGGCATACGAGATXXXXXXGCCATTTGTCTGTCGACCTGCAGCGTACG
Universal DOWNTAG primer(containing Illumina P5 adapter) AATGATACGGCGACCACCGAGATCTACACCACATGATATGTTGAGCGGTGTCGGTCTCGTAG
DOWNNTAG indexed (XXXXXX) primer (containing Illumina P7 adapter) CAAGCAGAAGACGGCATACGAGATXXXXXXGAGTATCTGTATCTGGCCGAGCTCGAATTCATCGAT
UPTAG barcode sequencing primer CGAGGTCGAGAATGATGTCCACGAGGTCTCT
DOWNTAG barcode sequencing primer CACATGATATGTTGAGCGGTGTCGGTCTCGTAG
UPTAG index sequencing primer CGTACGCTGCAGGTCGACAGACAAATGGC
DOWNTAG index sequencing primer ATCGATGAATTCGAGCTCGGCCAGATACAGATACTC
Open in a new tab

Table 2:

Index Sequences Used in Indexed PCR Primers

Index Number Index Sequence
1 ATCACG
2 CGATGT
3 TTAGGC
4 TGACCA
5 ACAGTG
6 GCCAAT
7 CAGATC
8 ACTTGA
9 GATCAG
10 TAGCTT
11 GGCTAC
12 CTTGTA
13 AGTCAA
14 AGTTCC
15 ATGTCA
16 CCGTCC
17 GTAGAG
18 GTCCGC
19 GTGAAA
20 GTGGCC
21 GTTTCG
22 CGTACG
23 GAGTGG
24 GGTAGC
25 ACTGAT
26 ATGAGC
27 ATTCCT
28 CAAAAG
29 CAACTA
30 CACCGG
31 CACGAT
32 CACTCA
33 CAGGCG
34 CATGGC
35 CATTTT
36 CCAACA
37 CGGAAT
38 CTAGCT
39 CTATAC
40 CTCAGA
41 GACGAC
42 TAATCG
43 TACAGC
44 TATAAT
45 TCATTC
46 TCCCGA
47 TCGAAG
48 TCGGCA
Open in a new tab

3.6. Barcode Sequencing Library Creation and Purification

  1. Run 5 μL of each PCR product on a 2% agarose 1X TAE gel for 30 minutes at 110V (Figure 5A). Use a low molecular weight DNA ladder for reference. The yield in each reaction should be very close to, if not perfectly equal across all samples. If not, there was an issue with either your master mix assembly or aliquoting or gDNA concentration/purity. The negative control lane should have no product at all.

  2. Create separate pools for the UPTAGs and DOWNTAGs destined for a sequencing library by combining equal volumes of each sample (excluding the negative control). For highly multiplexed pools (more than 15 samples), 10 μL per sample is sufficient, while for less complex pools (less than 15 samples), 20 μL per sample should be used. It is important to have enough total combined DNA that a good final yield will be obtained after purification.

  3. The pools will be run on and purified from a 5% polyacrylamide 1X TBE mini gel. Use either a pre-cast gel or pour your own. 1.5mm is preferred so that a larger sample volume can be purified (see Note 6).

    Recipe for two mini-sized 5% polyacrylamide 1.5mm gels:

    14.46 mL H2O

    2ml 10X TBE

    3.4 mL 30% acrylamide/bis (29:1 solution)

    140 μL 10% ammonium persulphate

    8 μL TEMED

  4. Make sure that the gel casting plates are very clean and dry. Assemble the casting apparatus before combining the reagents. Make two gels in case the first leaks. See materials for recipe.

  5. Use a pipette to pour ~9.5 mL per gel. Insert comb and let gel set for 30–60 minutes.

  6. Remove comb, rinse wells with distilled deionized H2O and assemble running apparatus. Fill gel reservoir to top and outer chamber ½ way with 1X TBE. Let apparatus sit for 5 min to check for leaks.

  7. Aliquot 100 μL of each pool into a fresh microcentrifuge tube. Add 20 μL of DNA loading dye and mix well (see Note 7).

  8. Load 60 μL in adjacent wells for each pool, leaving an empty well between pools. Be sure to include a low molecular weight ladder on the gel for reference.

  9. Apply 80V (constant voltage) for 60 minutes.

  10. To purify the DNA fragments, a modified crush and soak method is used. While the gel is running, for each sample to be purified, pierce a single small hole directly in the bottom of a rigid walled 0.5 mL microcentrifuge tube using a red-hot (heated by Bunsen flame) 26-gauge needle.

  11. Place the pierced microcentrifuge tubes into labeled 1.5 mL microcentrifuge tubes.

  12. After gel run is complete, disassemble apparatus and transfer the gel to a clean container.

  13. Add 50 mL 1X TBE and 5 μL of undiluted SYBR Safe dye. Gently rock the gel for 20 minutes at room temp to stain the DNA.

  14. Remove gel onto large piece of saran wrap (no de-staining is required)

  15. Quickly (to prevent DNA damage) image gel on a transilluminator to archive an image (Figure 5B).

  16. Using a fresh razor blade for each pool, excise the main band corresponding to each pool. Note that DNTAGs are a few base pairs larger than UPTAGs and will run slightly higher on the gel. Only cut the densely staining main band running near the 150 bp marker, do not include the “smile” portion or additional bands, and ensure that the slice cut is the minimum size possible.

  17. Transfer each gel slice into its appropriate 0.5 mL microcentrifuge tube-1.5 mL microcentrifuge tube apparatus. Centrifuge the tubes for 1 minute at 13,000 g at room temperature. The gel will be finely shredded as it passes through the small hole in the 0.5 mL tube. After centrifugation, all of the gel slices should have completely exited the 0.5mL tubes. If any chunks remain in a 0.5mL tube, re-position the tubes and re-spin.

  18. Discard the 0.5 mL microcentrifuge tubes, add 100 μL of 10mM Tris-HCl pH 8.0 to the pellet of shredded gel in each tube to create a slurry, then cap tubes. If the slurry seems to still be too dry, add up to a further 40 μL. However, the more buffer added, the more diluted the eluted DNA will be.

  19. Incubate tubes overnight at 4 °C with gentle rotation.

  20. The next morning, centrifuge the tubes containing the slurry for 1 minute at 13,000 g to pellet the gel fragments.

  21. Carefully transfer the buffer supernatant to a fresh microcentrifuge tube using a narrow opening pipettor tip (10 μL size is preferred since it tends to clog less with gel). Dig into the pellet and aspirate all of the buffer possible, leaving the pellet dry. Do not worry about aspirating/transferring some of the gel. ~80% of the buffer added the previous day should be recovered.

  22. When all transfers have been completed, centrifuge at max speed and transfer the supernatants to fresh microcentrifuge tubes, this time attempting to not disturb the gel fragment pellet (which should be much smaller than the original pellet). Your samples should now be free of acrylamide gel fragments. Centrifuge again if a gel pellet is still seen. Otherwise, the individual pools are now clean and ready to use.

  23. Quantify each sample, preferably using PicoGreen, and run a small aliquot of each sample on a 2% agarose 1X TAE gel to visualize (Figure 5C).

  24. Create each sequencing library by combining an equal quantity (2 ng/μL in 40 μL) of the matching UPTAG and DOWNTAG pools.

  25. Submit the sample to your sequencing facility with sequencing primers (Table 1 and Figure 4). Note that these primers must be PAGE purified for good performance. You will need to let them know which sample corresponds with which indexed primer sequence (Table 2).

Figure 5:

Figure 5:

Open in a new tab

Agarose and polyacrylamide gels generated throughout the protocol to visualize amplified barcodes. A) Example of a 2% agarose 1X TAE gel used to visualize 8 individual UPTAG barcodes. “–CON” indicates negative (water only) control that did not contain gDNA. B) Example of 5% polyacrylamide gel containing UPTAG and DOWNTAG pooled samples. Suggested excision boundary is boxed in red. C) Example of a 2% agarose 1X TAE gel used to visualize purified UPTAG and DOWNTAG pooled barcode samples after purification. * indicates 150 base pairs.

3.7. Data Analysis

  1. Download the sequencing files provided by your facility. Based on the index sequence information you provided at sample submission, fastq sequencing files should be separated based on your sample.

  2. Barcode sequence reads are mapped to an artificial genome containing known UPTAG and DOWNTAG sequences via Bowtie v1.0 (http://bowtie-bio.sourceforge.net/index.shtml).

  3. Normalize the number of barcode counts for each strain. To do so, divide each barcode count by the sum of all barcode counts for that condition and multiply by 1,000,000.

  4. Check for the correlation between technical replicates as well between UPTAG and DOWNTAG barcodes. Technical replicates should have an R2 value >0.95. Correlation between UPTAG and DOWNTAG should have an R2 value >0.8.

  5. Average the normalized reads for UPTAG and DOWNTAG barcodes for the technical replicates for each condition (see Note 8).

  6. Calculate the fold change between drug-treated and solvent-treated samples. To do so, calculate the log2 value for “UPTAG average drug-treated barcode reads” and the log2 value for “UPTAG average solvent-treated barcode reads”. Subtract log2 drug-treated from log2 solvent-treated samples. Repeat with DOWNTAG values.

  7. Assess significance of differences using median absolute deviation (MAD) calculation.

Figure 6:

Figure 6:

Open in a new tab

Scatterplot depicting the raw barcode reads obtained with a genomic DNA preparation that biases extraction efficiency based on chromosomal location.

Acknowledgements

We thank all members of the Cowen lab for helpful discussions. L.E.C. is supported by the Canadian Institutes of Health Research Foundation Grant (FDN-154288) and a National Institutes of Health NIAID R01 Grant (1R01AI127375-01). L.E.C. is a Canada Research Chair (Tier 1) in Microbial Genomics & Infectious Disease and co-Director of the CIFAR Fungal Kingdom: Threats & Opportunities program.

Footnotes

Note 1: If you are concerned about contamination when propagating the C. albicans DBC library in liquid YPD, you can supplement the YPD with 1X Penicillin-Streptomycin to reduce the likelihood of bacterial growth. If there are strains from the C. albicans DBC collection that did not grow after the 24-hour incubation, hand pick the strains from the YPD agar plates using a sterile toothpick and inoculate the desired well. Allow to grow for an additional 24 hours at 30 °C.

Note 2: As an initial approach to estimate the concentration of compound that will result in a 20–30% growth inhibition of the C. albicans DBC, perform a standard dose-response assay with the parental strain CaSS1 [22]. Use YPD medium and incubate at 30 °C for 24 hours. Once an approximate MIC80 for each compound has been determined, set up culture tubes in step 3.2.4 with several concentrations of compound that are just below the MIC80. For example, if the fluconazole MIC80 was estimated to be 2 μg/mL, try incubating the C. albicans DBC pool with 1.5 μg/mL, 1 μg/mL, and 0.7 μg/mL. Even with this approach, it may take several attempts in order to find an appropriate drug concentration that will inhibit the pool by 20–30%.

Note 3: From past experience, we have noted a chromosome location bias when alternate DNA extraction methods are used. Telomeric barcodes are over-represented while centromeric barcodes are under-represented. This is why we specifically recommend the PureLink Genomic DNA kit from Thermo Fischer Scientific. If you decide to use an alternate DNA extraction method, check for chromosome location bias by plotting the barcode counts after high-throughput sequencing has been performed (Figure 6).

Note 4: We use a sensitive fluorometric method to quantify the DNA content of samples because even with heavy RNase treatment, contaminating RNA will still be present in the sample, therefore spectrophotometric methods such as the Nanodrop will be wildly inaccurate at measuring sample DNA content.

Note 5: It is important to have a reasonable average representation per strain (barcode) in the PCR reactions. Too low of an average representation will result in low abundance strains not being detected well and/or having poor reproducibility across replicate samples and low dynamic range for assessing abundance. The DBC contains ~5,290 strains.

Example representation calculation:

The weight of the C. albicans diploid genome is ~33 fg/cell.

For an average of 1X coverage of the full GRACE pool

33 fg x 5,290=174,570 fg (0.174570 ng)

1000X pool coverage = 0.174570 ng x 1000 = 174.6 ng per PCR reaction

It is recommended to have at least 250X coverage of each strain in the PCR reaction.

Note 6: While a polyacrylamide gel purification is preferred to prepare PCR fragments for high-throughput sequencing, commercial gel extraction kits that utilize agarose gel purification can be used in this step. Care should be taken to ensure for the final elution no EDTA is present in the sample as this will interfere with the sequencing.

Note 7: Not all loading dyes work well with 5% acrylamide 1x TBE gels. Thermo Fisher Scientific #R0611 works well, while NEB #B7021 does not (sample floats out of well and DNA does not run properly).

Note 8: Not all strain-specific barcodes sequence well. As such, select strains will only have sufficient barcode counts for either the UPTAG or DOWNTAG. Ensure that any strains with significantly reduced barcode counts in the solvent sample (less than 20% of the median normalized barcode count) are not used to evaluate the fold-change differences between the drug-treated and solvent-treated samples.

Competing Interests

L.E.C. is a co-founder and shareholder in Bright Angel Therapeutics, a platform company for development of novel antifungal therapeutics. L.E.C. is a consultant for Boragen, a small-molecule development company focused on leveraging the unique chemical properties of boron chemistry for crop protection and animal health.

References

  • 1.Pfaller MA, Diekema DJ. (2010) Epidemiology of invasive mycoses in North America. Crit Rev Microbiol 36(1):1–53. [DOI] [PubMed] [Google Scholar]
  • 2.Martin GS, Mannino DM, Eaton S, Moss M. (2003) The epidemiology of sepsis in the United States from 1979 through 2000. New Engl J Med 348(16):1546–54. [DOI] [PubMed] [Google Scholar]
  • 3.Pfaller MA, Diekema DJ. (2007) Epidemiology of invasive candidiasis: a persistent public health problem. Clin Microbiol Rev 20(1):133–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Robbins N, Wright GD, Cowen LE. (2016) Antifungal drugs: The current armamentarium and development of new agents. Microbiol Spectr 4(5). doi: 10.1128/microbiolspec.FUNK-0002-2016. [DOI] [PubMed] [Google Scholar]
  • 5.Perfect JR. (2017) The antifungal pipeline: a reality check. Nat Rev Drug Disc 16(9):603–16. doi: 10.1038/nrd.2017.46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Giaever G, Shoemaker DD, Jones TW, Liang H, Winzeler EA, Astromoff A, et al. (1999) Genomic profiling of drug sensitivities via induced haploinsufficiency. Nat Genet 21(3):278–83. doi: 10.1038/6791. [DOI] [PubMed] [Google Scholar]
  • 7.Giaever G, Flaherty P, Kumm J, Proctor M, Nislow C, Jaramillo DF, et al. (2004) Chemogenomic profiling: identifying the functional interactions of small molecules in yeast. Proc Natl Acad Sci USA 101(3):793–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Xue A, Robbins N, Cowen LE. (2020) Advances in fungal chemical genomics for the discovery of new antifungal agents. Ann N Y Acad Sci doi: 10.1111/nyas.14484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Xu D, Jiang B, Ketela T, Lemieux S, Veillette K, Martel N, et al. (2007) Genome-wide fitness test and mechanism-of-action studies of inhibitory compounds in Candida albicans. PLoS Pathog 3(6):e92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Roemer T, Jiang B, Davison J, Ketela T, Veillette K, Breton A, et al. (2003) Large-scale essential gene identification in Candida albicans and applications to antifungal drug discovery. Mol Microbiol 50(1):167–81. doi: 3697 [pii]. [DOI] [PubMed] [Google Scholar]
  • 11.Shoemaker DD, Lashkari DA, Morris D, Mittmann M, Davis RW. (1996) Quantitative phenotypic analysis of yeast deletion mutants using a highly parallel molecular bar-coding strategy. Nat Genet 14(4):450–6. doi: 10.1038/ng1296-450. [DOI] [PubMed] [Google Scholar]
  • 12.Mann PA, McLellan CA, Koseoglu S, Si Q, Kuzmin E, Flattery A, et al. (2015) Chemical genomics-based antifungal drug discovery: Targeting glycosylphosphatidylinositol (GPI) precursor biosynthesis. ACS Infect Dis 1(1):59–72. doi: 10.1021/id5000212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Thevissen K, de Mello Tavares P, Xu D, Blankenship J, Vandenbosch D, Idkowiak-Baldys J, et al. (2012) The plant defensin RsAFP2 induces cell wall stress, septin mislocalization and accumulation of ceramides in Candida albicans. Mol Microbiol 84(1):166–80. doi: 10.1111/j.1365-2958.2012.08017.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Xu D, Ondeyka J, Harris GH, Zink D, Kahn JN, Wang H, et al. (2011) Isolation, structure, and biological activities of Fellutamides C and D from an undescribed Metulocladosporiella (Chaetothyriales) using the genome-wide Candida albicans fitness test. J Nat Prod 74(8):1721–30. doi: 10.1021/np2001573. [DOI] [PubMed] [Google Scholar]
  • 15.Xu D, Sillaots S, Davison J, Hu W, Jiang B, Kauffman S, et al. (2009) Chemical genetic profiling and characterization of small-molecule compounds that affect the biosynthesis of unsaturated fatty acids in Candida albicans. J Biol Chem 2009;284(29):19754–64. doi: 10.1074/jbc.M109.019877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Caplan T, Lorente-Macias A, Stogios PJ, Evdokimova E, Hyde S, Wellington MA, et al. (2020) Overcoming Fungal Echinocandin Resistance through Inhibition of the Non-essential Stress Kinase Yck2. Cell Chem Biol doi: 10.1016/j.chembiol.2019.12.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Roemer T, Davies J, Giaever G, Nislow C. (2012) Bugs, drugs and chemical genomics. Nat Chem Biol 8(1):46–56. doi: 10.1038/nchembio.744. [DOI] [PubMed] [Google Scholar]
  • 18.Ho CH, Piotrowski J, Dixon SJ, Baryshnikova A, Costanzo M, Boone C. (2011) Combining functional genomics and chemical biology to identify targets of bioactive compounds. Curr Opin Chem Biol 15(1):66–78. doi: 10.1016/j.cbpa.2010.10.023. [DOI] [PubMed] [Google Scholar]
  • 19.Smith AM, Durbic T, Oh J, Urbanus M, Proctor M, Heisler LE, et al. (2011) Competitive genomic screens of barcoded yeast libraries. J Visual Exp (54). doi: 10.3791/2864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Roemer T, Boone C. (2013) Systems-level antimicrobial drug and drug synergy discovery. Nat Chem Biol 9(4):222–31. doi: 10.1038/nchembio.1205. [DOI] [PubMed] [Google Scholar]
  • 21.Nijman SM. (2015) Functional genomics to uncover drug mechanism of action. Nat Chem Biol 11(12):942–8. doi: 10.1038/nchembio.1963. [DOI] [PubMed] [Google Scholar]
  • 22.Xie JL, Singh-Babak SD, Cowen LE. (2012) Minimum inhibitory concentration (MIC) assay for antifungal drugs. Bio-protocol 2(20):e252. [Google Scholar]

RESOURCES