Abstract
Cyphocharax magdalenae, a Colombian freshwater fish species, plays a vital role in nutrients distribution and serves as a significant food source for other fish species and local fishing communities. Considered a short-distance migratory species, C. magdalenae populations face substantial extinction risk due to human activities impacting their habitats. To address the lack of knowledge on genetic diversity and population structure, this study used next-generation sequencing technology to develop species-specific microsatellite loci and conducted a population genetics analysis of C. magdalenae in the middle and lower sections of the Cauca River, Colombia. Out of 30 pairs of microsatellite primers evaluated in 324 individuals, 14 loci were found to be polymorphic, at linkage equilibrium and, in at least one population, their genotypic frequencies were in Hardy-Weinberg equilibrium. Results showed high genetic diversity levels compared to other neotropical Characiformes, with inbreeding coefficients similar to those reported for phylogenetically related species. Moreover, C. magdalenae exhibits seasonal population structure (rainy-dry) consisting of two genetic stocks showing bottleneck signals and high effective population sizes. This information is essential for understanding the current species genetics and developing future management programs for this fishery resource.
Introduction
The field of ichthyology is marked by a comprehensive fish diversity examination, with 36,775 valid species cataloged to date, 18,688 of which thrive exclusively in freshwater environments [1]. Within this diverse assemblage, the order Characiformes, a significant facet of Ostariophysi, stands out with a notable count of 2,334 valid species confined to freshwater habitats [2]. This taxonomically rich group spans the continents of Africa, South America, Central America, and southern North America, concentrating approximately 90% of its diversity in the Neotropical region [2]. Within Characiformes, the Curimatidae family encompasses 9 genera and 121 valid species distributed in the Neotropics [1]. Cyphocharax Fowler 1906 genus is one of the most abundant, having 47 valid species [1] and wide distribution ranging from the Pacific rivers in southern Costa Rica to the La Plata River and various coastal drainages in central Argentina [3, 4]. It has been found that Atlantic basins have a much more diverse group expanding from the Orinoco River, Amazonas River, rivers from the Guayanas, and eastern Brazil; on the contrary, a less diverse group of species habits rivers from northern Peru to Costa Rica, comprising the tributaries of Magdalena and Maracaibo [5].
Cyphocharax magdalenae (Steindachner 1878) commonly known as “viejito” or “Yalúa” (Fig 1) distributes from the Coto River in southeastern Cosa Rica [6] and Panamá [7, 8], to the Maracaibo lake and its tributaries in Venezuela [9] and Colombia [10]. In Colombia, C. magdalenae is the only species of the genus reported for the Atrato, Sinú, Canalete and Magdalena-Cauca basin [10, 11]. The Cauca River, main tributary of the Magdalena-Cauca basin [12, 13], has great economic importance due to its influence on most of the prioritized productive chains in Colombia, which include small exploitations, extensive industries, monocultures, energy generation, mineral extraction, agriculture and fishing [12, 14, 15]. This has resulted in fish being one of the most threatened biological resources, with few or unknown local priorities on rivers [16].
Fig 1. Photography of Cyphocharax magdalenae, a neotropical freshwater fish.
Courtesy of Jorge E. García-Melo and Luis J. García-Melo, Proyecto CaVFish Colombia.
Cyphocharax magdalenae constitutes 30% of the total population within the lower Magdalena-Cauca floodplains and plays a crucial role in energy, nutrients, coal, and minerals transportation and sediment resuspension in the Cauca basin [15]. This potamodromous species undergoes short-distance reproductive migrations (<100 km) [17], spawns twice a year [11, 15], and lays small (0.73 ± 0.04 mm) adhesive eggs with small perivitelline space [11, 18]. Moreover, this fish has a generation time of 2.6 years [19], lacks parental care for embryos, and does not build nests.
Additionally, the fishing importance of C. magdalenae has been increasing during the last years due to the replacement of traditionally captured species such as catfish Prochilodus magdalenae Steindachner 1879 and Blanquillo Sorubim cuspicaudus Littmann, Burr & Nass 2000 [15, 20]. Although classified as a Least Concern species by The International Union for Conservation of Nature (IUCN), its notable overfishing-caused mortality suggests a possible decrease in its populations [11, 21, 22]. Moreover, C. magdalenae lacks genetic studies that allow knowing the current species status and delving into its ecological processes, which, in turn, hinders the species protection and conservation plans development and application.
The scarce information for C. magdalenae contrasts with population genetic studies performed for Curimata mivartii [23] and species with fishing relevance of the phylogenetically close family Prochilodontidae like Prochilodus magdalenae [24–26], Prochilodus reticulatus [27] and Ichthyoelephas longirostris [28]. Likewise, it contrasts with studies on species of other families inhabiting the Magdalena-Cauca basin such as Pseudoplatystoma magdaleniatum [29, 30], Brycon henni [31–33], S. cuspicaudus, Ageneiosus pardalis, Pimelodus grosskopfii [34], Pimelodus yuma [35], Pseudopimelodus magnus and Pseudopimelodus atricaudus [36]. Among the different markers used in the cited studies, microsatellites stand out as the most used tool to solve questions at micro-evolutive scale in population genetics. In this area, the Single Nucleotide Polymorphisms have been utilized for species delimitation and for exploring genetic introgression in Pimelodus species [37].
To estimate the species genetic status in the lower section of the Cauca River, this study contrasted three hypotheses: (i) C. magdalenae shows signs of genetic deterioration with low genetic variability levels, high inbreeding levels and recent bottlenecks resulting from habitat alterations due to different anthropogenic activities; (ii) the species exhibit high gene flow as a result of the scarce or non-existent geographic barriers in this habitat, which is based on evidence found for other Curimatidae species [23]; and (iii) seasons influencing fish migration in the Cauca River shape the population structure of C. magdalenae. To test these hypotheses, this study identified de novo and characterized species-specific microsatellite loci to C. magdalenae. This approach was chosen instead of using heterologous loci to avoid potential pitfalls associated with cross-amplification [38], such as allele size homoplasy [39], unsuccessful amplification in phylogenetically distant species [40], low polymorphism, presence of null alleles [41], and amplification of non-orthologous loci [42].
Materials and methods
Biological material and study area
This study analyzed a total of 324 muscle tissues and/or fins of C. magdalenae preserved in ethanol 70%, provided between 2019 and 2021 by Universidad de Antioquia, Universidad de Córdoba, and Universidad Nacional de Colombia Sede Medellín, through scientific cooperation agreement CT-2019-000661, under environmental license # 0155 of January 30th, 2009, from Ministry of Environment, Housing and Territorial Development for the Ituango hydroelectric construction.
Samples from individuals were collected in 19 sites of the main channel, some swamps, and tributaries of the lower sections of the Cauca River. This zone, characterized by a large alluvial plain surrounded by mountains and flat and wavy surfaces where various swampy complexes are formed [43, 44], has been exposed to different anthropic activities including stockbreeding, fishing and extensive cultures [see 23]. Additionally, high mercury and sediment levels and elevated vegetation amounts are reported in the main courses of the river as a result of deforestation and flooding that may affect ichthyofauna [45]. According to their distribution, samples were grouped in five sections (S4-S8, Fig 2) previously described by Landínez-García & Márquez (2016) [28].
Fig 2. Sampling sites (stars) of Cyphocharax magdalenae in the lower section of the Cauca River (S4-S8).
Self-made creation of the map based on contour lines scaled 1:100,000 from the Instituto Geográfico Agustín Codazzi source, 2019 (Available from: IGAC Geoportal, https://geoportal.igac.gov.co/contenido/datos-abiertos-cartografia-y-geografia).
Microsatellite loci identification and development of primers
Methodology previously described [23, 28] was followed for developing species-specific microsatellite loci for C. magdalenae. The genomic library was built from total DNA extraction from the fin (5,775 μg) of a C. magdalenae individual captured in the Cauca River (CYPHO11886) using the DNA extraction reagents and recommendations of the manufacturer PureLink genomic DNA Mini Kit (Invitrogen), then it was used for NGS surface sequencing (Whole Genome Sequencing), through Illumina Miseq (300 PE). After raw reads cleaning using PRINSEQ lite (removal of adapter sequences utilizing <Q30 quality bases), 100,000 high-quality extended reads were analyzed with PAL_FINDER v0.02.03 [46] for extracting reads containing tri-, tetra- and pentanucleotide microsatellite motifs. Then, Primer3 v2.0 [47] was used for the primer designs in the flanking sequences of the microsatellite loci and ultimately the correct evaluation of the primers was tested with ePCR [48]. Selection of the microsatellite loci set was performed according to already stablished features for validating new primers of microsatellite loci [49, 50].
For genotyping, 10 μl reaction mixtures were used with final concentrations of 0.3 pmol/μl of each forward primer tagged on the 5’ end with one of four adapters (tails A, B, C and D; [51]), 6 pmol/μl of each reverse primer, 0.5 pmol/μl fluorescently labeled adapter (6-FAM, VIC, NED and PET, Applied Biosystems), 1X Master Mix, 2.5% v/v GC Enhancer Platinum Multiplex PCR Master Mix (Applied Biosystems) and 3–5 μg/μl DNA isolated using the Purelink® purification kit (Thermo Scientific) with a modification in digestion time of 24 h when working with fins. Thermal profiles included an initial denaturalization step at 90°C for 35 s and an annealing step at 56°C for 35 s (with no final elongation). Subsequently, amplicons were separated by electrophoresis on an ABI 3730 XL automated sequencer using 600 LIZ as the internal molecular size. Then, GeneMarker® v3.0.0 was employed to denote allele fragments according to their molecular size (100 to 450 pb) and Micro-Checker v.2.2.3 [52] to detect potential genotyping errors.
Polymorphism, genetic diversity, outlier loci detection, and demographical events
Polymorphism information content (PIC) and average number of alleles per locus for each microsatellite marker were calculated using Cervus v3.0.7 [53] and GenAlEx v6.5.03 [54]. Estimation of observed (HO) and expected (HE) heterozygosities, inbreeding coefficient (FIS) and tests for departures from Hardy-Weinberg equilibrium were performed using Arlequin v3.5.2.2 [55], applying the sequential Bonferroni correction for the statistical significance in the multiple comparisons [56, 57].
For detecting outlier loci and determining evolutive forces acting over the microsatellite loci, BayeScan v2.1 [58] was used for performing an analysis employing the parameters for prior odds of 10:1 for the neutral model, 20 pilot runs, each having 5,000 iterations, followed by 100,000 iterations and a burn-in of 50,000. Critical values were based on the posterior probability of the Bayes factor, following the Jeffrey’s scale [59], which sets a probability of 0.76 as substantial evidence for selection.
To determine recent genetic bottlenecks, excess heterozygosity was tested under the mutation drift equilibrium assumption in three mutational models of the microsatellite loci (IAM: infinite alleles model, SMM: stepwise mutational model, TPM: two-phase model) through Wilcoxon signed rank test [60] included in Bottleneck v.1.2.02 [61]. Moreover, M ratio (mean ratio of the number of alleles to allele size range); [62] included in Arlequin v3.5.2.2 [55] was calculated following the criteria according to which values lower than 0.68 indicate recent and severe reductions in population size [62]. Furthermore, effective population size (Ne) of the species was determined in each of the assessed populations using the linkage disequilibrium method and a minimum allele frequency of 0.02 implemented in NeEstimator v2.1 [63]. Change in HE of the species in 10, 50 and 100 generations (t) was estimated based on the equation [64]. Genetic deterioration grade was stablished using the critical values of 25% Ht reduction in 10 (critically in danger), 50 (in danger) and 100 (vulnerable) generations [65].
Genetic structure
Bayesian analysis of population partitioning in STRUCTURE v.2.3.4 [66] was performed to determine samples grouping according to their co-ancestry coefficient. Parameters included 1,000,000 steps of the Markov chain Monte Carlo; 100,000 iterations were regarded as burn-in to estimate each K value (1–8). Each analysis was repeated 20 times. For better estimating the genetic stocks (K), STRUCTURESELECTOR [67] was used for calculating the ΔK ad hoc statistic [68], estimators MEDMEANK, MAXMEANK, MEDMEDK and MAXMEDK [69], and to graphically represent the results using the integrated CLUMPAK software [70].
Genetic differentiation of C. magdalenae among sections, genetic groups suggested by STRUCTURE, and seasons (rainy and dry) was calculated using the standardized statistics FST[71–73] and Jost’s DEST [74, 75], and Analysis of Molecular Variance (AMOVA) [73] using GenAlEx v6.503 software [54]. Additionally, a Discriminant Analysis of Principal Components (DAPC) was performed in polymorphic loci genotype resulting in 324 analyzed individuals using the R- package Adegenet [76]. Moreover, allele frequency distributions in genetic stocks were assessed through a G-test in Genepop v. 4.7.5. software [77].
Results
Identification of microsatellite loci and detection of outlier loci
Low-coverage genome sequencing raw data provided a total of 3,224,415,544 base pairs (bp), 10,712,344 reads, 41.28%GC and 83.72% Q30. After depuration, 100,000 reads (42,621,284 bp) were obtained, 37,119 out of which had compound repeat motifs, 1,054 interrupted repeat motifs and 71,376 contained microsatellite loci with direct repetitions (53,649 potentially amplifiable loci). Furthermore, 30,120 were validated using electronic PCR.
Out of 30 tested loci, 16 showed clearly defined peaks and absence of stutter bands in the electropherograms; these microsatellite loci include tri- (3) and tetra- (13) nucleotides motifs. Micro-Checker analysis did not indicate stutter-associated genotyping errors nor allele loss in the loci (dropout), and linkage disequilibrium tests were not significant. Departures of allele frequencies from Hardy-Weinberg equilibrium and heterozygote deficits were identified (Table 1). In general, microsatellite loci exhibited allele size between 106 and 414 bp with PIC values ranging from 0.733 to 0.954 and HO and HE between 0.408–0.916 and 0.762–0.957, respectively (Table 1); no outlier loci were detected by Bayescan. Nonetheless, null alleles were found in loci Cym10 and Cym16; thus, they were excluded in subsequent analyses.
Table 1. Primer sequences and features of 16 microsatellite loci selected for Cyphocharax magdalenae.
| Locus | Motif | Primer sequence (5’– 3’) | Range (bp) | Na | PIC | HO | HE | PHWE |
|---|---|---|---|---|---|---|---|---|
| Cym03 | (AAAG)n | F:TGCACTTAAATCCTGTCCATAAGC R:TCTGGATTGAGGCTTGAACG |
212–264 | 13 | 0.733 | 0.716 | 0.762 | 0.000** |
| Cym04 | (ATCT)n | F:TGAGATTCATAAATTGGGAAGAGG R:AAAGGCATGTCTGTGTTGCC |
230–298 | 18 | 0.898 | 0.840 | 0.908 | 0.010* |
| Cym06 | (AAAT)n | F:TCATCTTCCATTATTTGTGCTGG R:GAGGAACGATTTACCCATGC |
224–324 | 23 | 0.920 | 0.819 | 0.926 | 0.000** |
| Cym07 | (ATT)n | F:AGGCTCATTAGTACCAGCAGC R:TGTGCACAACAGGAACATCC |
111–195 | 27 | 0.941 | 0.861 | 0.945 | 0.000** |
| Cym08 | (ATAC)n | F:ACCAAACTGGAAGACAGCCC R:TAAACAACTTCCACACCGGC |
216–332 | 29 | 0.939 | 0.765 | 0.943 | 0.000** |
| Cym10 | (TTC)n | F:TTACTGCGAGCGGACCTACC R:CAGCCAACATGGTTTGTATGG |
236–407 | 40 | 0.929 | 0.647 | 0.935 | 0.000** |
| Cym11 | (AAAT)n | F:AACCCAAGCCTTCAATCAGG R:TGACCAACCGTATCCCTGC |
280–312 | 9 | 0.771 | 0.691 | 0.797 | 0.000** |
| Cym14 | (ATCT)n | F:TGTATGGTTTTGTCATTTGCACC R:CCTCAGGGAGTTATTTGCCG |
215–375 | 35 | 0.954 | 0.842 | 0.957 | 0.000** |
| Cym16 | (ATCT)n | F:GAAAGGGCAAATAACCTACTGC R:ATACCGGTTGTGCTGTGACC |
254–414 | 34 | 0.928 | 0.408 | 0.934 | 0.000** |
| Cym18 | (ATGG)n | F:CAGGGCAAATACTGCCTTCC R:TCCACAAAGAAGGCCACTCC |
185–289 | 27 | 0.922 | 0.873 | 0.928 | 0.023* |
| Cym19 | (TCTG)n | F:TGGCGTATAAACATCAGCGG R:CTGGAACTGCCAAAGATCCC |
157–225 | 17 | 0.846 | 0.851 | 0.861 | 0.530 |
| Cym24 | (ATT)n | F:GCTGGACTTCCATATCCACTCG R:GCTATTTCTTCCCCTGCATCG |
250–325 | 26 | 0.946 | 0.910 | 0.950 | 0.011* |
| Cym25 | (AAAT)n | F:CCCTGCCTTCATTAGCATCC R:CCAGCCTTCCTCTTTCTCCC |
106–198 | 23 | 0.910 | 0.843 | 0.918 | 0.000** |
| Cym26 | (AAAG)n | F:CAACTCGGAGTGACCTACCG R:CTGTGTGGACCGAGTGTTCC |
125–197 | 19 | 0.900 | 0.833 | 0.909 | 0.000* |
| Cym29 | (AATG)n | F:ATCTGGCAGTTTGTCCAGGG R:CAGTGTCCCAGACCGAGACC |
190–234 | 12 | 0.791 | 0.792 | 0.816 | 0.114 |
| Cym30 | (AGTG)n | F:GACGTTCCATCGCTTCATCC R:GAGAGAGTCTGACTGATGACCAGC |
184–236 | 14 | 0.751 | 0.763 | 0.782 | 0.600 |
Na number of alleles per locus; PIC polymorphic information content; HO Observed heterozygosity; HE Expected heterozygosity; PHWE P value of tests for departure from Hardy-Weinberg equilibrium (α: 0.05);
*P < 0.05;
**P < 0.01.
Genetic diversity and demographic events
Genetic diversity estimators (Table 2) showed that S7 had the lower average number of alleles per locus (15.714 alleles/locus) while S5 exhibited the higher mean number (18.857 alleles/locus). Mean HO was lower in S7 (0.772) and higher in S8 (0.827) and mean HE displayed the lower value in S5 (0.880) and the higher in S4 (0.887). Only two (Cym8 and Cym14) out of the 14 selected loci departed from the Hardy-Weinberg equilibrium in four of the five evaluated sections and the remaining fulfilled the assumption in at least two sections. A similar result of genetic diversity was observed in the genetic stocks (Stock1 and Stock2, Table 2) found by the genetic structure Bayesian analysis, as shown below.
Table 2. Genetic diversity of Cyphocharax magdalenae in five sections (S4, S5, S6, S7 and S8) of the Cauca River in Colombia.
| Pop | Cym19 | Cym 4 | Cym3 | Cym29 | Cym25 | Cym7 | Cym24 | Cym14 | Cym8 | Cym30 | Cym11 | Cym6 | Cym18 | Cym26 | Across loci | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| S4 | Na | 14 | 15 | 11 | 9 | 19 | 22 | 24 | 27 | 21 | 11 | 8 | 19 | 19 | 14 | 16.643 |
| HO | 0.956 | 0.822 | 0.773 | 0.778 | 0.711 | 0.800 | 0.886 | 0.841 | 0.791 | 0.844 | 0.667 | 0.795 | 0.800 | 0.889 | 0.811 | |
| HE | 0.878 | 0.910 | 0.756 | 0.801 | 0.920 | 0.947 | 0.950 | 0.957 | 0.924 | 0.781 | 0.830 | 0.903 | 0.926 | 0.912 | 0.885 | |
| PHWE | 0.584 | 0.269 | 0.117 | 0.019* | 0.000** | 0.004** | 0.069 | 0.002** | 0.147 | 0.854 | 0.010* | 0.131 | 0.080 | 0.195 | 0.000** | |
| FIS | -0.090 | 0.098 | -0.023 | 0.029 | 0.229 | 0.157 | 0.068 | 0.123 | 0.145 | -0.083 | 0.199 | 0.120 | 0.137 | 0.026 | 0.076* | |
| S5 | Na | 14 | 15 | 12 | 9 | 22 | 26 | 24 | 32 | 27 | 12 | 9 | 20 | 24 | 18 | 18.857 |
| HO | 0.796 | 0.860 | 0.652 | 0.811 | 0.936 | 0.849 | 0.926 | 0.883 | 0.766 | 0.772 | 0.702 | 0.796 | 0.883 | 0.777 | 0.815 | |
| HE | 0.844 | 0.913 | 0.695 | 0.803 | 0.929 | 0.943 | 0.947 | 0.958 | 0.951 | 0.792 | 0.819 | 0.917 | 0.907 | 0.900 | 0.880 | |
| PHWE | 0.613 | 0.467 | 0.273 | 0.696 | 0.237 | 0.083 | 0.626 | 0.000** | 0.000** | 0.444 | 0.000** | 0.001** | 0.066 | 0.004** | 0.000** | |
| FIS | 0.057 | 0.058 | 0.062 | -0.010 | -0.008 | 0.099 | 0.023 | 0.078 | 0.195 | 0.025 | 0.143 | 0.133 | 0.027 | 0.138 | 0.067* | |
| S6 | Na | 14 | 15 | 10 | 9 | 18 | 25 | 25 | 31 | 25 | 12 | 9 | 20 | 24 | 16 | 18.071 |
| HO | 0.883 | 0.853 | 0.750 | 0.753 | 0.844 | 0.896 | 0.948 | 0.792 | 0.787 | 0.727 | 0.727 | 0.805 | 0.883 | 0.882 | 0.824 | |
| HE | 0.875 | 0.903 | 0.788 | 0.814 | 0.913 | 0.939 | 0.953 | 0.957 | 0.941 | 0.785 | 0.772 | 0.926 | 0.941 | 0.909 | 0.887 | |
| PHWE | 0.698 | 0.019* | 0.306 | 0.116 | 0.006** | 0.091 | 0.039* | 0.000** | 0.004** | 0.208 | 0.000** | 0.004** | 0.172 | 0.131 | 0.000** | |
| FIS | -0.009 | 0.055 | 0.048 | 0.075 | 0.076 | 0.046 | 0.005 | 0.173 | 0.165 | 0.074 | 0.058 | 0.131 | 0.061 | 0.030 | 0.066* | |
| S7 | Na | 12 | 15 | 11 | 10 | 15 | 23 | 21 | 24 | 20 | 10 | 9 | 17 | 18 | 15 | 15.714 |
| HO | 0.865 | 0.806 | 0.811 | 0.806 | 0.730 | 0.811 | 0.778 | 0.838 | 0.622 | 0.722 | 0.568 | 0.806 | 0.865 | 0.784 | 0.772 | |
| HE | 0.848 | 0.917 | 0.794 | 0.815 | 0.894 | 0.947 | 0.944 | 0.950 | 0.933 | 0.779 | 0.790 | 0.933 | 0.915 | 0.923 | 0.884 | |
| PHWE | 0.129 | 0.064 | 0.743 | 0.412 | 0.062 | 0.001** | 0.001** | 0.163 | 0.000** | 0.297 | 0.001** | 0.022* | 0.053 | 0.061 | 0.000** | |
| FIS | -0.020 | 0.123 | -0.021 | 0.012 | 0.186 | 0.146 | 0.179 | 0.120 | 0.337 | 0.074 | 0.284 | 0.138 | 0.056 | 0.152 | 0.120* | |
| S8 | Na | 16 | 18 | 12 | 11 | 21 | 23 | 23 | 29 | 23 | 12 | 7 | 20 | 25 | 16 | 18.286 |
| HO | 0.817 | 0.829 | 0.676 | 0.814 | 0.859 | 0.901 | 0.930 | 0.845 | 0.800 | 0.761 | 0.718 | 0.887 | 0.901 | 0.845 | 0.827 | |
| HE | 0.866 | 0.898 | 0.788 | 0.820 | 0.904 | 0.940 | 0.951 | 0.953 | 0.950 | 0.773 | 0.722 | 0.929 | 0.936 | 0.903 | 0.881 | |
| PHWE | 0.416 | 0.102 | 0.001** | 0.854 | 0.019* | 0.041* | 0.786 | 0.000** | 0.000** | 0.737 | 0.719 | 0.436 | 0.519 | 0.007** | 0.000** | |
| FIS | 0.057 | 0.078 | 0.143 | 0.007 | 0.050 | 0.041 | 0.023 | 0.114 | 0.159 | 0.017 | 0.006 | 0.045 | 0.037 | 0.064 | 0.058* | |
| Stock1 | Na | 15 | 15 | 12 | 9 | 22 | 25 | 25 | 33 | 26 | 13 | 9 | 19 | 25 | 16 | 18.857 |
| HO | 0.895 | 0.856 | 0.696 | 0.768 | 0.860 | 0.850 | 0.956 | 0.886 | 0.805 | 0.723 | 0.702 | 0.830 | 0.886 | 0.816 | 0.823 | |
| HE | 0.861 | 0.899 | 0.740 | 0.783 | 0.893 | 0.939 | 0.942 | 0.956 | 0.945 | 0.774 | 0.785 | 0.906 | 0.926 | 0.896 | 0.875 | |
| PHWE | 0.796 | 0.764 | 0.046* | 0.524 | 0.099 | 0.353 | 0.960 | 0.000** | 0.002** | 0.204 | 0.000** | 0.157 | 0.031* | 0.013* | 0.000** | |
| FIS | -0.039 | 0.048 | 0.060 | 0.020 | 0.038 | 0.096 | -0.015 | 0.073 | 0.148 | 0.065 | 0.106 | 0.084 | 0.043 | 0.090 | 0.051* | |
| Stock2 | Na | 17 | 18 | 12 | 12 | 23 | 26 | 24 | 32 | 29 | 14 | 7 | 23 | 26 | 19 | 20.143 |
| HO | 0.828 | 0.832 | 0.726 | 0.806 | 0.833 | 0.867 | 0.885 | 0.818 | 0.743 | 0.785 | 0.686 | 0.813 | 0.867 | 0.842 | 0.809 | |
| HE | 0.860 | 0.910 | 0.773 | 0.815 | 0.896 | 0.942 | 0.948 | 0.956 | 0.941 | 0.786 | 0.696 | 0.930 | 0.928 | 0.888 | 0.876 | |
| PHWE | 0.905 | 0.028* | 0.026* | 0.280 | 0.078 | 0.070 | 0.023* | 0.000** | 0.000** | 0.839 | 0.771 | 0.001** | 0.003** | 0.061 | 0.000** | |
| FIS | 0.038 | 0.086 | 0.061 | 0.011 | 0.070 | 0.080 | 0.067 | 0.145 | 0.211 | 0.002 | 0.015 | 0.125 | 0.066 | 0.051 | 0.071* |
Na number of alleles per locus; HO y HE Observed and expected heterozygosities, respectively; FIS inbreeding coefficient; PHWE P statistical significance for the Hardy-Weinberg test (α: 0.05).
*P < 0.05;
**P < 0.01.
Moreover, the inbreeding coefficients across loci in each population showed statistical significance with greater impact in population S7 (FIS = 0.120, P = 0.000). These values, although remained significant, significantly decreased in the stocks (FISStock1 = 0.051, P = 0.000; FISStock2 = 0.071, P = 0.000).
It was found that assessed populations recently suffered a drastic reduction in population size since both the modified Garza-Williamson index (M-ratio: 0.238–0.256) and P values of the Wilcoxon signed rank test for the IAM and the TPM showed statistical significance (Table 3). Results for SMM, however, were not significant.
Table 3. Bottleneck tests and effective population size (Ne) of Cyphocharax magdalenae in the five sampling sections and genetic stocks of the Magdalena-Cauca basin.
Statistical significance is noted in bold (P<0.05).
| Pop | IAM1 | SMM1 | TPM1 | M-ratio2 | Ne3 |
|---|---|---|---|---|---|
| S4 | 0.000** | 0.879 | 0.052 | 0.238 | 316 (166.4–1997.1) |
| S5 | 0.000** | 0.852 | 0.021* | 0.256 | ∞ (1194.3–∞) |
| S6 | 0.000** | 0.620 | 0.000** | 0.248 | 1869.2 (470.5–∞) |
| S7 | 0.000** | 0.932 | 0.015* | 0.243 | 223.9 (116.1–1571.6) |
| S8 | 0.000** | 0.966 | 0.039* | 0.250 | 233590.8 (692.8–∞) |
| Stock1 | 0.000** | 0.988 | 0.052 | 0.252 | 1464.6 (567.7–∞) |
| Stock2 | 0.000** | 0.979 | 0.002** | 0.257 | ∞ (2127–∞) |
| Overall | 0.000** | 0.891 | 0.000** | 0.262 | (1314.5–10252.9) |
1P values of the Wilcoxon signed rank test of one tail in IAM, SMM and TPM;
2M-ratio < 0.68 denote recent reductions in the population;
3IC 95% using the Jackknife method (Waples & Do, 2008).
* P < 0.05;
**P < 0.01
Furthermore, the effective size calculation in each sampled section showed the lower values in S4 and S7 and the higher in S6 and S8; nevertheless, it was not possible to obtain a value for S5, and estimation was obtained only for one of the genetic stocks (Stock1) (Table 3). Due to the latter, in subsequent analyses the lower limits of confidence intervals were used for S5 and Stock2.
For all evaluated generations, the species is classified as non-threatened as no reduction percentage reached 25% (critical value of the classification) (Table 4). S8 showed the lower reduction percentage in all generations (0.002, 0.011, 0.021); nevertheless, S7 and S4 exhibited the greater loss of heterozygosity percentage in 100 generations with 20.034 and 14.645, respectively. Moreover, in the evaluation on genetic stocks, no approximation surpassed the 5% reduction in all generations; in fact, similar values were found in each stock for each generation, although Stock1 showed slightly higher values.
Table 4. Estimation of the change in HE of Cyphocharax magdalenae in 10, 50 and 100 generations.
| Pop | t | Ht reduction | Ht reduction (%) |
|---|---|---|---|
| S4 | 10 | 0.014 | 1.571 |
| 50 | 0.067 | 7.612 | |
| 100 | 0.130 | 14.645 | |
| S5 | 10 | 0.004 | 0.418 |
| 50 | 0.018 | 2.072 | |
| 100 | 0.036 | 4.101 | |
| S6 | 10 | 0.002 | 0.267 |
| 50 | 0.012 | 1.329 | |
| 100 | 0.023 | 2.640 | |
| S7 | 10 | 0.020 | 2.211 |
| 50 | 0.093 | 10.576 | |
| 100 | 0.177 | 20.034 | |
| S8 | 10 | 0.000 | 0.002 |
| 50 | 0.000 | 0.011 | |
| 100 | 0.000 | 0.021 | |
| Stock1 | 10 | 0.003 | 0.341 |
| 50 | 0.015 | 1.693 | |
| 100 | 0.029 | 3.357 | |
| Stock2 | 10 | 0.002 | 0.235 |
| 50 | 0.010 | 1.169 | |
| 100 | 0.020 | 2.324 |
Genetic structure
It was found that the most likely number of populations (ΔK) based on the Bayesian inference approach was 2. These two groups coexist in all sampled sections as confirmed by the co-ancestry histogram (Fig 3A). Additionally, it was observed that Stock1 predominates in sections S4 and S5 (pink), while Stock2 (purple) predominates in sections S6, S7 and S8. This was corroborated by the DAPC, showing that the two genetic stocks were not homogeneously distributed (Fig 3B and 3C); only just one similarity was found in the distribution of the tested individuals in sections S6 and S7 (Fig 3B). Differences in the frequencies of the stocks agree with results obtained in AMOVA (F´ST (4, 647) = 0.003, P = 0.001) and the pairwise comparisons of the standardized statistics F’ST, DEST (Table 5), which showed significant differences between S8 in relation to the remaining sections, and S6 in relation to S4 and S5.
Fig 3. Results of Bayesian inference of structure (a) and discriminant analysis of principal components of Cyphocharax magdalenae: (b) Five sections evaluated (c) Two genetic stocks.
Table 5. Pairwise comparisons of the genetic structure estimators of Cyphocharax magdalenae.
Jost’s DEST (above diagonal) and F’ST (below diagonal).
| Pop | S4 | S5 | S6 | S7 | S8 |
| S4 | - | 0.000 | 0.031* | 0.014 | 0.082* |
| S5 | 0.005 | - | 0.019* | 0.007 | 0.042* |
| S6 | 0.007* | 0.004* | - | 0.000 | 0.020* |
| S7 | 0.008 | 0.006 | 0.006 | - | 0.037* |
| S8 | 0.010* | 0.006* | 0.005* | 0.008* | - |
* Statistical significance.
Genetic structure comparison by collect season (rainy: April-June, October-December; dry: January-March, July-August; Serna et al., 2021) and sampling years, in addition to confirming the coexistence of two genetic stocks within the evaluated sections of the Cauca River (ΔK = 2, Mean LnP(K) = -22763.31000, MEDMEANK, MAXMEANK, MEDMEDK = 2; Fig 4A), revealed that during rainy seasons, the capture percentage was greater for Stock2 during the sampled years (2020: 91.7%; 2021: 94.3%), while Stock1 was primarily captured during dry season (2020: 67%; 2021: 58.8%) in comparison to the moderated captures of Stock2 (2020: 33%; 2021: 41.2%) (Fig 4B).
Fig 4. Temporal structure of Cyphocharax magdalenae during 2019–2021 in the middle and lower sections of the Cauca River (A) and percentage of each stock by season and year of capture (B).
Rainy season (H): H_20: October 2020; H_21(1): April 2021; H_21(2): December 2021; Dry season (S): S_19: July-August-September 2019; S_20: February 2020; S_21: January 2021.
Discussion
To test three hypotheses related to the population genetics of C. magdalenae, this study developed a set of 16 polymorphic microsatellite loci capable of detecting diversity levels and genetic structure in the lower section of the Cauca River. The selected microsatellite loci were preferably those having tri- and tetranucleotide repetition motifs as these repetition patterns are the most recommended for their simplicity for genotyping and allele classification [46, 78, 79]. All microsatellite loci exhibited PIC values that allow describing them as highly informative according to Bostein et al., 1980 [80]; moreover, these values were higher than those reported for C. mivartii (0.549–0.946), I. longirostris (0.375–0.871) and P. magdalenae (0.399–0.949) [23, 26, 28].
Results obtained do not support the hypothesis of low genetic variability levels in C. magdalenae as it showed high alleles/locus and HE mean values in relation to those reported for neotropical Characiformes (Na: 10.92, HE: 0.675) [81]. As this is the first study performed for Cyphocharax genus, high diversity was found in comparison to C. mivartii (Na: 10.493, HO: 0.757, HE: 0.801), a Curimatidae species with which it shares its habitat [23]. Likewise, C. magdalenae displayed greater values over the two estimators with respect to I. longirostris (Na: 8.84–11. 05, HO: 0.701–0.767, HE: 0.771–0.798; [28]) and similar values to those reported for P. magdalenae (Na: 22.455, HO: 0.725, HE: 0.898; [26]) in the Cauca River. Even more, C. magdalenae showed greater values in alleles/locus and similar HE values compared to P. magdalenae, in rivers with great importance for Colombia, such as San Jorge (Na: 13.545, HO: 0.809; HE: 0.884), Sinú (Na: 15.273, HO: 0.767, HE: 0.882), Atrato (Na: 14.636, HO: 0.718, HE: 0.879), Nare (Na: 15.636, HO: 0.659; HE: 0.876), and Magdalena (Na: 19.455, HO: 0.758; HE: 0.896). C. magdalenae also exhibited much greater HE values than P. reticulatus (HE: 0.400) even though this estimator was calculated based on a different molecular marker [27].
Furthermore, the hypothesis of high inbreeding levels in C. magdalenae was not confirmed since the species showed inbreeding signals below 10% in each genetic stock (FIS Stock1 = 0.051; FIS Stock2 = 0.071). Although these values do not exceed the proposed limit [82, 83], it has been indicated that any inbreeding coefficient greater than cero has unfavorable effects on the fitness [84]. Considering these results and those reported for Characiformes in the Magdalena-Cauca basin using species specific microsatellites, C. magdalenae exhibited inbreeding levels relatively similar to those reported for C. mivartii (0.040–0.087; [23]), lower values to those described for P. magdalenae (0.125–0.255; [26]), and greater to those found in Brycon henni (-0.040 –-0.009; [33]), a phylogenetically farther species.
Additionally, this study corroborated the hypothesis of high gene flow despite having found significant differences among individuals of the lower section of the Cauca River as those differences are related to the coexistence of two genetic stocks with uneven distribution through the river. This indicates that there is no evidence of barriers separating the gene flow of C. magdalenae in the lower section of the Cauca River, which is consistent with data reported for C. mivartii [23], P. magdalenae [26], Cynopotamus magdalenae (Steindachner 1879), Megaleporinus muyscorum [85] and catfishes A. pardalis, P. grosskopfii, S. cuspicaudus [86], P. magdaleniatum [30], P. atricaudus and P. magnus [36]. Nonetheless, genetic structure resulting from seasonal variation was found since comparisons over the samples in rainy and dry seasons during the assessed years allowed detecting that one stock predominates in the dry season (Stock1) while the other predominates in the rainy season (Stock2). Sampling in both seasons for two years reflects an alternated cyclical behavior between both stocks and greater proliferative advantage of Stock2 over Stock1, which suggests a differential reproductive success leading to different cohorts (temporal Wahlund effect). These results are similar to those reported for Prochilodus lineatus (Valenciennes 1837) in the Mogi-Guaçu River in Brazil as individuals analyzed between 2005 and 2006 in rainy and dry seasons (January and August, respectively) showed evidence of temporal genetic structure [87]. Furthermore, it was found that Salminus brasiliensis (Cuvier 1816) in the Uruguay River in Brazil is formed by three genetic stocks resulting from a temporal genetic structure in which seasonal precipitations in the river are one of the main factors that could have originated genetic groups as the water level is fundamental in reproductive migration [88].
Furthermore, this study supports the hypothesis of a recent genetic bottleneck in C. magdalenae. These results may be a consequence of the joint action of various anthropogenic activities impacting the environment, directly affecting C. magdalenae individuals, or climatic changes. For instance, for The IUCN, C. magdalenae shows a decrease in its populations due to fishing pressure [11, 21, 22], which is consistent with the decline of this species reported in the Magdalena basin, with a diminishment in 887.7 tones unloaded for 2019 [21] in comparison to 436.1 tons for 2021 [22]. Moreover, there is no current regulation on a recommended or suggested minimum catch size for this species [89]; in fact, it was found that between 2018–2021 catch size ranges were lower than those described for size at maturity [22].
As it has been proposed for other species [86], contamination with mining-derived products could be affecting the viability of C. magdalenae, which is supported by evidence of methylmercury in fishes collected in the zone [45]. Another threat is the establishment of introduced exotic species [11, 90], such as Basa fish Pangasianodon hypophthalmus, a omnivorous species of fast size and weight growth, and having extension in Colombia, mainly in the Magdalena-Cauca basin [90], and the Nile Tilapia Oreochromis niloticus, which has the capacity to survive in all types of habitats, from salty, marine waters to estuarine and continental waters with temperatures between 8 and 42°C [90]. Despite the introduction of O. niloticus in Colombia was done with commercial purposes and control of Oreochromis mossambicus, an aggressive behavior against native species P. magdalenae has been displayed [91] and, after its introduction, there has been a reduction in the abundance of Triportheus magdalenae (Steindachner 1878) in the Guajaro reservoir in Magdalena [92].
In addition to the anthropogenic activities, it has been documented that the impact of climate factors has provoked changes in fish populations as they are responsible for abrupt changes in environments such as high temperatures, alterations of hydrological cycles, dissolved oxygen reduction, changes in mortality rates, growth, reproduction and distribution of fish populations [93]. This climate factor has also been used for explaining population genetics aspects of C. mivartii [23] and P. magdalenae [26].
Contrary to the bottleneck evidence, estimations performed over Ne (Stock1: 1464.6, Stock2: 2127) were higher than the critical value (Ne ≤ 1000), which allows deducting that the species has long term maintenance [84]. In conjunction with the previously mentioned high genetic diversity levels, this result suggests that C. magdalenae populations are large enough to sustain elevated genetic diversity and Ne, despite exhibiting signals of bottleneck. This idea is also supported by the results of the conservation status test as even in 100 generations (260 years: species with generational time of 2.6 years) [19] estimations did not show evidence of heterozygosity reductions greater than 25% (critical value of the classification), for which the species can be listed as non-threatened. This classification, however, should be interpreted carefully since it has been indicated that between 4–10% of freshwater species in South America are exposed to some extinction risk, mainly due to habitat loss or degradation [94].
To conclude, this study allowed determining that C. magdalenae in the lower section of the Cauca River exhibits seasonal population structure formed by two genetic stocks associated to the rainy and dry seasons, and which show high genetic diversity, low inbreeding coefficients, bottleneck signals and large Ne. Data obtained along with the microsatellite loci developed de novo in this study are a starting point for future research directed to monitoring the genetic diversity and population structure of this species to develop proper management plans.
Supporting information
First row indicates respectively: Number of loci, Number of individuals, Number of sampling sections, Sample size for five sections. Third row indicates respectively: Sample ID, Sampling section, Genetic stock, Locus name for 14 loci.
(XLSX)
Na number of alleles per locus; HO Observed heterozygosity; HE Expected heterozygosity.
(XLSX)
Acknowledgments
The authors express their gratitude to Universidad de Antioquia, Universidad de Córdoba, and Universidad Nacional de Colombia Sede Medellín for providing the fish tissue samples, and to the Proyecto CaVFish Colombia—Catálogo Visual de Peces de Agua Dulce de Colombia (cavfish.unibague.edu.co)—for providing the photograph of Fig 1.
Data Availability
All relevant data are within the manuscript and its Supporting information files.
Funding Statement
This study was supported by a grant framed under the Project “Variabilidad genética de un banco de peces de los sectores medio y bajo del río Cauca” (CT-2019-000661, Empresas Públicas de Medellín and Universidad Nacional de Colombia, Sede Medellín). Funders do not play any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Fricke R, Eschmeyer WN. Fong JD. 2023 Species by family/subfamily. 2024 Feb 03. http://researcharchive.calacademy.org/research/ichthyology/catalog/SpeciesByFamily.asp.
- 2.Toledo-Piza M, Baena EG, Dagosta FCP, Menezes DA, Andrade M, Benine RC, et al. Checklist of the species of the Order Characiformes (Teleostei: Ostariophysi). Neotrop Ichthyol. 2024;22(1): e230086. doi: 10.1590/1982-0224-2023-0086 [DOI] [Google Scholar]
- 3.Maldonado-Ocampo JA, Vari RP, Usma JS. Checklist of the Freshwater Fishes of Colombia. Biota Colomb 9. 2008;9: 1–12. [Google Scholar]
- 4.Melo BF, Sidlauskas BL, Hoekzema K, Vari RP, Dillman CB, Oliveira C. Molecular phylogenetics of Neotropical detritivorous fishes of the family Curimatidae (Teleostei: Characiformes). Mol Phylogenet Evol. 2018;127: 800–812. doi: 10.1016/j.ympev.2018.06.027 [DOI] [PubMed] [Google Scholar]
- 5.Vari RP, Zanata AM, Camelier P. New species of Cyphocharax (Ostariophysi: Characiformes: Curimatidae) from the Rio de Contas Drainage, Bahia, Brazil. Copeia. 2010; 382–387. doi: 10.1643/CI-09-140 [DOI] [Google Scholar]
- 6.Angulo A, Garita-Alvarado CA, Bussing WA, López MI. Annotated checklist of the freshwater fishes of continental and insular Costa Rica: Additions and nomenclatural revisions. Check List. 2013;9: 987–1019. doi: 10.15560/9.5.987 [DOI] [Google Scholar]
- 7.Smith SA, Bell G, Bermingham E. Cross-Cordillera exchange mediated by the Panama Canal increased the species richness of local freshwater fish assemblages. Proc R Soc B Biol Sci. 2004;271: 1889–1896. doi: 10.1098/rspb.2004.2796 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Vega AJ, Robles YA, Tuñón O, Barrera C. Fauna acuática del área centro occidental de Panamá. Tecnociencia. 2006;8: 87–100. [Google Scholar]
- 9.Vari RP. Systematics of the Neotropical Genus Cyphocharax Fowler (Pisces: Ostariophysi). Smithsonian Contributions to Zoology. Washington, D.C; 1992. http://www.bioone.org/doi/abs/10.2994/SAJH-D-13-00022.1 [Google Scholar]
- 10.DoNascimiento C, Agudelo-Zamora HD, Bogotá-Gregory JD, Méndez-López A, Ortega-Lara A, Lasso C, et al. Lista de especies de peces de agua dulce de Colombia / Checklist of the freshwater fishes of Colombia. v2.16. Asociación Colombiana de Ictiólogos. Dataset/Checklist. 2024. Available from: doi: 10.15472/numrso [DOI] [Google Scholar]
- 11.Lasso CA, Gutiérrez F de P, Morales-Betancourt MA, Agudelo E, Ramírez-Gil H, Ajiaco-Martínez RE, editors. II. Pesquerías continentales de Colombia: cuencas del Magdalena-Cauca, Sinú, Canalete, Atrato, Orinoco. Bogotá: Instituto de Investigación de los Recursos Biológicos Alexander von Humboldt; 2011. http://hdl.handle.net/20.500.12324/19395 [Google Scholar]
- 12.González-López N, Carvajal-Escobar Y. Characterization of hydrological drought in the Cauca River high valley. Tecnol. cienc. agua. 2020;11: 235–264. doi: 10.24850/j-tyca-2020-01-06 [DOI] [Google Scholar]
- 13.Cerón WL, Kayano MT, Ocampo-Marulanda C, Canchala T, Rivera IA, Ávila-Díaz A, et al. Spatio-temporal variability of hydroclimatology in the upper Cauca River basin in southwestern Colombia: Pre-and post-Salvajina dam perspective. Atmosphere (Basel). 2021;12. doi: 10.3390/atmos12111527 [DOI] [Google Scholar]
- 14.Carvajal Y, Enciso A, Sandoval M. Hydrological analysis of historical floods in the upper valley of Cauca River. Ing. compet. 2016;18: 46. doi: 10.25100/iyc.v18i1.2176 [DOI] [Google Scholar]
- 15.Jiménez-Segura L, Lasso CA, editors. XIX. Peces de la cuenca del río Magdalena, Colombia: diversidad, conservación y uso sostenible. Serie Editorial Recursos Hidrobiológicos y Pesqueros Continentales de Colombia. Instituto de Investigación de Recursos Biológicos Alexander von Humboldt; 2020. pp. 115–157. 2020. doi: 10.21068/a2020rrhhxix [DOI] [Google Scholar]
- 16.Hernández-Barrero S, Barco MV, Reyes CGB, Paramo J, Sierra LS, Stotz W. Is traditional fisheries management correctly addressing the possible causes of fish production decline? The relationship between environmental degradation and artisanal river fisheries in the Magdalena River basin, Colombia. Mar Freshw Res, 2022; 73(12):1475–1488. [Google Scholar]
- 17.Usma Oviedo JS, Villa-Navarro F, Lasso CA, Castro F, Zúñiga-Upegui PT, Cipamocha CA, et al. Peces dulceacuícolas Migratorios de Colombia. In: Zapata LA, Usma JS. Guía de las especies migratorias de la biodiversidad en Colombia. Peces. Vol. 2. Bogotá: Ministerio de Ambiente y Desarrollo Sostenible, WWF-Colombia; 2013. p.215–441. [Google Scholar]
- 18.Atencio-García VJ, Montes-Petro CD, Tapia-Pacheco CJ, Madariaga-Mendoza DL, Posada-González M, Ramírez-Guerra A, et al. Desarrollo embrionario y larvario de viejito Cyphocarax magdalenae. XVI Congreso Colombiano de Ictiología. ACICTIOS. 2022; Barranquilla, 27–29 de julio. https://acictios.org/congreso-colombiano-de-ictiologia-2022-memorias/
- 19.Puentes V, Escobar FD, Polo CJ, Alonso JC, editors. Estados de los principales recursos pesqueros de Colombia 2014. Oficina de Generación del Conocimiento y la Información, Autoridad Nacional de Acuicultura y Pesca–AUNAP; 2014. http://hdl.handle.net/20.500.12324/34405
- 20.Blanco H V, Solipá J, Olaya-Nieto CW, Segura-Guevara FF, Brú-Cordero SB, Tordecilla-Petro G. Crecimiento y mortalidad de la Yalúa (Cyphocharax magdalenae Steindachner, 1878) en el río Sinú, Colombia. Rev MVZ Córdoba. 2005;10: 555–563. http://www.scielo.org.co/scielo.php?script=sci_arttext&pid=S0122-02682005000100005&lang=es%0Ahttp://www.scielo.org.co/pdf/mvz/v10n1/v10n1a05.pdf [Google Scholar]
- 21.Duarte LO, Manjarrés–Martínez L, Reyes-Ardila H. Estadísticas de desembarco y esfuerzo de las pesquerías artesanales e industriales de Colombia entre febrero y diciembre de 2019. Autoridad Nacional de Acuicultura y Pesca. Bogotá; 2019. http://sepec.aunap.gov.co/Archivos/Boletines-2019/Boletin_Pesca_Consumo_artesanal_industrial_2019.pdf [Google Scholar]
- 22.Duarte LO, Cuervo C, Vargas O, Gil-Manrique B, Tejeda K, De León G, et al. Estadísticas de desembarco y esfuerzo de las pesquerías artesanales de Colombia 2021. Santa Marta; 2021. http://sepec.aunap.gov.co/Archivos/Boletines-2021/SEPEC_Boletin_Desembarco_Artesanal_2021.pdf [Google Scholar]
- 23.Landínez-García RM, Marquez EJ. Microsatellite loci development and population genetics in neotropical fish Curimata mivartii (Characiformes: Curimatidae). PeerJ. 2018; 12–17. doi: 10.7717/peerj.5959 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Aguirre-Pabón J, Narváez Barandica J, Castro García L. Mitochondrial DNA variation of the bocachico Prochilodus magdalenae (Characiformes, Prochilodontidae) in the Magdalena River Basin, Colombia. Aquat Conserv. 2013;23: 594–605. doi: 10.1002/aqc.2339 [DOI] [Google Scholar]
- 25.Berdugo GO, Barandica JCN. Genetic diversity and population structure of bocachico Prochilodus magdalenae (Pisces, Prochilodontidae) in the Magdalena river basin and its tributaries, Colombia. Genet Mol Biol. 2014;37: 37–45. doi: 10.1590/S1415-47572014000100008 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Landínez-García RM, Narváez JC, Márquez EJ. Population genetics of the freshwater fish Prochilodus magdalenae (Characiformes: Prochilodontidae), using species-specific microsatellite loci. PeerJ. 2020; 1–26. doi: 10.7717/peerj.10327 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Macias JNL, Vallejo FG, Rincón ER, Giraldo AC, Cerón F. Diversidad genética del bocachico (Prochilodus reticulatus) de la cuenca alta del río Cauca (Colombia). Acta Biol Parana. 2009;38. doi: 10.5380/abpr.v38i0.16928 [DOI] [Google Scholar]
- 28.Landínez-García RM, Márquez EJ. Development and characterization of 24 polymorphic microsatellite loci for the freshwater fish Ichthyoelephas longirostris (Characiformes: Prochilodontidae). PeerJ. 2016;4: e2419. doi: 10.7717/peerj.2419 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Gallo H, Díaz-sarmiento J. Variabilidad genética del bagre rayado Pseudoplatystoma fasciatum (Pisces: Pimelodidae) en el río magdalena. Rev Acad Colomb Cienc Exactas Fis Nat. 2003;105: 599–605. [Google Scholar]
- 30.García-Castro KL, Rangel-Medrano JD, Landínez-García RM, Márquez EJ. Population genetics of the endangered catfish Pseudoplatystoma magdaleniatum (Siluriformes: Pimelodidae) based on species-specific microsatellite loci. Neotrop Ichthyol. 2021;19: 1–15. doi: 10.1590/1982-0224-2020-0120 [DOI] [Google Scholar]
- 31.Pineda H, Arboleda L, Echeverry A, Urcuqui S, Pareja D, Oliveria M, et al. Caracterización de la diversidad genética en el pez Brycon henni (Characiformes: Characidae) en Colombia central por medio de marcadores RAPD. Rev Biol Trop. 2007;55: 1025–1035. [PubMed] [Google Scholar]
- 32.Hurtado-Alarcón JC, Mancera-Rodríguez NJ, Saldamando-Benjumea CI. Variabilidad genética de Brycon henni (Characiformes: Characidae) en la cuenca media de los ríos Nare y Guatapé, sistema Río Magdalena, Colombia. Rev Biol Trop. 2011;59: 269–282. [PubMed] [Google Scholar]
- 33.Landínez-García RM, Márquez EJ. Population genetics of the fish Brycon henni (Characiformes: Bryconidae) using species-specific polymorphic microsatellite loci. Rev Biol Trop. 2020;68: 847–861. doi: 10.15517/RBT.V68I3.38405 [DOI] [Google Scholar]
- 34.Restrepo-Escobar N, Márquez EJ. Microsatellite loci development for three catfish species from Northwestern South America. Neotrop Ichthyol. 2020;18: 1–16. doi: 10.1590/1982-0224-2019-0079 [DOI] [Google Scholar]
- 35.Joya CD, Landínez-García RM, Márquez EJ. Development of microsatellite loci and population genetics of the catfish Pimelodus yuma (Siluriformes: Pimelodidae). Neotrop Ichthyol. 2021;19: 1–15. doi: 10.1590/1982-0224-2020-0114 [DOI] [Google Scholar]
- 36.Rangel-Medrano JD, Márquez EJ. Development of microsatellite loci and population genetics in the bumblebee catfish species Pseudopimelodus atricaudus and Pseudopimelodus magnus (Siluriformes: Pseudopimelodidae). Neotrop Ichthyol. 2021;19: 1–15. doi: 10.1590/1982-0224-2020-0053 [DOI] [Google Scholar]
- 37.Martínez JG, Rangel-Medrano JD, Yepes-Acevedo AJ, Restrepo-Escobar N, Márquez EJ. Species limits and introgression in Pimelodus from the Magdalena-Cauca River basin. Mol Phylogenet Evol. 2022; 173:107517. doi: 10.1016/j.ympev.2022.107517 [DOI] [PubMed] [Google Scholar]
- 38.Primmer CR, Painter JN, Koskinen MT, Palo JU, Merilä J. Factors affecting avian cross-species microsatellite amplification. J Avian Biol. 2005;36: 348–360. doi: 10.1111/j.0908-8857.2005.03465.x [DOI] [Google Scholar]
- 39.Estoup A, Jarne P, Cornuet JM. Homoplasy and mutation model at microsatellite loci and their consequences for population genetics analysis. Mol Ecol. 2002; 11(9):1591–604. doi: 10.1046/j.1365-294x.2002.01576.x [DOI] [PubMed] [Google Scholar]
- 40.Barbará T, Palma-Silva C, Paggi GM, Bered F, Fay MF, Lexer C. Cross-species transfer of nuclear microsatellite markers: Potential and limitations. Mol Ecol. 2007;16: 3759–3767. doi: 10.1111/j.1365-294X.2007.03439.x [DOI] [PubMed] [Google Scholar]
- 41.Rutkowski R, Sielezniew M, Szostak A. Contrasting levels of polymorphism in cross-amplified microsatellites in two endangered xerothermophilous, obligatorily myrmecophilous, butterflies of the genus Phengaris (Maculinea)(Lepidoptera: Lycaenidae). Eur J Entomol. 2009; 106(4): 457–469. doi: 10.14411/eje.2009.058 [DOI] [Google Scholar]
- 42.Yue G-H, Kovacs B, Orban L. A new problem with cross-species amplification of microsatellites: generation of non-homologous products. Zool Res. 2010;31: 131–140. doi: 10.3724/SP.J.1141.2010.02131 [DOI] [PubMed] [Google Scholar]
- 43.Mejía O, Betancur T, Londoño L. Aplicación de técnicas geoestadísticas en la hidrogeología del bajo Cauca antioqueño. Dyna. 2007;74 (152): 137–149. [Google Scholar]
- 44.Betancur T, Mejía O, Palacio C. Modelo hidrogeológico conceptual del Bajo Cauca antioqueño: un sistema acuífero tropical. Rev Fac Ing. 2009; 107–118. [Google Scholar]
- 45.Cruz-Esquivel Á, Marrugo-Negrete J. Concentraciones de metilmercurio en Prochilodus magdalenae (Teleostei: Curimatidae) y Hoplias malabaricus (Teleostei: Erythrinidae) en la cuenca baja del río Cauca-Magdalena, norte de Colombia. Acta Biol Colomb. 2022;27: 28–35. doi: 10.15446/abc.v27n1.83092 [DOI] [Google Scholar]
- 46.Castoe TA, Poole AW, Gu W, Jason de Koning AP, Daza JM, Smith EN, et al. Rapid identification of thousands of copperhead snake (Agkistrodon contortrix) microsatellite loci from modest amounts of 454 shotgun genome sequence. Mol Ecol Resour. 2010;10: 341–347. doi: 10.1111/j.1755-0998.2009.02750.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Rozen S, Skaletsky H. Primer3 on the World Wide Web for general users and for biologist programmers. In: Misener S, Krawetz S, editors. Bioinformatics Methods and Protocols. New Jersey: Humana Press; 2000. pp.365–386. [DOI] [PubMed] [Google Scholar]
- 48.Rotmistrovsky K, Jang W, Schuler GD. A web server for performing electronic PCR. Nucleic Acids Res. 2004;32: 108–112. doi: 10.1093/nar/gkh450 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Fernández-Silva I, Whitney J, Wainwright B, Andrews KR, Ylitalo-Ward H, Bowen BW, et al. Microsatellites for Next-Generation Ecologists: A Post-Sequencing Bioinformatics Pipeline. PLoS One. 2013;8. doi: 10.1371/journal.pone.0055990 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Schoebel CN, Brodbeck S, Buehler D, Cornejo C, Gajurel J, Hartikainen H, et al. Lessons learned from microsatellite development for nonmodel organisms using 454 pyrosequencing. J Evol Biol. 2013;26: 600–611. doi: 10.1111/jeb.12077 [DOI] [PubMed] [Google Scholar]
- 51.Blacket MJ, Robin C, Good RT, Lee SF, Miller AD. Universal primers for fluorescent labelling of PCR fragments-an efficient and cost-effective approach to genotyping by fluorescence. Mol Ecol Resour. 2012;12: 456–463. doi: 10.1111/j.1755-0998.2011.03104.x [DOI] [PubMed] [Google Scholar]
- 52.Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004;4: 535–538. doi: 10.1111/j.1471-8286.2004.00684.x [DOI] [Google Scholar]
- 53.Marshall TC, Slate J, Kruuk LEB, Pemberton JM. Statistical confidence for likelihood-based paternity inference in natural populations. Mol Ecol. 1998;7: 639–655. doi: 10.1046/j.1365-294x.1998.00374.x [DOI] [PubMed] [Google Scholar]
- 54.Peakall R, Smouse PE. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes. 2006;6: 288–295. doi: 10.1111/j.1471-8286.2005.01155.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Excoffier L, Laval G, Schneider S. Arlequin (version 3.0): An integrated software package for population genetics data analysis. Evol Bioinform Online. 2005;1: 117693430500100. doi: 10.1177/117693430500100003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Holm S. A simple sequentially rejective multiple test procedure. Scand Stat Theory Appl. 1979;6: 65–70. [Google Scholar]
- 57.Rice WR. Analyzing Tables of Statistical Tests. Evolution. 1989;43: 223–225. doi: 10.1111/j.1558-5646.1989.tb04220.x [DOI] [PubMed] [Google Scholar]
- 58.Foll M, Gaggiotti O. A genome-scan method to identify selected loci appropriate for both dominant and codominant markers: A Bayesian perspective. Genetics. 2008;180: 977–993. doi: 10.1534/genetics.108.092221 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Nagin DS. Analyzing developmental trajectories: A semiparametric, group-based approach. Psychol Methods. 1999;4: 139–157. doi: 10.1037/1082-989X.4.2.139 [DOI] [PubMed] [Google Scholar]
- 60.Luikart G, Cornuet JM. Empirical evaluation of a test for identifying recently bottlenecked populations from allele frequency data. Conserv Biol. 1998;12: 228–237. doi: 10.1046/j.1523-1739.1998.96388.x [DOI] [Google Scholar]
- 61.Piry S, Luikart G, Cornuet JM. BOTTLENECK: A computer program for detecting recent reductions in the effective population size using allele frequency data. J Hered. 1999;90: 502–503. doi: 10.1093/jhered/90.4.502 [DOI] [Google Scholar]
- 62.Garza JC, Williamson EG. Detection of reduction in population size using data from microsatellite loci. Mol Ecol. 2001;10: 305–318. doi: 10.1046/j.1365-294x.2001.01190.x [DOI] [PubMed] [Google Scholar]
- 63.Do C, Waples RS, Peel D, Macbeth GM, Tillett BJ, Ovenden JR. NeEstimator v2: Re-implementation of software for the estimation of contemporary effective population size (Ne) from genetic data. Mol Ecol Resour. 2014;14: 209–214. doi: 10.1111/1755-0998.12157 [DOI] [PubMed] [Google Scholar]
- 64.Crow JF, Kimura M. Introduction to population genetics theory. New York: Harper & Row; 1970. [Google Scholar]
- 65.Willoughby JR, Sundaram M, Wijayawardena BK, Kimble SJA, Ji Y, Fernandez NB, et al. The reduction of genetic diversity in threatened vertebrates and new recommendations regarding IUCN conservation rankings. Biol Conserv. 2015;191: 495–503. doi: 10.1016/j.biocon.2015.07.025 [DOI] [Google Scholar]
- 66.Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155: 945–959. doi: 10.1093/genetics/155.2.945 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Li Y-L, Liu J-X. StructureSelector: a web-based software to select and visualize the optimal number of clusters by using multiple methods. Mol Ecol Resour. 2018;18: 176–177. doi: 10.1111/1755-0998.12719 [DOI] [PubMed] [Google Scholar]
- 68.Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol Ecol. 2005;14: 2611–2620. doi: 10.1111/j.1365-294X.2005.02553.x [DOI] [PubMed] [Google Scholar]
- 69.Puechmaille SJ. The program structure does not reliably recover the correct population structure when sampling is uneven: Subsampling and new estimators alleviate the problem. Mol Ecol Resour. 2016;16: 608–627. doi: 10.1111/1755-0998.12512 [DOI] [PubMed] [Google Scholar]
- 70.Kopelman NM, Mayzel J, Jakobsson M, Rosenberg NA, Mayrose I. CLUMPAK: a program for identifying clustering modes and packaging population structure inferences across K. Mol Ecol Resour. 2015;15: 1179–1191. doi: 10.1111/1755-0998.12387 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Wright S. Isolation by distance. Genetics. 1943;28: 114. doi: 10.1093/genetics/28.2.114 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Wright S. The interpretation of population structure by F-statistics with special regard to systems of mating. Evolution. 1965;19: 395–420. [Google Scholar]
- 73.Meirmans PG. Using the Amova framework to estimate a standardized genetic differentiation measure. Evolution. 2006;60: 2399–2402. doi: 10.1554/05-631.1 [DOI] [PubMed] [Google Scholar]
- 74.Jost L. GST and its relatives do not measure differentiation. Mol Ecol. 2008;17: 4015–4026. doi: 10.1111/j.1365-294x.2008.03887.x [DOI] [PubMed] [Google Scholar]
- 75.Meirmans PG, Hedrick PW. Assessing population structure: FST and related measures. Mol Ecol Resour. 2011;11: 5–18. doi: 10.1111/j.1755-0998.2010.02927.x [DOI] [PubMed] [Google Scholar]
- 76.Jombart T. Adegenet: A R package for the multivariate analysis of genetic markers. Bioinformatics. 2008;24: 1403–1405. doi: 10.1093/bioinformatics/btn129 [DOI] [PubMed] [Google Scholar]
- 77.Rousset F. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour. 2008;8: 103–106. doi: 10.1111/j.1471-8286.2007.01931.x [DOI] [PubMed] [Google Scholar]
- 78.Castoe TA, Poole AW, De Koning AJ, Jones KL, Tomback DF, Oyler-McCance, et al. Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake. PloS One. 2012;7(2): e30953. doi: 10.1371/journal.pone.0030953 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Guichoux E, Lagache L, Wagner S, Chaumeil P, Léger P, Lepais O, et al. Current trends in microsatellite genotyping. Mol Ecol Resour. 2011;11: 591–611. doi: 10.1111/j.1755-0998.2011.03014.x [DOI] [PubMed] [Google Scholar]
- 80.Bostein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet. 1980;32: 314–331. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1686077/ [PMC free article] [PubMed] [Google Scholar]
- 81.Hilsdorf AWS, Hallerman EM. Genetic resources of neotropical fishes. Genetic Resources of Neotropical Fishes. Switzerland: Springer International Publishing; 2017. [Google Scholar]
- 82.Franklin IR. Evolutionary changes in small populations. In: Soulé M, Wilcox B, editors. Conservation biology: an evolutionary-ecological prospective. Sunderland: Sinauer Associates; 1980. pp. 135–149. [Google Scholar]
- 83.Soulé ME. Thresholds for Survival: Maintaining Fitness and Evolutionary Potential. In: Soulé M, Wilcox B, editors. Conservation Biology: An Evolutionary-Ecological Perspective. Sunderland: Sinauer Associates; 1980. pp. 151–169. [Google Scholar]
- 84.Frankham R, Bradshaw CJA, Brook BW. Genetics in conservation management: Revised recommendations for the 50/500 rules, Red List criteria and population viability analyses. Biol Conserv. 2014;170: 56–63. doi: 10.1016/j.biocon.2013.12.036 [DOI] [Google Scholar]
- 85.Márquez EJ., Restrepo-Escobar N, Yepes-Acevedo AJ, Narváez-Barandica JC. Diversidad y estructura genética de los peces de la cuenca del Río Magdalena, Colombia. In: Jiménez-Segura L, Lasso CA, editors. Peces de la cuenca del río Magdalena, Colombia: diversidad, conservación y uso sostenible. Serie Editorial Recursos Hidrobiológicos y Pesqueros Continentales de Colombia. Instituto de Investigación de Recursos Biológicos Alexander von Humboldt; 2020. pp. 115–157. doi: 10.21068/a2020rrhhxix [DOI] [Google Scholar]
- 86.Restrepo-Escobar N, Yepes-Acevedo AJ, Márquez EJ. Population genetics of three threatened catfish species in heterogeneous environments of the Cauca River, Colombia. Neotrop Ichthyol. 2021;19: 1–18. doi: 10.1590/1982-0224-2020-0040 [DOI] [Google Scholar]
- 87.Rosa IF, Oliveira DJ, Cruz VP, Ashikaga FY, Costa GO, Doretto LB, et al. Temporal genetic structure of a stock of Prochilodus lineatus (Characiformes: Prochilodontidae) in the Mogi-Guaçu River ecosystem, São Paulo, Brazil. Neotrop Ichthyol. 2022;20: 1–18. doi: 10.1590/1982-0224-2021-0156 [DOI] [Google Scholar]
- 88.Ribolli J, Hoeinghaus DJ, Johnson JA, Zaniboni-Filho E, de Freitas PD, Galetti PM. Isolation-by-time population structure in potamodromous Dourado Salminus brasiliensis in southern Brazil. Conserv Genet. 2017;18: 67–76. doi: 10.1007/s10592-016-0882-x [DOI] [Google Scholar]
- 89.AUNAP-UNIMAGDALENA. Tallas mínimas de captura para el aprovechamiento sostenible de las principales especies de peces, crustáceos y moluscos comerciales de Colombia. 2013. http://sepec.unimagdalena.edu.co/Archivos/Cartilla - TALLAS MINIMAS_Digital (2).pdf
- 90.Lasso CA, Escobar MD, Herrera J, Castellanos MC, Valencia-Rodríguez D, Campuzano J, et al. Peces introducidos en el río Magdalena y cuencas vecinas, Colombia. In: Jiménez-Segura L, Lasso CA, editors. XIX. Peces de la cuenca del río Magdalena, Colombia: diversidad, conservación y uso sostenible. Serie Editorial Recursos Hidrobiológicos y Pesqueros Continentales de Colombia. Instituto de Investigación de Recursos Biológicos Alexander von Humboldt; 2020.pp. 295–367. [Google Scholar]
- 91.Rico G. Fauna exótica e invasora en Colombia. Instituto de Investigación de Recursos Biológicos Alexander von Humboldt. 2010. 71pp. [Google Scholar]
- 92.Caraballo P, Gandara M. El sector pesquero en el departamento de sucre, Colombia. Rev Colombiana cienc Anim RECIA. 2009;1: 273–278. [Google Scholar]
- 93.Serna-lópez JP, Cañón-barriga JE. Projecting the future of Ayapel Cienaga: A hydroecologic analysis under climate change scenarios. Rev Fac Ing Univ Antioquia. 2020; 73–87. doi: 10.17533/udea.redin.20190940 [DOI] [Google Scholar]
- 94.Reis RE, Albert JS, Di Dario F, Mincarone MM, Petry P, Rocha LA. Fish biodiversity and conservation in South America. J Fish Biol. 2016;89: 12–47. doi: 10.1111/jfb.13016 [DOI] [PubMed] [Google Scholar]




