Skip to main content
Plant Biotechnology Journal logoLink to Plant Biotechnology Journal
. 2024 Jan 9;22(5):1417–1432. doi: 10.1111/pbi.14276

A newly evolved rice‐specific gene JAUP1 regulates jasmonate biosynthesis and signalling to promote root development and multi‐stress tolerance

Adnan Muzaffar 1,2,3, , , Yi‐Shih Chen 3,4, , , Hsiang‐Ting Lee 1,2,3,4, , # , Cheng‐Chieh Wu 5, , # , Trang Thi Le 3, Jin‐Zhang Liang 3,6, Chun‐Hsien Lu 3,7, Hariharan Balasubramaniam 3,8, Shuen‐Fang Lo 9, Lin‐Chih Yu 3, Chien‐Hao Chan 3, Ku‐Ting Chen 3, Miin‐Huey Lee 10, Yue‐Ie Hsing 5, Tuan‐Hua David Ho 4,5, Su‐May Yu 1,2,3,4,7,8,10,
PMCID: PMC11022792  PMID: 38193234

Summary

Root architecture and function are critical for plants to secure water and nutrient supply from the soil, but environmental stresses alter root development. The phytohormone jasmonic acid (JA) regulates plant growth and responses to wounding and other stresses, but its role in root development for adaptation to environmental challenges had not been well investigated. We discovered a novel JA Upregulated Protein 1 gene (JAUP1) that has recently evolved in rice and is specific to modern rice accessions. JAUP1 regulates a self‐perpetuating feed‐forward loop to activate the expression of genes involved in JA biosynthesis and signalling that confers tolerance to abiotic stresses and regulates auxin‐dependent root development. Ectopic expression of JAUP1 alleviates abscisic acid‐ and salt‐mediated suppression of lateral root (LR) growth. JAUP1 is primarily expressed in the root cap and epidermal cells (EPCs) that protect the meristematic stem cells and emerging LRs. Wound‐activated JA/JAUP1 signalling promotes crosstalk between the root cap of LR and parental root EPCs, as well as induces cell wall remodelling in EPCs overlaying the emerging LR, thereby facilitating LR emergence even under ABA‐suppressive conditions. Elevated expression of JAUP1 in transgenic rice or natural rice accessions enhances abiotic stress tolerance and reduces grain yield loss under a limited water supply. We reveal a hitherto unappreciated role for wound‐induced JA in LR development under abiotic stress and suggest that JAUP1 can be used in biotechnology and as a molecular marker for breeding rice adapted to extreme environmental challenges and for the conservation of water resources.

Keywords: jasmonate, rice, root development, ABA, abiotic stress, grain yield

Introduction

Climate change is shifting weather patterns to more extremes, aggravating global crop productivity that has already plateaued (Lucas, 2003). As much as half of global crop yield loss is likely caused by stressful environments (Vogel et al., 2019), and this scenario is worsening due to multifactorial stress combinations. Understanding how adverse environments impact plant growth and devising strategies to improve crop resilience against environmental stresses are not only fundamental scientific endeavours, but they are also of vital importance to agricultural production and food security.

Like abscisic acid (ABA), jasmonic acid (JA) plays an important role in promoting plant defence against abiotic stresses (Ali and Baek, 2020). JA and its methyl ester (MeJA) and isoleucine conjugates (JA‐Ile) are linolenic acid derivatives collectively referred to as jasmonates (JAs). JAs regulate plant growth and development, secondary metabolism, immunity and responses to environmental challenges (Ruan et al., 2019). Under normal low‐JA or JA‐absent conditions, the Jasmonate Zinc Finger Inflorescence Meristem (ZIM)‐domain (JAZ) protein binds to and inhibits the activity of several transcription factors that regulate downstream JA‐responsive genes (Ruan et al., 2019). Upon stress stimulation or during developmental processes, endogenous JA‐Ile accumulates and binds to both JAZ and Coronatine Insensitive 1 (COI1, an F‐box protein), thereby promoting formation of an SCFCOI1‐JA‐Ile‐JAZ co‐receptor complex (Sheard et al., 2010), leading to degradation of JAZ and activation of transcription factors that induce genes involved in biotic and abiotic stress defence and plant development (Ruan et al., 2019).

The plant root architecture is essential for water and nutrient uptake, anchorage and interactions with microbes in soil; all functions that impact growth rate, abiotic stress tolerance and yield. The root architecture also profoundly affects the capacity of plants to adapt to water limitation, with the majority of drought‐tolerant rice varieties having a deeper, thicker and more highly branched root system than drought‐sensitive varieties (Price et al., 1997; Uga et al., 2013). Cereals form a complex root system comprising embryonic seminal roots (SRs), shoot/node‐born crown roots (CRs) and lateral roots (LRs) that originate from SRs and CRs (Coudert et al., 2010). In rice, CRs constitute a framework for the whole root system and LRs comprising a large proportion of the entire root system are responsible for water and nutrient adsorption (Gowda et al., 2011). Thus, understanding the mechanism regulating LR development is of agronomic importance.

Several hormones co‐regulate LR development, with auxin being the primary signalling hormone and other hormones and stresses regulating the biosynthesis, transport and functions of auxin (Jung and McCouch, 2013). For instance, MeJA regulates auxin biosynthesis and transport, as well as LR development, in Arabidopsis (Sun et al., 2009), and high ABA concentrations and drought suppress the auxin transport, signalling and cellular localization necessary for lateral root primordia (LRP) initiation and development in both Arabidopsis and rice (Chen et al., 2015; Jung and McCouch, 2013). Previously, we showed that ectopic expression of HVA1 that encodes a small group 3 late embryogenesis abundant protein (LEA3) derived from barley, under the control of an ABA/stress‐inducible promoter (ABRC321), alleviated ABA‐ and osmotic stress‐mediated suppression of LR development, correlating with high‐level HVA1 protein and auxin accumulation in root apical meristem and LRP founder cells under ABA treatments (Chen et al., 2015). Nevertheless, the detailed mechanism of auxin, JA and ABA signalling crosstalk that regulates LR development remains mostly unclear.

Rice is a staple food of nearly half of the world's population, and its production must be significantly increased to secure food supply for the rapidly growing global population over the next few decades. On average, of the 160 million hectares of rice farmland globally, over 30% is affected by drought (Panda et al., 2021; Shi et al., 2023), 23% by salinity (Kumar et al., 2021) and 10% by low temperature (Shi et al., 2023). Thus, establishing new strategies for breeding multi‐stress‐tolerant rice while retaining high productivity remains an important research endeavour. Enhancing root development to optimize crop performance under adverse environments is an important component of crop improvement strategies. Representing a significant step toward that end, we have identified JAUP1 that is upregulated by HVA1. Our study has revealed several unique and interesting features of JA and JAUP1, including that: (i) JAUP1 is a recently evolved novel gene unique to the rice genome; (ii) JAUP1 plays an important role in the wound‐induced function of JA in root development; (iii) JAUP1 regulates a feedforward loop for JA biosynthesis and signalling and the establishment of multi‐stress tolerance; (iv) JA/JAUP1 and auxin signalling crosstalk enhances LR development; and (v) elevated expression of JAUP1 enhances multi‐stress tolerance and reduces yield loss in rice under limited water supply.

Results

JAUP1 is a newly evolved gene and only exists in Oryza species with AA and BB genomes

Our previous study showed that genes essential for root development and abiotic stress tolerance are both highly induced in HVA1‐overexpressing (HVA1‐Ox) transgenic rice in the absence of ABA (Chen et al., 2015), indicating that the signalling process regulating root development and abiotic stress tolerance may have been amplified in the HVA1‐Ox lines. To identify ABA‐independent but HVA1‐upregulated genes that are involved in root development under abiotic stress, we performed microarray analyses on roots from an HVA1‐Ox line treated with or without ABA. We identified a total of 135 genes in both root tips and whole roots that are upregulated upon HVA1 overexpression in the absence of ABA (Figure S1), with JAUP1 (LOC_Os07g26100.1) being the most highly upregulated gene.

JAUP1 encodes a previously uncharacterized protein of unknown function, with no discernible similarity to any DNA or amino acid sequences or predicted protein structures in databases or the published literatures, or to those from organisms or even cereals other than rice, indicating that JAUP1 is a rice tribe‐specific gene that has evolved recently. JAUP1 and its homologue JAUP2 are present on chromosomes 7 and 4, respectively, of the japonica rice genome. The coding regions of these two JAUPs are identical, and their 5′ and 3′ untranslated regions (UTRs) differ only by a few nucleotides (Figure S2). We conducted BLAST analysis of the JAUP1 nucleotide sequence against 13 available Oryzae reference genomes (Stein et al., 2018) and uncovered that JAUP1 is present only in Oryza species with AA and BB genomes and that it has been duplicated only in the O. sativa vg. japonica subgroup (Table 1). JAUP1 and its homologues in Oryza AA and BB genomes share 89% to 100% sequence identity in coding regions. However, nucleotide substitutions, deletions or insertions might have generated partial JAUP1 homologues in some species (Table 1; Figure S3).

Table 1.

JAUP1 and its homologues are present only in the Oryza species with AA and BB genomes

Oryza species (cultivar) Genome type Transcript ID Coding sequence identity (%) Coding sequence length (bp) Predicted amino acid number
O. sativa vg. japonica AA Os07t0442800‐01 (Chromosome 7) 100.00 552 183
O. sativa vg. japonica AA Os04t0115200‐01 (Chromosome 4) 100.00 552 183
O. sativa vg. indica (93–11) AA BGIOSGA024386‐TA 97.83 552 183
O. nivara AA ONIVA04G07330.1 98.01 552 183
O. rufipogon AA 100.00 552 183
O. glaberrima AA ORGLA07G0107100.1 95.66 538 a
O. barthii AA OBART07G12660.1 96.02 538 a
O. glumaepatula AA 98.19 552 183
O. longistaminata AA 98.19 552 183
O. punctata BB 89.45 493 Partial b
O. brachyantha FF 0
Leersia perrieri Outgroup 0
Brachypodium distachyon Outgroup 0
a

A 15‐bp deletion and one nucleotide insertion at the 59th nucleotide in the coding sequence of the JAUP1 homologue led to a frameshift in the O. glaberrima and O. barthii JAUP1 homologues.

b

A 59‐bp deletion at the 3′ end of the coding sequence of the JAUP1 homologue in O. punctata led to a truncation in the C‐terminus.

We ascertained the phylogenetic relationships among JAUP1 homologues, supporting previous assessments of rice genome evolution (Stein et al., 2018). Sister relationships were identified between O. sativa vg. japonica and its wild relative O. rufipogon, between O. sativa vg. indica and its wild relative O. nivara, and between O. glaberrima and O. barthii (Figure S4). Due to its 59‐base pair (bp) deletion, JAUP1 of O. punctata is most distantly related to other Oryza homologues.

Ectopic expression of JAUP1 alleviates ABA‐ and salt‐mediated suppression of root growth and confers multi‐stress tolerance

We confirmed that JAUP1 expression was induced by salt, drought and cold, but not by ABA, in rice seedlings (Figure 1a). GUS staining of transgenic rice carrying JAUP1:GUS showed that the JAUP1 promoter was active in embryos and endosperms of dry and imbibed seeds, and became highly active in seedling roots (Figure 1b).

Figure 1.

Figure 1

JAUP1 overexpression alleviates ABA‐ and salt‐mediated suppression of root growth and confers multi‐stress tolerance. (a) Fourteen‐day‐old seedlings were treated with 5 μM ABA, 150 mm NaCl or 4 °C for 24 h, or air‐dried for 4 h. RNA was purified from root tips and subjected to qRT‐PCR analysis. LEA3 was used as a positive control for ABA, NaCl and drought treatments, and ICE1 was used as a control for cold treatment. Values represent mean ± SD (n = 3). (b) Transgenic rice seeds carrying the JAUP1:GUS construct were germinated and the seedlings were stained for GUS expression. Growth stages up to day 4 after imbibition (in box) have been enlarged. O: outside. I: inside. (c–e) JAUP1‐Act and JAUP1‐Ox seedlings were treated with various concentrations of ABA or 150 mm NaCl for 10 days. (f–h) Fourteen‐day‐old seedlings were subjected to cold (4 °C), dehydration, or 200 mm NaCl treatments. (i) Fourteen‐day‐old seedlings grown in vermiculite were subjected to dehydration. Plant height was shorter in the JAUP1‐Ox1 line than in WT.

We obtained a JAUP1‐activated mutant, JAUP1‐Act, in which a T‐DNA with enhancers is inserted 252 bp downstream of the 3′ UTR (Figure S5a). Previously, we showed that root growth in wild‐type (WT) rice was inhibited by ABA concentrations ≧0.2 μm (Chen et al., 2015). We found that length and LR number, as well as the density of SRs and CRs, were significantly greater in the JAUP1‐Act line relative to WT at ABA concentrations ≧0.2 μm (Figure 1c; Figure S5b). Next, we expressed Ubi:JAUP1 in transgenic rice. Growth of all types of roots under ABA treatments was generally greater in both JAUP1‐Act and JAUP1‐Ox lines compared to WT, although root growth was increasingly inhibited at higher ABA concentrations (Figure 1c,d; Figure S5b,c). Root growth was also enhanced in JAUP1‐Act and JAUP1‐Ox lines at a NaCl concentration of 150 mm (Figure 1e; Figure S5d).

Notably, we also hydroponically cultured seedlings and then cold‐treated (4 °C), dehydrated, or subjected them to 150 mm NaCl, before allowing them to recover under normal conditions. The JAUP1‐Ox1 line displayed greater tolerance than WT to all those abiotic stress treatments (Figure 1f–i).

JAUP1 upregulates genes for JA biosynthesis and signalling and multi‐stress tolerance

The 549 nucleotides of JAUP1 encode a protein of 183 amino acids. We noticed two Arg (R)‐rich domains, comprising amino acids 11RRRK14 (designated NLS1) and 95RRR97 (NLS2), in the JAUP1 polypeptide (Figure 2a). We examined the subcellular localization of Ubi:GFP‐JAUP1 using barley aleurone cell and rice protoplast transient expression assay systems. GFP‐JAUP1 localized in the nuclei of both cell types (Figure 2b,c). Substituting the R and Lys (K) of either or both putative NLS with Ala (A) resulted in an almost exclusive cytosolic localization of GFP‐JAUP1 in rice protoplasts (Figure 2c), indicating that JAUP1 contains two nuclear localization signals.

Figure 2.

Figure 2

JAUP1 encodes a protein containing two nuclear localization signals (NLSs). (a) Positions of the two NLSs in the JAUP1 amino acid sequence. (b) Barley aleurones transfected with Ubi:GFP‐JAUP1. (c) Rice protoplasts transfected with Ubi:GFP‐JAUP1 (WT or single/double NLS mutated). Scale bar = 10 μm. GFP and chloroplast red fluorescence signals were examined under confocal microscopy. Left panel: representative fluorescence images of cells. Right panel: quantification of cell numbers hosting JAUP1 in the nucleus and/or cytosol.

RNA sequencing (RNAseq) on WT and JAUP1‐Ox1 lines to identify JAUP1‐upregulated but ABA‐independent genes revealed many encoded proteins involved in JA biosynthesis and signalling and stress tolerance (Figure 3a; Table S1), including MGD, PLA, LOX, AOS and AOC responsible for biosynthesis of 12‐oxo‐phytodienoic acid in plastids, OPR for biosynthesis of (+)‐7‐iso‐JA in peroxisomes, and JAR1 and JMT2 for respective production of JA‐Ile and MeJA in cytosol. We also identified many nuclear signalling and regulatory factors, such as JAZ families, and several transcription factor families (ERFs, MYCs, RSS3, ICE1/2, NACs and WRKYs) that regulate the expression of many JA‐responsive genes (Ruan et al., 2019), and various ethylene biosynthesis enzymes and signalling factors (ACS, ACO, EIN3 and ERF).

Figure 3.

Figure 3

JAUP1 activates genes for JA biosynthesis and signalling, root development and multi‐stress tolerance. Transcriptomic analysis of JAUP1‐upregulated genes relative to WT. (a) Genes involved in JA biosynthesis and abiotic stress tolerance. The colour scale of log2 fold‐change ranges from 0 to 5, with red and white representing higher and lower transcript levels, respectively. The double and single arrows indicate biochemical and signalling pathways, respectively, and the red arrow indicates the induction of enzymes involved in JA biosynthesis in plastids, peroxisomes and the cytosol, and genes involved in root development and abiotic stress tolerance by JAUP1/JA. (b) Protoplasts isolated from shoots of the WT and JAUP1‐Ox lines were co‐transfected with effector and reporter plasmids, incubated in sugar‐free medium for 16 h, and assayed for luciferase activity. The value for luciferase activity of the reporter construct in the absence of the effector was set to 1×, and all other values were calculated relative to this value. Error bar indicates the SE from three replicate experiments.

Moreover, we identified several dehydration‐responsive element binding protein 1 (DREB1) variants that are upregulated by the JA‐JAZ‐ICE1/2 signalling cascade for freezing tolerance in Arabidopsis (Hu et al., 2013), and by the JA‐JAZ‐RSS3/bHLH148 signalling cascade for salt and drought tolerance in rice (Seo et al., 2011; Toda et al., 2013). Our RNAseq also revealed HsfA3 that confers drought and heat tolerance in Arabidopsis (Zhu et al., 2020), as well as HsfC1B that regulates salt tolerance in rice (Schmidt et al., 2012; Schramm et al., 2008). Additionally, we uncovered trehalose‐6‐phosphate synthase (TPS) and trehalose‐6‐phosphatase (TPP) families as being upregulated by JAUP1. The osmotic molecule trehalose is converted from glucose by TPS and TPP, with overexpression of both those proteins significantly enhancing trehalose accumulation and tolerance to salt, drought and cold in rice and other cereals (Garg et al., 2002; Paul et al., 2020). Furthermore, ICE1 binds and activates the TPP1 promoter to confer cold tolerance on rice (Zhang et al., 2017).

We randomly selected 31 genes representing different gene groups involved in JA biosynthesis and signalling pathways and responsible for stress tolerance for qRT‐PCR analyses. As expected, the expression of all these genes was highly upregulated in the JAUP1‐Ox1 line (Figure S6a). We treated WT rice seedlings with MeJA for 1 h and observed that it strongly induced the expression of JAUP1 itself and 26 JAUP1‐upregulated genes (Figure S6b), confirming that JAUP1 and MeJA regulate the same set of genes.

JAUP1 regulates auxin‐ and JA‐dependent root development

Auxin exerts multiple functions in regulating plant growth and development, and auxin signal transduction is mediated by the interaction between the repressor Auxin/Indole‐3‐Acetic Acid (AUX/IAA) and the transcription factor Auxin Response Factor (ARF). Under normal low‐auxin or auxin‐absent conditions, AUX/IAA binds to and inhibits the activity of ARF (which binds to auxin‐inducible gene promoters; Leyser, 2018). During developmental processes, endogenous auxin accumulates and is captured by the receptor Transport Inhibitor Response 1 (TIR1), promoting the formation of an SCFTIR1‐auxin‐AUX/IAA co‐receptor complex that promotes degradation of AUX/IAA and release of ARF to activate auxin‐inducible genes (Leyser, 2018). In rice roots, IAA13 and ARF19 mRNAs accumulate to similar levels, and an IAA13ARF19 interaction regulates auxin‐dependent LR development (Yamauchi et al., 2019). Our RNAseq analysis showed that genes encoding COI2, IAA13 and ARF19 were also induced by JAUP1 to similar levels (Table S1). Our study has shown that JAUP1 overexpression leads to the buildup of a robust JA biosynthesis and responding system. A protoplast transient expression assay demonstrated that RNA interference (RNAi)‐mediated knockdown of COI1a and COI2 induced IAA13 promoter activity almost two‐ and threefold, respectively (Figure 3b), indicating that COI1a and COI2 are negative regulators of the IAA13 promoter. These results support crosstalk between JA and auxin signalling.

We observed that LRs emerged and elongated more rapidly from parental roots in the JAUP1‐Ox1 line compared to WT, and the effect was more pronounced without ABA than with ABA (Figure 4a). Next, we treated seedlings with ABA and with or without the polar auxin transport inhibitor N‐(1‐naphthyl) phthalamic acid (NPA; Reed et al., 1998). Upon 0.2 μm ABA treatment alone, LR density and length in the JAUP1‐Ox1 line were greater than in WT, but growth of all types of roots in both the WT and JAUP1‐Ox1 lines was inhibited upon NPA treatment alone (Figure 4b). ABA and NPA co‐treatment resulted in inhibited CR and LR growth, but SRs were still longer than WT in JAUP1‐Ox1.

Figure 4.

Figure 4

JAUP1 regulates auxin‐ and JA‐dependent root development. (a) Two‐day‐old WT and JAUP1‐Ox1 seedlings were grown with or without 0.2 μM ABA for 9 days and roots were stained with toluidine blue. Scale bar = 1 mm. (b) Three‐day‐old JAUP1‐Ox1 seedlings were treated with 0.2 μM ABA and/or 0.1 μM NPA for 8 days, before examining root morphology. Red dots indicate starting points of root growth upon treatments with ABA and/or NPA. (c) Three‐day‐old WT and JAUP‐Ox1 seedlings were treated with 0.2 μM ABA for 9 days, and JA levels (ng/g fresh weight, FW) in roots and shoots were determined. (d) WT and edited nucleotide sequences of two homozygous jaup1 mutants. Numbers above dots indicate the position of nucleotides downstream of the first nucleotide of the coding sequence. Changes in target site sequences, including a 23‐bp deletion (−23) and a 1‐bp deletion (−1) in homozygous jaup1‐2 and jaup1‐4 mutants, respectively, were highlighted with a green background. (e) Root phenotypes of jaup1 mutants. (f) Quantification of total length, LR number and LR density in seminal and CRs of jaup1 mutants. Values represent mean ± SD (n = 3). (g) RNAs were purified from roots of 14‐day‐old WT and jaup1‐2 seedlings and subjected to qRT‐PCR analysis using gene‐specific primers. Values represent mean ± SD (n = 3). (h) Three‐day‐old WT seedlings were incubated with 0.01 μM MeJA for 11 days, and roots were photographed. (i) Three‐day‐old sWT and jaup1‐2 seedlings were incubated with or without 0.01 μM MeJA for 11 days, and roots were photographed.

In 12‐day‐old seedlings grown under normal conditions, we detected an increase in JA concentrations in the roots and shoots of the JAUP1‐Ox1 line relative to WT (Figure 4c), confirming that JAUP1 overexpression did indeed enhance JA biosynthesis. However, the JA concentration in JAUP1‐Ox1 roots treated with a high inhibitory concentration (0.2 μm) of ABA was reduced relative to WT roots. This outcome could be due to inhibited expression by ABA of several genes involved in JA biosynthesis in the JAUP1‐Ox1 line (Table S2).

We generated JAUP1 knockout mutants via CRISPR‐Cas9‐based genome editing and obtained two homozygous knockout mutants (jaup1‐2 and jaup1‐4; Figure 4d) that displayed significantly reduced LR length and density compared to WT (Figure 4e,f). We also selected 24 JAUP1‐upregulated genes involved in JA biosynthesis and signalling, root development and stress tolerance for further qRT‐PCR analyses. Apart from AOC1 and NAC59, the expression of all remaining genes was downregulated in the jaup1‐2 mutant (Figure 4g).

We treated 3‐day‐old WT rice seedlings with various concentrations of MeJA and observed that 0.01 μm MeJA significantly enhanced LR length and the density of SRs and CRs; higher concentrations of MeJA inhibited SR and CR length but increased LR density (Figure 4h; Figure S7a,b). Without MeJA treatment, the growth of all types of roots in jaup1 was inhibited, but the growth of all roots recovered to a degree similar to WT upon treatment with 0.01 μm MeJA (Figure 4i).

Wound‐induced JA/ JAUP1 promotes LR emergence by inducing cell wall remodelling in epidermal cells overlaying the LR

We found that the JAUP1 promoter is temporally, spatially and developmentally regulated and wound‐inducible, and it is highly active in the root cap (RC) of all types of roots. The JAUP1 promoter was active in EPCs of different regions of young CRs, except for the apical meristem zone (Figure 5a). In EPCs, the JAUP1 promoter was most active in the epidermis, then in exodermis and sclerenchyma, and least active in cortex (Figure 5b). We noticed intensified GUS activity in parental root EPCs overlaying emerging LR of JAUP1:GUS seedlings (Figure 5c). Moreover, GUS activity was significantly higher in the emerging root cap of lateral root (RC‐LR) relative to the parental root EPCs surrounding RC‐LR (Figure 5d). In emerged LRs, the JAUP1 promoter was also active in vascular tissue (Figure 5e).

Figure 5.

Figure 5

Wound‐induced JA/JAUP1 promotes LR emergence by inducing cell wall remodelling in epidermal cells overlaying the LR. JAUP1:GUS seedlings were grown for 7 days and stained for GUS activity. (a) A young CR was stained for GUS activity and the region 1.2 cm above the root tip was sectioned. Red dot marks the position of LRP. (b) Enlarged cross‐sections of the root cap. LRC: lateral root cap. Ep: epidermis. Ex: exodermis. Sc: sclerenchyma. C: cortex. En/P: endodermis/pericycle. V: vascular bundle. (c) Intensified GUS activity was detected in the parental root EPCs (red arrowhead) overlaying emerging LR. (d) GUS activity was detected in both RC‐LR and parental root EPCs (red arrowheads) during LR emergence. (e) A young primary (1°) LR with an emerging secondary (2°) LR. (f) A leaf blade was wounded and stained for GUS activity. Four wounded sites have been enlarged. (g) Root tip was resectioned for 5 or 20 min and then stained for GUS activity. (h) DR5:GUS/WT and DR5:GUS/JAUP1 seedlings grown with or without 0.2 μM ABA for 5 days. (i) Emerging LRP in CRs in (h) were examined under microscopy. Additional images are presented in Figure S8b. Yellow and red dashed lines encompass the dome‐shaped RC‐LR and disjointed/disordered area of the cell wall, respectively, in root epidermal layers. (j) Threeday‐old WT seedlings were incubated with 0.01 μM MeJA for 11 days. RNAs were purified from roots and subjected to qRT‐PCR analysis using gene‐specific primers. Genes also induced in the JAUP1‐Ox1 line shown in (k) are marked in red. CK, control. (k) RNAs were purified from 14‐day‐old WT and JAUP1‐Ox1 seedlings and subjected to qRTPCR analysis using gene‐specific primers. Values represent mean ± SD (n = 3). In (j) and (k), the genes were selected from Table S3. Scale bars in (a), (b), (c), (d), (e) and (i) = 100 μm, in (f) = 1 cm and in (g) = 1 mm.

We pressed the teeth of a comb over a JAUP1:GUS leaf blade and observed that the resulting wounded sites exhibited GUS activity (Figure 5f). We also resectioned JAUP1:GUS root tips and noted intensified GUS signal at the wound site 5 min after resectioning, which had further intensified at the wound site and extended along EPCs in the meristematic to elongation zones 20 min after resectioning (Figure 5g).

The amount and direction of auxin flow in roots determine both the positioning and frequency of LRP initiation (Himanen et al., 2002; Orman‐Ligeza et al., 2013), and DR5:GUS is a widely used marker for estimating endogenous auxin levels (Ulmasov et al., 1997). We introduced DR5:GUS into WT and JAUP1‐Ox1 lines to generate DR5:GUS/WT and DR5:GUS/JAUP1 transgenic lines. These lines were then grown in medium with or without ABA. Although ABA significantly suppressed LR growth, the LRs were longer and denser in the JAUP1‐Ox background than in the WT background, regardless of the presence or absence of ABA (Figure 5h). DR5:GUS was mainly expressed in RC, vascular tissues and LR founder cells, but there was no obvious difference in DR5:GUS expression pattern between roots from the JAUP1‐Ox and WT backgrounds (Figure S8a). In the parental root, the GUS signal was intensified in EPCs overlaying emerging LR (Figure 5i; Figure S8b), indicating that auxin accumulation had increased in these EPCs. We observed that emerging LRs passed through more disordered and dispersed EPCs in the root of the DR5:GUS/JAUP1 line than the DR5:GUS/WT line, with the opening in the epidermal cell layer generally being smaller under ABA treatments (Figure 5i; Figure S8b).

LR development is a three‐stage process consisting of LRP initiation and development and LR emergence (Jung and McCouch, 2013). The dome‐shaped LRP develops into a LR as it transitions through many cell layers, ultimately breaking through parental root EPC junctions toward the rhizosphere, with root progression being facilitated by enzyme‐weakened cell walls (Peret et al., 2009; Vilches‐Barro and Maizel, 2015). We identified several genes encoding cell wall remodelling enzymes as being upregulated by JAUP1 based on our RNAseq analysis (Tables S1 and 3). Many of these genes were also upregulated by MeJA (Figure 5j). Additionally, we confirmed that genes encoding α‐expansin (EXPA), polygalacturonase (PGL), xyloglucan endotransglycosylase (XTR), and xyloglucan endotransglucosydase/hydrolase (XTH), all of which have been reported as impacted or upregulated by auxin and associated with epidermis cell wall separation during LR emergence in Arabidopsis (Vilches‐Barro and Maizel, 2015), were upregulated by JAUP1 in the absence of ABA and mostly maintained high‐level expression under ABA treatment based on our qRT‐PCR analysis of root mRNAs (Figure 5k).

We also examined the progress of wound‐activated JA/JAUP1 signalling during LR emergence. The JAUP1 promoter was initially not induced in the RC‐LR (stages 1 and 2) but became active when the RC‐LR reached and pushed against parental root EPCs (stage 3), with activity then increasing in RC‐LR (stage 4), and spreading throughout the RC‐LR during and after emergence through parental root EPCs (stage 5 and beyond; Figure 6a,b).

Figure 6.

Figure 6

Wound‐activated JA/JAUP1 signalling promotes LR emergence. JAUP1:GUS seedlings were grown for 7 days and stained for GUS activity. (a) A CR with emerging and emerged LRs. Numbers mark LRs at different developmental stages. (b) Stages corresponding to (a) indicate the progression of LR emergence. Wound‐activated JA signal induces JAUP1 expression, feedforward JA biosynthesis, crosstalk between the RC‐LR and parental root EPCs, and cell wall remodelling to facilitate LR emergence in rice. Scale bars = 100 μm.

Elevated JAUP1 expression enhances stress tolerance and reduces yield loss under limited water supply

We performed field trials under a rainout shelter where water levels for irrigation could be controlled. We found that grain weight per plant in the JAUP1‐Ox1 and JAUP1‐Act lines was similar to WT under 100% irrigation, but it was consistently higher than WT under 70% irrigation across three crop seasons (Figure 7a). Notably, the JAUP1‐Ox1 and JAUP1‐Act lines displayed lower grain yield losses than WT under the condition of limited water supply in the three crop seasons (Figure 7b). JAUP1 expression levels appear to be correlated with rice productivity under limited water supply. We determined that an old Taiwanese japonica breeding line (HCY103) displayed lower grain yield loss compared to Tainung 67 under limited water supply in a recent crop season, whereas it was dramatically reduced in a landrace from China (3K102; Figure 7c). Comparing JAUP1‐Ox lines with three pre‐screened japonica rice varieties (Figure 7d; Table S4), HCY103 had similar levels of JAUP1 mRNA to the JAUP1‐Act and JAUP1‐Ox3 lines, whereas those of 3K102 and 3K185 were significantly reduced (Figure 7d).

Figure 7.

Figure 7

Elevated JAUP1 expression reduces grain yield loss under limited water supply and enhances abiotic stress tolerance. (a) Total grain weight per plant of rice grown in a rainout shelter under full (100%) and limited (70%) irrigation conditions across three growth seasons, that is, the second season (II) of 2020 and the first (I) and second (II) seasons of 2021. Grain yield was determined from individual plants (n = 15). The box plot was generated in Microsoft Excel, and statistical analysis was carried out using the Student's t‐test. The number below each box plot is the average grain weight per plant of each lines. (b) Grain yield loss in individual plants from (a). The number above each bar is the average grain yield, and the percentage ratio (with a blue or yellow background) is the % reduction of grain yield loss in the WT and JAUP1‐overexpressing lines. (c) From similar experiments to those described in (a), grain yield loss was determined for individual plants of Tainung 67 WT (n = 10), 3K102 (n = 13) and HCY103 (n = 15) for the first growth season (I) of 2022. (d) mRNA was extracted from roots of 10‐day‐old rice seedlings and subjected to qRT‐PCR analysis. The value for JAUP1 mRNA level in WT Tainung 67 was set as 1×, and all other values were calculated relative to this value. (e) Rice seeds were sown in medium containing 100 mm NaCl or 300 mm sorbitol and grown for 14 days. Seedlings were collected and dry weights were determined. The number above each bar indicates the percentage of dry weight relative to the control of each rice variety.

Finally, we germinated the seeds of different rice varieties and grew them in 100 mm NaCl or 300 mm sorbitol for 14 days. Whole plant dry weight was determined to score their degree of stress tolerance. The JAUP1‐Ox1 line (with a JAUP1 mRNA level 187‐fold that of WT Tainung 67) was tolerant to both NaCl and sorbitol, whereas the JAUP1‐Act, JAUP1‐Ox3 and HCY103 lines (with JAUP1 mRNA levels 72‐, 75‐ and 83‐fold that of Tainung 67, respectively) were tolerant to sorbitol but not NaCl (Figure 7e). Tainung 67, 3K102 and the 3K185 rice landrace from Southeast Asia that display similar JAUP1 mRNA levels were all intolerant to both NaCl and sorbitol.

Discussion

Novel roles and multiple functions of JA/JAUP1 in promoting stress tolerance and root growth in response to environmental challenges

We have discovered a novel gene JAUP1 that synergizes with JA to exert multiple functions specifically in rice. First, JAUP1 induces JA biosynthesis, thereby activating a series of genes that enhance multi‐stress tolerance and root growth. Normally, CR and LR growth is suppressed by high concentrations of ABA and by severe abiotic stress, greatly limiting plant growth and productivity (Chen et al., 2015; Ma et al., 2018). In the present study, we have demonstrated that elevated JAUP1 expression enhances JA accumulation and the expression of many genes that can alleviate the suppressed LR elongation caused by ABA, drought and salinity. Interestingly, JAUP1 itself is induced not only by drought, salt and cold but also by exogenously applied MeJA, indicating a self‐perpetuating feed‐forward loop that promotes JA production and activity in response to abiotic stresses. JAUP1 contains two canonical nuclear localization signals, with our transient expression assays showing that the protein is localized in the nucleus. It remains unclear how JAUP1 upregulates such a broad range of genes with diverse functions in various cellular compartments.

Second, JAUP1 is preferentially expressed in root tissues where the delicate meristematic stem cells and developing LRs are protected. The JAUP1 promoter is highly active in RC and EPCs of the elongation and differentiation zones of young roots (Figure 5a,b). This observation is consistent with studies showing that expression of JA‐regulated genes is enriched in the epidermis of the Arabidopsis root elongation zone (Birnbaum et al., 2003), and that higher JA levels are found in the root epidermis and RC of rice (Li et al., 2021). The root tissue‐specific expression of JAUP1 implies it functions in the induction of JA biosynthesis and expression of genes essential for root development.

Third, the JAUP1 promoter is responsive to wound signals and can transmit them to developing roots. We observed that GUS activity in JAUP1:GUS plants was intensified in parental root EPCs overlaying the penetrating LR (Figure 5c) and in the emerged RC‐LR (Figure 5d), indicating that the wound signal arising from mechanical extrusion between the RC‐LR and parental root EPCs induces JAUP1:GUS expression. This notion is further supported by our observations that GUS signal was enhanced by wounding of the leaves and root tips of JAUP1:GUS plants and that the signal in wounded root tips intensified and extended into the meristematic and elongation zones over time. In Arabidopsis root tips, wound‐induced JA promotes stem cell activation and regeneration, which is required for the wound response to accommodate soil penetration and counteract nematode herbivory (Zhou et al., 2019). Thus, in rice, JAUP1‐induced JA accumulation may play a similar role in this process. Root tips can sense physical resistance attributable to surrounding agar medium via an auxin‐mediated mechanism, affecting root morphology and internal biochemical signals (Yan et al., 2018). We discovered that the JAUP1 promoter is more active in EPCs of young roots than in mature roots and in vascular tissues of young LRs. Thus, JA/JAUP1 seem to preferentially protect the relatively fragile young LRs against the physical force experienced during their outgrowth in agar medium.

Fourth, JA/JAUP1 auxin signalling crosstalk regulates root development. The JA receptors COI1a and COI2 suppress the auxin signalling repressor IAA13, leading to release of more ARF19 to activate transcription of auxin‐responsive genes that regulate LR development. Expression of COI2 is more pronounced than that of COI1a, and COI2 exerts greater suppression of the IAA3 promoter than does COI1a (Figure 3b), indicating that COI2 may play a more important role in promoting LR growth. A recent study suggested that CR growth inhibition by 5 μm JA relies on COI2 rather than COI1a/1b (Nguyen et al., 2023). Potentially, inhibition of the IAA13 promoter by the low concentration of JA or JAUP1 that consequently promoted root growth may also act through COI2.

In the CRs of 2‐week‐old rice seedlings, the LR has to pass through at least 10–11 cell layers prior to breaking through the parental root EPC junctions toward the rhizosphere. Moreover, epidermal cell wall structure is tightened and stabilized in the differentiation zone (Somssich et al., 2016), thereby restricting LR outgrowth. The production of cell wall remodelling enzymes is auxin‐dependent in Arabidopsis roots (Vilches‐Barro and Maizel, 2015). JAUP1 significantly induces several genes encoding cell wall remodelling enzymes (Table S1), which may weaken the tight junctions among EPCs and facilitate LR emergence in the root differentiation zone. Indeed, we observed an increase in auxin accumulation and cell openings in parental root EPCs overlaying emerging LR in our JAUP1Ox lines (Figure 5i).

Fifth, the JAUP1 promoter becomes active in the RC‐LR when it reaches and pushes against parental root EPCs, leading to wound‐induced production of JA. Since JA, especially in the form of MeJA, is a volatile hormone, it is conceivable that the JA in RC‐LR is transmitted to the parental root EPCs where LR emergence takes place. Therefore, the wound‐induced JA/JAUP1 signal originally produced in RC‐LRs may eventually induce expression of cell wall remodelling enzymes in parental root EPCs overlaying the emerging LR. Several of these enzymes are induced by MeJA and maintained at high levels in the presence of ABA (Figure 5j,k). This mechanism may account for auxin‐dependent and JA/JAUP1‐enhanced LR growth under normal and high ABA and abiotic stress conditions.

We hereby propose a model linking the progression of wound‐activated JA signalling to induction of JAUP1 expression, feed‐forward JA biosynthesis, signalling crosstalk between RC‐LR and parental root EPCs, and the enzyme production that facilitates LR emergence in rice (Figure 6b).

Rice‐specific JAUP1 evolved recently and promotes drought tolerance and water conservation

There is strong evidence that JAUP1 evolved quite recently in the rice genome. First, the predicted JAUP1 protein and its homologues do not display sequence homology to any known, expressed, or hypothetical proteins from organisms other than rice. Second, JAUP1 and its homologues are present only in cultivated Oryza species and their closely related rice species with AA and BB genomes. Third, the coding region of JAUP1 is highly conserved in those Oryza species with AA and BB genomes, and it is duplicated only in the O. sativa vg. japonica cultivar but not in its close wild relative O. rufipogon. Fourth, the coding sequences of JAUP1 (chromosome 7) and JAUP2 (chromosome 4) in japonica rice are identical, and their 5′ and 3′ UTRs differ by only a few nucleotides, indicating a very recent gene duplication event. Fifth, JAUP1 encodes a small protein of 183 amino acids and lacks an intron, a hallmark of new genes (Long et al., 2003).

Rice is susceptible to drought and salinity due to its shallow rooting system and other undesirable traits. Drought and salt‐tolerant rice cultivars have yet to be developed due to the complex mechanisms regulating tolerance to these two stresses. Many rice varieties have adapted to different biogeographical ranges and can tolerate various environmental stresses, constituting an important reservoir for crop improvement. Expression levels of JAUP1 are correlated with tolerances to various abiotic stresses, and JAUP1 displays differential expression among natural rice populations. For instance, JAUP1 mRNA levels relative to WT (Tainung 67) were increased 72‐, 187‐ and 75‐fold in the JAUP1‐Act, JAUP1‐Ox1 and JAUP1‐Ox3 lines, respectively; JAUP1‐Ox1 is tolerant to cold, drought/osmotic and salt stresses (Figures 1f–i and 7e), and JAUP1‐Act and JAUP1‐Ox3 are tolerant to osmotic stress but not to salt (Figure 7e). JAUP1‐Act and JAUP1‐Ox1 also display significantly enhanced grain yield under limited water supply compared to the WT (Figure 7a). JAUP1 mRNA levels in HCY103 are 83‐fold that of WT and it is tolerant to osmotic stress but not to salt. Thus, our results indicate that increasing JAUP1 mRNA levels relative to WT by ≧72‐fold endows drought/osmotic tolerance and reduced yield loss under limited water supply and increasing them ≧187‐fold confers broad‐spectrum stress tolerance and reduced yield loss under the same conditions (Figures 1f–i and 7b–e).

The evolution of JAUP1 has increased rice genome diversity, endowing beneficial growth characteristics. JAUP1 is necessary for JA production and root growth, and greater JAUP1 expression enables rice to adapt to stressful environments and conserve water resources. Varied JAUP1 expression in natural populations provides a valuable genetic resource for breeding rice capable of withstanding extreme environmental challenges. Therefore, screening of more rice accessions for significantly higher JAUP1 mRNA levels may prove beneficial for rice improvements.

In summary, our study has discovered a novel recently evolved gene JAUP1 that can be applied in biotechnology via genetic modification, such as transgenic engineering or genome editing, for rice improvements. Since elevated JAUP1 expression in natural rice populations correlates well with stress tolerance and reduced yield loss under limited water supply, JAUP1 can be used as a marker for molecular breeding of rice adapted to extreme environmental challenges and aid in the conservation of water resources. It is also feasible to test if JAUP1 could exert similar functions upon transfer into other cereal genomes for trait improvements.

Materials and methods

Plant materials and growth conditions

The japonica rice line Oryza sativa cv Tainung 67 was used in this study unless otherwise indicated. Plasmids were introduced into Agrobacterium tumefaciens strain EHA105, and rice transformation was performed as described previously (Chen et al., 2002). Transgenic rice carrying ABRC321:HVA1 was generated previously (Chen et al., 2015). The JAUP1‐activated mutant (JAUP1‐Act) was obtained from the Taiwan Rice Insertional Mutant (TRIM) population (http://trim.sinica.edu.tw/; Hsing et al., 2007; Lo et al., 2016). Seeds were sterilized with 3% (v/v) NaOCl for 40 min, washed with sterile water and germinated for 3 days in water. Seedlings with similar shoot length were transferred to ½MS agar (0.3% CultureGel™ Type1, Phytotechlab) medium containing indicated chemicals, and incubated at 28 °C with a 16‐h light/8‐h dark cycle in a growth chamber.

Microarray analysis

Three‐day‐old seedlings of WT and 3xABRC321:HVA1 lines were treated with 0.2 μm ABA for 8 days. Total RNA was extracted from roots using an RNeasy Mini Kit (QIAGEN). RNA quality assessment and microarray experiments were conducted in the Affymetrix Gene Expression Service Lab of Academia Sinica using GeneChip® Rice Genome Arrays (Affymetrix). The Affymetrix CEL files were imported into GeneSpring 12.6 software (Agilent Technology), and the MAS5.0 algorithm was used for data normalization. Genes with more than twofold changes in expression were analysed further (Pepper et al., 2007).

Plasmid construction

For overexpression of JAUP1 in transgenic rice, JAUP1 cDNA was synthesized by RT‐PCR of total RNA extracted from roots of transgenic rice carrying 3xABRC321:HVA1. For overexpression of JAUP1 under the control of the maize ubiquitin (Ubi) promoter, the JAUP1 cDNA was cloned into pENTRY/D‐TOPO and then into pSMY1H‐Ubi‐attRI‐ccdB‐attR2‐Nos expression vector using LR‐Clonase (Invitrogen), generating pSMY1H‐Ubi‐JAUP1‐Nos. The JAUP1 native promoter (2‐kb upstream of the translation initiation codon ATG) was isolated by PCR of rice genomic DNA using forward and reverse primers containing Kpn1 and NotI restriction sites, respectively. For spatiotemporal expression assay of JAUP1, the 2‐kb JAUP1 promoter was fused upstream of GUS in pCambia‐1305.1.

To identify the subcellular localization of JAUP1, JAUP1 cDNA was cloned into pENTRY/D‐TOPO and then inserted into pUbi‐GFP‐attRI‐ccdB‐attR2‐Nos expression vector using LR‐Clonase (Invitrogen), generating pUbi‐GFP‐JAUP1‐Nos. To generate the NLS1 and NLS2 mutations, a plasmid back‐to‐back PCR method using pUbi‐GFP‐JAUP1‐Nos as template was performed to change JAUP1 amino acid residues RRRK11‐14 to AAAA11‐14 (generating pUbi‐GFP‐JAUP1(mNLS1)‐Nos), RRR94‐97 to AAA94‐97 (generating pUbi‐GFP‐JAUP1(mNLS2)‐Nos), and a combination of both (generating pUbi‐GFP‐JAUP1(mNLS1/mNLS2)‐Nos).

Primers

The sequences of all primers used for genotyping, PCR, RT‐PCR and qRT‐PCR are listed in Table S5.

GUS staining and microscopy

Rice seeds were germinated in ½MS agar for 10 days. GUS staining of rice seedlings was conducted as described previously (Chen et al., 2015). After GUS staining, roots were incubated in 100% ethanol for 1 week. Root samples were examined using a Zeiss AxioObserver Z1 microscope.

Real‐time quantitative RT‐PCR (qRT‐PCR) analyses

Total RNA was purified from roots of rice seedlings using Trizol reagent (Invitrogen), treated with RNase‐free DNase I (Promega), and used for reverse transcription using Superscript III reverse transcriptase (Invitrogen). qRT‐PCR analysis was performed as described previously (Chen et al., 2019).

Abiotic stress treatments

Seedlings of T3‐generation homozygous JAUP1‐Act and JAUP1‐Ox lines were hydroponically cultured in beakers for 14 days prior to abiotic stress treatments. For cold treatment, seedlings were placed in a refrigerator at 4 °C for 2 days. For the dehydration experiment, the hydroponic solution was decanted, before wrapping the roots with a paper towel until WT plants had completely wilted. For salt treatment, seedlings were transferred to 200 mm NaCl solution for 2 days. After all those stress treatments, roots were washed and kept in sterile deionized water to avoid contamination during recovery. For drought treatment, seedlings were cultured in vermiculite for 14 days, gradually dehydrated without watering for 11 days, and then re‐watered.

Subcellular localization

To detect the cellular localization of JAUP1‐GFP fusion protein, the released protoplast cells from leaf sheath of 10‐day‐old rice seedlings grown in MS medium were isolated and transformed via the polyethylene glycol (PEG 4000) method (Zhang et al., 2011). GFP signal was imaged with a Zeiss LSM780 confocal microscope using a 488‐nm laser beam for excitation and a 500‐ to 550‐nm laser beam for emission.

RNA sequencing (RNAseq) and bioinformatics analyses

Total mRNA was extracted from seedlings using Trizol® reagent (Ambion) and an RNeasy Plant Mini Kit (Qiagen). RNA quality control and quantification were carried out using a Bioanalyzer 2100 system (Aligent). cDNA libraries were prepared with a TruSeq standard mRNA kit (Illumina) according to the manufacturer's instructions. cDNA sequencing was performed using a 500‐high output v2 sequencing kit and an Illumina Nextseq500 instrument. Bioinformatics analyses were conducted in QIAGEN CLC Genomics Workbench (v11.0.1). The heat‐map was generated by matching the log2 fold‐change value to a colour scale in EXCEL.

Endogenous JA quantification

Two‐day‐old WT and JAUP1‐Ox lines were grown on ½MS medium with or without ABA for 14 days. Roots and shoots were collected separately and immediately frozen with liquid nitrogen. JA was extracted as described (Pan et al., 2010). JA quantification was performed using an ultra‐performance liquid chromatography (UPLC) system coupled inline with a Waters Xevo TQ‐XS triple quadrupole mass spectrometer (Waters, Millford, MA). The sample was separated with an ACQUITY UPLC HSS T3 column (Waters) at 30 °C with a 0.3 mL/min flow rate. The mobile phase was a gradient of: (A) water containing 0.1% acetic acid; and (B) methanol containing 0.1% acetic acid. D5‐Jasmonic acid (D5‐JA) was used as the internal standard. Characteristic mass spectrometry transitions were monitored using negative multiple reaction monitoring (MRM) mode for jasmonic acid (m/z, 209 → 59), and D5‐JA (m/z, 214 → 62). Data acquisition and processing were performed using MassLynx v. 4.2 and TargetLynx software (Waters).

CRISPR‐Cas9‐based gene knockout

A CRISPR‐Cas9 guide RNA spacer sequence was designed in a program on the website http://crispr.hzau.edu.cn/CRISPR2/. A pair of DNA oligonucleotides—forward sequence CCGGCACGCAACGACAGTTG and reverse sequence CAACTGTCGTTGCGTGCCGG—with appropriate cloning, linkers was synthesized, phosphorylated, annealed and ligated into BsaI‐digested pRGEB31 vector (Xie and Yang, 2013). pRGEB31 was a gift from Dr. Yinong Yang (Addgene plasmid #51295; http://n2t.net/addgene:51295; PRID: Addgene_51 295). After introducing the vector into the E. coli DH5‐alpha strain, plasmids were purified with a QIAGEN Plasmid Midi kit (Qiagen), before confirming the DNA sequence using M13R primer in advance of subsequent rice transformation.

Statistical analysis

In bar graphs, for the relative value given above a bar, the value for the control or WT without treatment was set to 1 or 100, and the respective values for the tested lines were calculated relative to it. For root length, number or density, raw values of individual lines are provided. Error bars indicate the SE from three independent experiments. *, ** and *** indicate significance levels at P < 0.05, 0.01 and 0.001, respectively, from a Student's t‐test.

Evolutionary analysis by maximum likelihood

Multiple‐sequence alignment of JAUP1 coding sequences and their homologues, based on BLAST analysis against the GenBank nucleotide database and the protein database of the National Center for Biotechnology Information, was performed using the MUSCLE algorithm in MEGA11 (Tamura et al., 2021). The evolutionary history of JAUP1 was inferred according to a Maximum Likelihood approach and the Tamura‐Nei model (Tamura and Nei, 1993). The phylogenetic tree with the highest log likelihood (−1173.22) is presented, and the percentage of trees in which the associated taxa clustered is shown next to respective branches. The initial tree(s) for the heuristic search was obtained automatically by applying Neighbor‐Joining and BioNJ algorithms to a matrix of pairwise distances estimated using the Tamura‐Nei model, and the topology with the highest log likelihood value was selected. The tree has been drawn to scale, with branch lengths reflecting the number of substitutions per site. This analysis involved 10 nucleotide sequences. The 1st + 2nd + 3rd + noncoding codon positions were included, resulting in 553 positions in the final dataset. Evolutionary analyses were conducted in MEGA11 (Tamura et al., 2021).

Supporting information

Table S1 List of JAUP1‐upregulated genes involved in JA biosynthesis and signaling, root development and multi‐stress tolerance, as determined by RNAseq analysis.

Table S2 List of JA biosynthesis genes down‐regulated by ABA in the JAUP1‐Ox line, as determined by RNAseq analysis.

Table S3 List of JAUP1‐regulated genes encoding cell wall remodeling enzymes, as determined by RNAseq analysis.

Table S4 Source of japonica rice varieties.

Table S5 List of primers.

Figure S1 Transcriptomic analysis of genes regulated by HVA1 and/or ABA.

Figure S2 The nucleotide sequences of JAUP1 and JAUP2 on chromosomes 7 and 4, respectively, are highly homologous.

Figure S3 Nucleotide sequences of JAUP1 and its homologs are highly conserved across Oryza species.

Figure S4 JAUP1 has only been duplicated in the Oryza sativa japonica cultivar.

Figure S5 JAUP1 overexpression alleviates ABA‐ and NaCl‐mediated root growth inhibition.

Figure S6 JAUP1 and MeJA upregulate the same set of genes for JA biosynthesis and signaling, root development and multi‐stress tolerance.

Figure S7 MeJA regulates root growth.

Figure S8 JAUP1 overexpression does not alter auxin distribution but does promote cell wall separation overlaying the emerging LRP.

PBI-22-1417-s001.pdf (2.3MB, pdf)

Acknowledgements

We thank Dr John O'Brien for critical review of this manuscript, Ms Min‐Wei Tsai for rice transformation and Ms Ting‐Hsiang Chang at the Metabolomics Core Facility of the Agricultural Biotechnology Research Center at Academia Sinica for the UPLC‐MS/MS analysis. We also thank the Genomics Core, Bioinformatics‐Biology Service Core and Imaging Core at the Institute of Molecular Biology, Academia Sinica, for bioinformatics and imaging analyses. This work was supported by grants from the Innovative Translational Agricultural Research (ITAR) Program of Academia Sinica (AS‐108‐ITAR‐TD08, AS‐109‐ITAR‐TD08, AS‐110‐ITAR‐TD06 and AS‐KPQ‐111‐ITAR‐11108), Ministry of Science and Technology (MOST 109‐2326‐B‐001‐004 and MOST 110‐2326‐B‐001‐011) and in part by the Advanced Plant Biotechnology Center from the Featured Areas Research Center Program within the framework of the Higher Education Sprout Project by the Ministry of Education (MOE) in Taiwan.

References

  1. Ali, M.S. and Baek, K.H. (2020) Jasmonic acid signaling pathway in response to abiotic stresses in plants. Int. J. Mol. Sci. 21, 621–639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Birnbaum, K. , Shasha, D.E. , Wang, J.Y. , Jung, J.W. , Lambert, G.M. , Galbraith, D.W. and Benfey, P.N. (2003) A gene expression map of the Arabidopsis root. Science, 302, 1956–1960. [DOI] [PubMed] [Google Scholar]
  3. Chen, P.‐W. , Lu, C.‐A. , Yu, T.‐S. , Tseng, T.‐H. , Wang, C.‐S. and Yu, S.‐M. (2002) Rice alpha‐amylase transcriptional enhancers direct multiple mode regulation of promoters in transgenic rice. J. Biol. Chem. 277, 13641–13649. [DOI] [PubMed] [Google Scholar]
  4. Chen, Y.S. , Lo, S.F. , Sun, P.K. , Lu, C.A. , Ho, T.H. and Yu, S.M. (2015) A late embryogenesis abundant protein HVA1 regulated by an inducible promoter enhances root growth and abiotic stress tolerance in rice without yield penalty. Plant Biotechnol. J. 13, 105–116. [DOI] [PubMed] [Google Scholar]
  5. Chen, Y.S. , Ho, T.D. , Liu, L. , Lee, D.H. , Lee, C.H. , Chen, Y.R. , Lin, S.Y. et al. (2019) Sugar starvation‐regulated MYBS2 and 14‐3‐3 protein interactions enhance plant growth, stress tolerance, and grain weight in rice. Proc. Natl. Acad. Sci. USA, 116, 21925–21935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Coudert, Y. , Perin, C. , Courtois, B. , Khong, N.G. and Gantet, P. (2010) Genetic control of root development in rice, the model cereal. Trends Plant Sci. 15, 219–226. [DOI] [PubMed] [Google Scholar]
  7. Garg, A.K. , Kim, J.K. , Owens, T.G. , Ranwala, A.P. , Choi, Y.D. , Kochian, L.V. and Wu, R.J. (2002) Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proc. Natl. Acad. Sci. USA, 99, 15898–15903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Gowda, V.R.P. , Henry, A. , Yamauchi, A. , Shashidhar, H.E. and Serraj, R. (2011) Root biology and genetic improvement for drought avoidance in rice. Field Crop Res. 122, 1–13. [Google Scholar]
  9. Himanen, K. , Boucheron, E. , Vanneste, S. , de Almeida Engler, J. , Inze, D. and Beeckman, T. (2002) Auxin‐mediated cell cycle activation during early lateral root initiation. Plant Cell, 14, 2339–2351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hsing, Y.I. , Chern, C.G. , Fan, M.J. , Lu, P.C. , Chen, K.T. , Lo, S.F. , Sun, P.K. et al. (2007) A rice gene activation/knockout mutant resource for high throughput functional genomics. Plant Mol. Biol. 63, 351–364. [DOI] [PubMed] [Google Scholar]
  11. Hu, Y. , Jiang, L. , Wang, F. and Yu, D. (2013) Jasmonate regulates the inducer of cbf expression‐C‐repeat binding factor/DRE binding factor1 cascade and freezing tolerance in Arabidopsis. Plant Cell, 25, 2907–2924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Jung, J.K. and McCouch, S. (2013) Getting to the roots of it: genetic and hormonal control of root architecture. Front. Plant Sci. 4, 186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kumar, M. , Sandhya, K.P. , Singh, A.G. and Jukanti, A.K. (2021) Abiotic stress tolerance in rice: insight in climate change scenario. In Integrative Advances in Rice Research( Min, H. , ed). Ch. 4. Rijeka: IntechOpen. [Google Scholar]
  14. Leyser, O. (2018) Auxin signaling. Plant Physiol. 176, 465–479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li, S. , Cao, L. , Chen, X. , Liu, Y. , Persson, S. , Hu, J. , Chen, M. et al. (2021) Synthetic biosensor for mapping dynamic responses and spatio‐temporal distribution of jasmonate in rice. Plant Biotechnol. J. 19, 2392–2394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lo, S.F. , Fan, M.J. , Hsing, Y.I. , Chen, L.J. , Chen, S. , Wen, I.C. , Liu, Y.L. et al. (2016) Genetic resources offer efficient tools for rice functional genomics research. Plant Cell Environ. 39, 998–1013. [DOI] [PubMed] [Google Scholar]
  17. Long, M. , Betran, E. , Thornton, K. and Wang, W. (2003) The origin of new genes: glimpses from the young and old. Nat. Rev. Genet. 4, 865–875. [DOI] [PubMed] [Google Scholar]
  18. Lucas, J. (2003) World food security at risk as crop yields plateau. http://www.trust.org/item/20131119230754‐aynqh/?source=spotlight
  19. Ma, H. , Liu, C. , Li, Z. , Ran, Q. , Xie, G. , Wang, B. , Fang, S. et al. (2018) ZmbZIP4 contributes to stress resistance in maize by regulating ABA synthesis and root development. Plant Physiol. 178, 753–770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Nguyen, H.T. , Cheaib, M. , Fournel, M. , Rios, M. , Gantet, P. , Laplaze, L. , Guyomarc'h, S. et al. (2023) Genetic analysis of the rice jasmonate receptors reveals specialized functions for OsCOI2. PloS One, 18, e0291385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Orman‐Ligeza, B. , Parizot, B. , Gantet, P.P. , Beeckman, T. , Bennett, M.J. and Draye, X. (2013) Post‐embryonic root organogenesis in cereals: branching out from model plants. Trends Plant Sci. 18, 459–467. [DOI] [PubMed] [Google Scholar]
  22. Pan, X. , Welti, R. and Wang, X. (2010) Quantitative analysis of major plant hormones in crude plant extracts by high‐performance liquid chromatography‐mass spectrometry. Nat. Protoc. 5, 986–992. [DOI] [PubMed] [Google Scholar]
  23. Panda, D. , Mishra, S.S. and Behera, P.K. (2021) Drought tolerance in rice: focus on recent mechanisms and approaches. Rice Sci. 28, 119–132. [Google Scholar]
  24. Paul, M.J. , Watson, A. and Griffiths, C.A. (2020) Trehalose 6‐phosphate signalling and impact on crop yield. Biochem. Soc. Trans. 48, 2127–2137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Pepper, S.D. , Saunders, E.K. , Edwards, L.E. , Wilson, C.L. and Miller, C.J. (2007) The utility of MAS5 expression summary and detection call algorithms. BMC Bioinformatics, 8, 273. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Peret, B. , Larrieu, A. and Bennett, M.J. (2009) Lateral root emergence: a difficult birth. J. Exp. Bot. 60, 3637–3643. [DOI] [PubMed] [Google Scholar]
  27. Price, A.H. , Tomos, A.D. and Virk, D.S. (1997) Genetic dissection of root growth in rice (Oryza sativa L.) I: a hydrophonic screen. Theor. Appl. Genet. 95, 132–142. [Google Scholar]
  28. Reed, R.C. , Brady, S.R. and Muday, G.K. (1998) Inhibition of auxin movement from the shoot into the root inhibits lateral root development in Arabidopsis. Plant Physiol. 118, 1369–1378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ruan, J. , Zhou, Y. , Zhou, M. , Yan, J. , Khurshid, M. , Weng, W. , Cheng, J. et al. (2019) Jasmonic acid signaling pathway in plants. Int. J. Mol. Sci. 20, 2479–2493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Schmidt, R. , Schippers, J.H. , Welker, A. , Mieulet, D. , Guiderdoni, E. and Mueller‐Roeber, B. (2012) Transcription factor OsHsfC1b regulates salt tolerance and development in Oryza sativa ssp. japonica. AoB Plants, 2012, pls011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Schramm, F. , Larkindale, J. , Kiehlmann, E. , Ganguli, A. , Englich, G. , Vierling, E. and von Koskull‐Doring, P. (2008) A cascade of transcription factor DREB2A and heat stress transcription factor HsfA3 regulates the heat stress response of Arabidopsis. Plant J. 53, 264–274. [DOI] [PubMed] [Google Scholar]
  32. Seo, J.S. , Joo, J. , Kim, M.J. , Kim, Y.K. , Nahm, B.H. , Song, S.I. , Cheong, J.J. et al. (2011) OsbHLH148, a basic helix‐loop‐helix protein, interacts with OsJAZ proteins in a jasmonate signaling pathway leading to drought tolerance in rice. Plant J. 65, 907–921. [DOI] [PubMed] [Google Scholar]
  33. Sheard, L.B. , Tan, X. , Mao, H. , Withers, J. , Ben‐Nissan, G. , Hinds, T.R. , Kobayashi, Y. et al. (2010) Jasmonate perception by inositol‐phosphate‐potentiated COI1‐JAZ co‐receptor. Nature, 468, 400–405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Shi, J. , An, G. , Weber, A.P.M. and Zhang, D. (2023) Prospects for rice in 2050. Plant Cell Environ. 46, 1037–1045. [DOI] [PubMed] [Google Scholar]
  35. Somssich, M. , Khan, G.A. and Persson, S. (2016) Cell wall heterogeneity in root development of Arabidopsis. Front. Plant Sci. 7, 1242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Stein, J.C. , Yu, Y. , Copetti, D. , Zwickl, D.J. , Zhang, L. , Zhang, C. , Chougule, K. et al. (2018) Genomes of 13 domesticated and wild rice relatives highlight genetic conservation, turnover and innovation across the genus Oryza. Nat. Genet. 50, 285–296. [DOI] [PubMed] [Google Scholar]
  37. Sun, J. , Xu, Y. , Ye, S. , Jiang, H. , Chen, Q. , Liu, F. , Zhou, W. et al. (2009) Arabidopsis ASA1 is important for jasmonate‐mediated regulation of auxin biosynthesis and transport during lateral root formation. Plant Cell, 21, 1495–1511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tamura, K. and Nei, M. (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10, 512–526. [DOI] [PubMed] [Google Scholar]
  39. Tamura, K. , Stecher, G. and Kumar, S. (2021) MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 38, 3022–3027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Toda, Y. , Tanaka, M. , Ogawa, D. , Kurata, K. , Kurotani, K. , Habu, Y. , Ando, T. et al. (2013) RICE SALT SENSITIVE3 forms a ternary complex with JAZ and class‐C bHLH factors and regulates jasmonate‐induced gene expression and root cell elongation. Plant Cell, 25, 1709–1725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Uga, Y. , Sugimoto, K. , Ogawa, S. , Rane, J. , Ishitani, M. , Hara, N. , Kitomi, Y. et al. (2013) Control of root system architecture by DEEPER ROOTING 1 increases rice yield under drought conditions. Nat. Genet. 45, 1097–1102. [DOI] [PubMed] [Google Scholar]
  42. Ulmasov, T. , Murfett, J. , Hagen, G. and Guilfoyle, T.J. (1997) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell, 9, 1963–1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Vilches‐Barro, A. and Maizel, A. (2015) Talking through walls: mechanisms of lateral root emergence in Arabidopsis thaliana . Curr. Opin. Plant Biol. 23, 31–38. [DOI] [PubMed] [Google Scholar]
  44. Vogel, E. , Donat, M.G. , Alexander, L.V. , Meinshausen, M. , Ray, D.K. , Karoly, D. , Meinshausen, N. et al. (2019) The effects of climate extremes on global agricultural yields. Environ. Res. Lett. 14, 054010. [Google Scholar]
  45. Xie, K. and Yang, Y. (2013) RNA‐guided genome editing in plants using a CRISPR‐Cas system. Mol. Plant, 6, 1975–1983. [DOI] [PubMed] [Google Scholar]
  46. Yamauchi, T. , Tanaka, A. , Inahashi, H. , Nishizawa, N.K. , Tsutsumi, N. , Inukai, Y. and Nakazono, M. (2019) Fine control of aerenchyma and lateral root development through AUX/IAA‐ and ARF‐dependent auxin signaling. Proc. Natl. Acad. Sci. USA, 116, 20770–20775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Yan, J. , Wang, B. , Zhou, Y. and Hao, S. (2018) Resistance from agar medium impacts the helical growth of Arabidopsis primary roots. J. Mech. Behav. Biomed. Mater. 85, 43–50. [DOI] [PubMed] [Google Scholar]
  48. Zhang, Y. , Su, J. , Duan, S. , Ao, Y. , Dai, J. , Liu, J. , Wang, P. et al. (2011) A highly efficient rice green tissue protoplast system for transient gene expression and studying light/chloroplast‐related processes. Plant Methods, 7, 30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zhang, Z. , Li, J. , Li, F. , Liu, H. , Yang, W. , Chong, K. and Xu, Y. (2017) OsMAPK3 phosphorylates OsbHLH002/OsICE1 and inhibits its ubiquitination to activate OsTPP1 and enhances rice chilling tolerance. Dev. Cell, 43, 731–743.e5. [DOI] [PubMed] [Google Scholar]
  50. Zhou, W. , Lozano‐Torres, J.L. , Blilou, I. , Zhang, X. , Zhai, Q. , Smant, G. , Li, C. et al. (2019) A jasmonate signaling network activates root stem cells and promotes regeneration. Cell, 177, 942–956.e14. [DOI] [PubMed] [Google Scholar]
  51. Zhu, M.D. , Zhang, M. , Gao, D.J. , Zhou, K. , Tang, S.J. , Zhou, B. and Lv, Y.M. (2020) Rice OsHSFA3 gene improves drought tolerance by modulating polyamine biosynthesis depending on abscisic acid and ROS levels. Int. J. Mol. Sci. 21, 1857–1872. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1 List of JAUP1‐upregulated genes involved in JA biosynthesis and signaling, root development and multi‐stress tolerance, as determined by RNAseq analysis.

Table S2 List of JA biosynthesis genes down‐regulated by ABA in the JAUP1‐Ox line, as determined by RNAseq analysis.

Table S3 List of JAUP1‐regulated genes encoding cell wall remodeling enzymes, as determined by RNAseq analysis.

Table S4 Source of japonica rice varieties.

Table S5 List of primers.

Figure S1 Transcriptomic analysis of genes regulated by HVA1 and/or ABA.

Figure S2 The nucleotide sequences of JAUP1 and JAUP2 on chromosomes 7 and 4, respectively, are highly homologous.

Figure S3 Nucleotide sequences of JAUP1 and its homologs are highly conserved across Oryza species.

Figure S4 JAUP1 has only been duplicated in the Oryza sativa japonica cultivar.

Figure S5 JAUP1 overexpression alleviates ABA‐ and NaCl‐mediated root growth inhibition.

Figure S6 JAUP1 and MeJA upregulate the same set of genes for JA biosynthesis and signaling, root development and multi‐stress tolerance.

Figure S7 MeJA regulates root growth.

Figure S8 JAUP1 overexpression does not alter auxin distribution but does promote cell wall separation overlaying the emerging LRP.

PBI-22-1417-s001.pdf (2.3MB, pdf)

Articles from Plant Biotechnology Journal are provided here courtesy of Society for Experimental Biology (SEB) and the Association of Applied Biologists (AAB) and John Wiley and Sons, Ltd

RESOURCES