A transient expression tool box for anthocyanin biosynthesis in Nicotiana benthamiana

Summary

Transient expression in Nicotiana benthamiana offers a robust platform for the rapid production of complex secondary metabolites. It has proven highly effective in helping identify genes associated with pathways responsible for synthesizing various valuable natural compounds. While this approach has seen considerable success, it has yet to be applied to uncovering genes involved in anthocyanin biosynthetic pathways. This is because only a single anthocyanin, delphinidin 3‐O‐rutinoside, can be produced in N. benthamiana by activation of anthocyanin biosynthesis using transcription factors. The production of other anthocyanins would necessitate the suppression of certain endogenous flavonoid biosynthesis genes while transiently expressing others. In this work, we present a series of tools for the reconstitution of anthocyanin biosynthetic pathways in N. benthamiana leaves. These tools include constructs for the expression or silencing of anthocyanin biosynthetic genes and a mutant N. benthamiana line generated using CRISPR. By infiltration of defined sets of constructs, the basic anthocyanins pelargonidin 3‐O‐glucoside, cyanidin 3‐O‐glucoside and delphinidin 3‐O‐glucoside could be obtained in high amounts in a few days. Additionally, co‐infiltration of supplementary pathway genes enabled the synthesis of more complex anthocyanins. These tools should be useful to identify genes involved in the biosynthesis of complex anthocyanins. They also make it possible to produce novel anthocyanins not found in nature. As an example, we reconstituted the pathway for biosynthesis of Arabidopsis anthocyanin A5, a cyanidin derivative and achieved the biosynthesis of the pelargonidin and delphinidin variants of A5, pelargonidin A5 and delphinidin A5.

Introduction

Anthocyanins are water‐soluble pigments that give many fruits and flowers their colour. They are made in the cytosol through a series of enzymatic steps from the precursor phenylalanine and are stored in the vacuole, where, in some species, additional enzymatic steps also take place (Saito et al., 2013; Tanaka et al., 2008). The first coloured and stable products are the basic anthocyanins pelargonidin 3‐O‐glucoside (P3G), cyanidin 3‐O‐glucoside (C3G) and delphinidin 3‐O‐glucoside (D3G). In many plants, these basic anthocyanins undergo further modifications, such as glycosylation, acylation and methylation, which impact the colour and stability of the anthocyanins. While the biosynthetic pathways leading to the basic anthocyanins are well understood, there is still limited knowledge about the genes and enzymes involved in the synthesis of more complex anthocyanins.

Investigating the function of genes putatively involved in anthocyanin biosynthesis usually requires the production of recombinant protein in E. coli. The purified enzymes are then tested in vitro by incubation with the expected substrate in a suitable reaction buffer. Finally, the reaction products are analysed by chromatography and mass spectrometry. Such a strategy works well to biochemically characterize one or a few genes, but is time‐consuming as it requires cloning of the gene of interest in an expression construct, expressing the gene in E. coli and purifying the recombinant protein. It also requires having access to a specific substrate that may not always be commercially available, which then needs to be chemically synthesized. This strategy is therefore not well suited for quickly screening large numbers of candidate genes.

Transient expression in Nicotiana benthamiana provides a powerful alternative for the identification of genes involved in the biosynthesis of interesting secondary metabolites. This method involves cloning coding sequences of candidate genes in an expression vector under the control of a robust constitutive promoter (the Cauliflower Mosaic Virus 35S promoter) and expressing them transiently in N. benthamiana leaves using agroinfiltration. The high efficiency of this process allows co‐expression of multiple genes simultaneously using pools of agrobacterium strains, each strain for expression of a single candidate gene (Christ et al., 2019). One advantage of screening multiple genes in a single step is that it enables exploration of entire pathways, even in the absence of precise knowledge regarding the order of successive enzymatic steps. Moreover, this approach overcomes challenges associated with unstable intermediate metabolites by rapidly converting them to subsequent intermediates until the final, usually more stable product is synthesized. In situations where the initial precursor for the pathway of interest is lacking in N. benthamiana, it is possible to introduce a chemically synthesized substrate during or shortly after infiltration (Fu et al., 2021). The versatility of the N. benthamiana expression platform has led to the rapid elucidation of several complex secondary metabolite pathways in recent years, significantly expediting research progress (Kwan et al., 2023).

The N. benthamiana platform has, so far, not been used for the elucidation of anthocyanin biosynthetic pathways. This is because induction of anthocyanin biosynthesis by transcription factors in N. benthamiana does not work well, produces very low levels of anthocyanins and leads only to the production of delphinidin‐3‐O‐rutinoside (D3R), a precursor for some, but not all, more complex anthocyanins (Hugueney et al., 2009; Outchkourov et al., 2014).

In this study, we have devised a platform capable of producing any desired basic anthocyanin through the infiltration of a few essential constructs. Additionally, for synthesizing more complex anthocyanins, the platform accommodates the infiltration of species‐specific biosynthetic genes. The strategy involves overexpressing certain anthocyanin biosynthetic genes that are either inadequately expressed or absent in N. benthamiana, while simultaneously silencing others that might impede the biosynthesis of some anthocyanins of interest. Therefore, the current investigation should be useful to enable the rapid, high‐yield production of complex natural anthocyanins but also of novel anthocyanins not found in nature.

Results

Infiltration of transcription factors results in low‐level anthocyanin biosynthesis

Anthocyanin biosynthesis is regulated by a complex of transcription factors that include MYB, bHLH and WDR proteins (Koes et al., 2005; Ramsay and Glover, 2005). It has been reported that transient or stable expression of MYB and bHLH transcription factors is sufficient to enable anthocyanin biosynthesis in tissues where anthocyanins are not normally expressed (Butelli et al., 2008; Starkevic et al., 2015; Zhang et al., 2013). In N. benthamiana, transient expression of the Arabidopsis MYB transcription factor PAP1 was shown to lead to the biosynthesis of D3R (Hugueney et al., 2009). Co‐expression of the MYB and bHLH transcription factors from Antirrhinum majus, Rosea1 and Delila also led to the biosynthesis of D3R (Outchkourov et al., 2014). Here, we have compared the efficiency of these transcription factors to induce anthocyanin biosynthesis in N. benthamiana leaves. The transient expression of Delila alone did not lead to any colour or anthocyanin biosynthesis in the infiltrated area. Expression of Rosea1 alone or PAP1 alone both led to a weak grey colour, and LC–MS analysis revealed a single peak with the mass of delphinidin‐3‐O‐rutinoside (Figure 1). Expression of Delila together with Rosea1 or PAP1 also led to grey colour and biosynthesis of D3R, but the infiltrated areas became necrotic in some leaves. Therefore, infiltration of constructs for expression of transcription factors in N. benthamiana can lead to anthocyanin biosynthesis, but only of D3R. In addition, only a very low amount of this anthocyanin can be obtained.

Figure 1.

Transient expression of PAP1, Rosea1 and Delila in Nicotiana benthamiana leaves. (a) N. benthamiana leaves infiltrated with mixes of Agrobacterium strains for expression of Rosea1 and Delila (mix 1), PAP1 and Delila (mix 2), Rosea1 (mix 3), PAP1 (mix 4) and Delila (mix 5), 6 days after infiltration. The two pictures show two leaves of the same plant infiltrated with the same Agrobacterium strain mixes, with the lower leaf being lower on the plant. (b) LC–MS analysis of infiltrated tissue extracted from the upper leaf shown in (a). Compounds were identified by UV/VIS in maxplot detection from 280 to 600 nm and ESI‐MS between m/z 400 to 700 in positive ionization mode [M + H]⁺.

Co‐infiltration of all anthocyanin biosynthetic genes leads to anthocyanin biosynthesis

Achieving the biosynthesis of other anthocyanins should be feasible by transient expression of all biosynthetic genes in a given pathway without relying on transcription factors. To test this approach, we expressed all known biosynthetic genes necessary for the production of C3G. The pathway consists of 10 genes, including three genes for phenylpropanoid biosynthesis (phenylalanine ammonia‐lyase, PAL; cinnamate‐4‐hydroxylase, C4H; 4‐coumarate:CoA ligase, 4CL) and seven genes for flavonoid biosynthesis (chalcone synthase, CHS; chalcone isomerase, CHI; flavanone 3‐hydroxylase, F3H; flavonoid 3′‐hydroxylase, F3′H; dihydroflavonol 4‐reductase, DFR; anthocyanidin synthase, ANS; and anthocyanin 3‐O‐glucosyltrasferase, 3GT) (Saito et al., 2013; Shi and Xie, 2014) (Figure 2a). In addition, at least one additional gene, coding for a glutathione S‐transferase (GST), is required for the transport and sequestration of anthocyanins to the vacuole (Sun et al., 2012). All genes were cloned from Arabidopsis by PCR amplification from cDNAs using gene‐specific primers. The GST, which had been first characterized in maize and petunia (Alfenito et al., 1998; Marrs et al., 1995), was cloned from petunia. We also cloned an anthocyanin permease (AP) involved in the transport of proanthocyanidin precursors to the vacuole (TT12) to check whether it could also be used for anthocyanin transport to the vacuole. All genes were subcloned in expression vectors under control of the 35S promoter and were transiently expressed in N. benthamiana leaves by Agrobacterium‐mediated delivery of the constructs. A reddish‐brown colour appeared in the infiltrated area 3 days after infiltration and continued to develop in the next few days, suggesting successful anthocyanin biosynthesis (Figures 2b and 3a). LC–MS analysis revealed the presence of two peaks that showed the typical UV‐absorbance of anthocyanins with a maximum of 510–520 nm, with [M + H]⁺ ions at m/z 449 and 595 characteristic for C3G and cyanidin 3‐O‐rutinoside (C3R), respectively (Figures 2c and 3b). The presence of C3R, which has a rhamnose attached to the glucose residue of C3G (Figure 3c), indicates that some endogenous flavonoid biosynthesis genes from N. benthamiana are also expressed in the infiltrated leaf and contribute to anthocyanin formation. To test which genes may already be expressed endogenously, we infiltrated the complete set of genes, omitting each gene individually in 12 separate infiltrations (Figure S1). We then repeated the infiltrations with the minimal set of genes identified (Figure 2b). These data indicate that four genes are absolutely required: CHS, DFR, ANS and GST, and no anthocyanin is produced without them. Two genes are already expressed in the N. benthamiana genome (PAL and F3H), but additional transient expression increases the amount of anthocyanin produced. One gene, F3′H, is not expressed in the N. benthamiana genome (as expected) and was used for the biosynthesis of C3G. Omitting F3′H led to the expression of pelargonidin 3‐O‐glucoside (P3G) and pelargonidin 3‐O‐rutinoside (P3R, Figure 2c; Figure 3a,b). Finally, five genes do not need to be transiently expressed as they are already sufficiently expressed in the N. benthamiana genome (C4H, 4CL, CHI and 3GT) or are not necessary (potentially the AP). In summary, seven genes need to be co‐expressed for efficient production of C3G (PAL, CHS, F3H, F3′H, DFR, ANS and GST). Biosynthesis of P3G is obtained by omitting the F3′H gene.

Figure 2.

Anthocyanin biosynthesis in Nicotiana benthamiana leaves by transient expression of biosynthetic genes. (a) The anthocyanin biosynthetic pathway starts with phenylalanine. Enzymes that need to be transiently expressed for high‐level C3G biosynthesis are highlighted in yellow. The enzymes that do not require transient expression are highlighted in grey. Additional biosynthetic enzymes, such as glucosyltransferases (GT), acyltransferases (AT) and methyltransferases (MT), are required for the biosynthesis of more complex anthocyanins. (b) N. benthamiana leaves infiltrated with mixes of Agrobacterium strains for expression of anthocyanin biosynthetic genes, 6 days after infiltration. The leaves were infiltrated with agrobacterium strain mixes for expression of all 13 genes tested (mix a + b, with mix a for expression of At Pal, At CHS, At F3H, At F3′H, At ANS, At DFR, Ph GST and mix b for expression of At C4H, At 4CL, At CHI, At 3GT, At AP) or for expression of a minimal set of genes (mix a). The leaves were also infiltrated with Agrobacterium strain mixes similar to mix a, but lacking one of the genes, as indicated. (c) LC–MS analysis of infiltrated tissues of infiltrations shown in (b). Compounds were identified by UV/VIS in maxplot detection from 280 to 600 nm and ESI‐MS between m/z 400 to 700 in positive ionization mode [M + H]⁺.

Figure 3.

Biosynthesis of the basic anthocyanins in Nicotiana benthamiana leaves by transient expression of biosynthetic genes. (a) Leaf of a N. benthamiana wildtype plant infiltrated with mixes of agrobacterium strains for biosynthesis of P3G (infiltration 1), C3G (infiltration 2) and D3G (infiltrations 3 and 4), 6 days after infiltration. The components of the agrobacterium strain mixes 1–4 are detailed in (b). (b) LC–MS analysis of infiltrated tissues shown in (a). (c) Structure of P3G/P3R (R1 = R2 = H), C3G/C3R (R1 = OH, R2 = H) and D3G/D3R (R1 = R2 = OH), with the structure of the anthocyanin 3‐O‐glucosides shown on the left and the rutinosides on the right. (d) Infiltration of the same Agrobacterium strain mixes as in (a) but in a leaf of a plant of the N. benthamiana line 29–2, which lacks RhamT activity. (e) LC–MS analysis of infiltrated tissues shown in (d). Compounds were identified by UV/VIS in maxplot detection from 280 to 600 nm and ESI‐MS between m/z 400 to 700 in positive ionization mode [M + H]⁺.

For the biosynthesis of D3G, we replaced the F3′H gene with a flavonoid 3′ 5′ hydroxylase (F3′5′H). Since Arabidopsis makes cyanidin‐based anthocyanins and does not have a F3′5′H, we used a Petunia hybrida gene (Figure 3a). Surprisingly, six peaks were observed, with an UV‐absorbance between 510–530 nm, characteristic for anthocyanins and with masses characteristic for pelargonidin glycosides, P3G and P3R, [M + H]⁺ 433.4 and 579.5, respectively, cyanidin glycosides, C3G and C3R, [M + H]⁺ 449.4 and 595.5, respectively, and delphinidin glycosides, D3G and D3R, [M + H]⁺ 465.4 and 611.5, respectively (Figure 3b, mix 3). Apparently, the petunia F3′5′H is not specific for delphinidin and also leads to the production of pelargonidin and cyanidin. A campanula F3′5′H has been reported to lead to the selective accumulation of delphinidin derivatives in tobacco (Okinaka et al., 2003). Here, we cloned and tested a F3′5′H gene from Campanula persicifolia. The use of this gene gives rise to mostly delphinidins, D3G and D3R (Figure 3b, mix 4).

As GST was the only gene not sourced from Arabidopsis in the previous experiment (except F3′5′H), we also tested the GST from Arabidopsis (TT19) as an alternative to the petunia GST. Our findings revealed comparable results in terms of anthocyanin accumulation (Figure S2).

It is known that DFR genes from various species exhibit different substrate specificities (Johnson et al., 2001). Therefore, we conducted a comparison between the DFR gene from Arabidopsis and from at least another species, tomato (Solanum lycopersicum). The DFR gene from Arabidopsis was suitable for the production of all basic anthocyanin glycosides. In contrast, pelargonidin glucosides were produced less efficiently using the DFR gene from tomato (Figure S2). This result is consistent with previous observations that indicate that the tomato DFR has a substrate preference for dihydromyricetin (Bovy et al., 2002; Butelli et al., 2021), although it can also act on dihydroquercetin, as shown here.

Knockout of the N. benthamiana rhamnosyltransferase genes

It would be useful to be able to produce anthocyanin 3‐O‐glucosides without the rutinoside derivatives. One or several rhamnosyltransferases (RhamTs) must be endogenously expressed in N. benthamiana leaves. A blast search of the N. benthamiana genome in the Sol Genomics Network database (https://solgenomics.net/) (Fernandez‐Pozo et al., 2015) made using a petunia RhamT gene sequence as a query (GenBank X71059) identified two candidate genes on chromosome 4 and 17, with predicted cDNAs Niben101Scf00113g06004.1 and Niben101Scf02173g00001.1. Two transcripts, Nbv6.1trP56414 and Nbv6.1trP70740, were also identified in the N. benthamiana genome from the University of Queensland (https://benthgenome.qut.edu.au/) (Nakasugi et al., 2014). Both genes seem to be expressed in leaves, according to ATLAS (https://sefapps02.qut.edu.au/atlas/tREX6.php). An alignment of the four sequences shows that the same two genes were identified in both databases, even though the sequences are not identical, potentially as a result of sequencing errors or from being incomplete sequences (Figures S3 and S4).

Mutations in both genes were generated by the transformation of a CRIPSR construct (pAGM44963) in the N. benthamiana standard lab strain. A line lacking Cas9 and with mutations in all four alleles, line Nb 29–2, was identified in the progeny of one of the primary transformants. The plant analysed had a single nucleotide (nt) insertion (an A) and a 49 nt deletion in homologues of the gene for transcript Nbv6.1trP56414 and a single nucleotide insertion (an A) and a 7 nt deletion in homologues of the gene for transcript Nbv6.1trP70740 (Figure S5). Since all alleles have mutations that introduce frameshifts in their sequence, all progeny plants should have a null phenotype as well. As expected, infiltration of this line with constructs for biosynthesis of all three basic anthocyanins produced the anthocyanin glucosides without the rutinoside derivatives (Figure 3d,e). In the chromatograms of all WT plants, UV‐signals and the related [M + H]⁺ ions at m/z 579, 595 and 611 represent the rutinosides of pelargonidin, cyanidin and delphinidin (Figure 3b). These signals are missing in the infiltrations performed in the CRISPR line.

Use of transcription factors for high‐level production of anthocyanins

As shown above, co‐expression of all genes in a pathway can lead to the production of all basic anthocyanins. This protocol is, however, not very robust and is dependent on the growing conditions and the time of year (for plants grown in a greenhouse). In some cases, very low anthocyanin production is obtained, and anthocyanins are barely visible on the leaf. It would be useful to be able to more efficiently induce the anthocyanin biosynthetic pathway using transcription factors, as not only biosynthetic pathway genes are induced by Delila and Rosea1, but also upstream genes involved in the biosynthesis of the precursors phenylalanine and malonyl CoA (Outchkourov et al., 2018). However, as seen in Figure 1, the use of the transcription factors Delila, Rosea1 or PAP1 only resulted in a low amount of anthocyanin produced. What could be the reason for that?

We hypothesized that one of the genes that should be induced by Rosea1 and Delila must be limiting and may either not be induced or be weakly induced in N. benthamiana, or may have a mutation lowering its function. To find out which one, we infiltrated wildtype N. benthamiana plants with the construct for expression of Rosea1 (which led to the highest amount of anthocyanin production in figure 1) together with each of the seven biosynthetic genes that we have identified as required for anthocyanin production, each one in a separate infiltration. A very clear result shows that expression of ANS is the problem and that co‐infiltration of a heterologous ANS with Rosea1 solves the problem (Figure 4a). LC–MS analysis shows that the anthocyanin produced is still D3R (Figure 4b,c). Infiltration of constructs for expression of Rosea1 and ANS on N. benthamiana plants from line Nb 29–2 resulted in the production of D3G. Therefore, co‐expression of Rosea1 and Arabidopsis ANS in the leaves of Nb 29–2 benthamiana plants or wildtype plants can lead to high levels of production of pure D3G or D3R, respectively.

Figure 4.

Anthocyanin biosynthesis in Nicotiana benthamiana leaves by co‐expression of Rosea1 and selected anthocyanin biosynthetic genes. (a) Leaves of N. benthamiana wildtype infiltrated with an Agrobacterium strain for expression of Rosea1 alone (neg) or with strains for expression of Rosea1 and one of the anthocyanin biosynthetic gene, as indicated, 6 days after infiltration. (b) Leaves of N. benthamiana wildtype (left) or line Nb 29–2 line (right) infiltrated with strains for expression of Rosea1 and At ANS. (c) LC–MS analysis of infiltrated tissues of infiltrations shown in (b). Compounds were identified by UV/VIS in maxplot detection from 280 to 600 nm and ESI‐MS between m/z 400 to 700 in positive ionization mode [M + H]⁺.

Knockout of N. benthamiana F3′5′H and biosynthesis of all basic anthocyanins

To produce basic anthocyanins other than D3G using transcription factors, it would be necessary to have a line lacking F3′5′H enzymatic activity. Such a line would be expected to produce only the pelargonidin glycoside after expression of Rosea1 and ANS (Figure 2a). Additional expression of a heterologous F3′H gene would be expected to lead to the formation of the cyanidin glycoside.

Two F3′5′H homologues were identified in the N. benthamiana genome on chromosomes 1 and 2 using a blast search of the Sol Genomics database with the petunia F3′5′H gene (sequence of pAGM10493) as a query. Two predicted cDNAs, Niben101Scf14625g02006.1 and Niben101Scf03963g01002.1, were picked out. The Niben101Scf03963g01002.1 coding sequence is present in two reading frames. There is probably an error in this sequence, as an alignment of the genomic sequence with the two introns manually removed indicates a single reading frame for both homologues (Figure S6). A CRISPR construct containing a single guide RNA targeting both homologues, pAGM70984, was transformed in the N. benthamiana line Nb 29–2 lacking RhamT activity. Primary transformants were screened by infiltration of constructs for expression of Rosea1 and ANS. Surprisingly, the infiltration did not lead to visible anthocyanin formation in 7 out of 10 tested transformants (Figure S7). This is probably because the DFR gene from N. benthamiana cannot use dihydrokaempferol efficiently as a substrate, as is the case for the DFR genes of other plants in the Solanaceae family. Co‐infiltration of the same plants with Rosea1 and ANS together with a construct for expression of the campanula F3′5′H restored delphinidin biosynthesis, confirming that the two F3′5′H homologues were indeed knocked out and not another gene involved in anthocyanin biosynthesis. Sequencing of a PCR product amplified from one of the two target genes from genomic DNA extracted from positive plants revealed a mix of sequences indicative of the presence of mutations at this locus (not shown). Unfortunately, the mutant plants were found to be sterile and could not be used further.

As an alternative, we tried to silence both homologues by RNAi using a hairpin construct made using a 298 bp DNA fragment from one of the two N. benthamiana F3′5′H genomic sequences (Figure S6). Infiltration of constructs for expression of Rosea1, Arabidopsis ANS and the hairpin construct led to the absence of anthocyanin biosynthesis (Figure 5a–c, mix 1). Infiltration of the same constructs together with a DFR gene from Pelargonium zonale led to P3G biosynthesis (Figure 5b,c, mix 2), confirming the hypothesis that the DFR from N. benthamiana cannot use or does not use dihydrokaempferol efficiently as a substrate. Infiltration of Rosea1 and Arabidopsis ANS, F3′H and DFR led to a high level of C3G (Figure 5b,c, mix 3), and to a lower level of C3G when Arabidopsis DFR was omitted (Figure S8). When the same construct combinations were infiltrated on wildtype N. benthamiana plants, the corresponding rutinoside derivatives were obtained (Figure 5e). In summary, we can produce high levels of the three basic anthocyanins by infiltrating defined combinations of 2–5 constructs in the leaves of N. benthamiana line 29–2.

Figure 5.

Biosynthesis of the basic anthocyanins in Nicotiana benthamiana leaves by co‐expression of Rosea1 and selected biosynthetic genes. (a) Schematic representation of the constructs present in Agrobacterium strains infiltrated in leaves shown in (b) and (d). (b) Leaf of a N. benthamiana wildtype plant infiltrated with Agrobacterium strain mixes 1–4 as detailed in (a). (c) LC–MS analysis of infiltrated tissues shown in (b). (d) Leaf of a plant from N. benthamiana line Nb 29–2 infiltrated with the same Agrobacterium strain mixes (1–4) as in (b). (e) LC–MS analysis of infiltrated tissues shown in (d). Compounds were identified by UV/VIS in maxplot detection from 280 to 600 nm and ESI‐MS between m/z 200 to 1200 in positive ionization mode [M + H]⁺.

Anthocyanin production of the three basic anthocyanins using transcription factors was more robust and reproducible than when using only pathway genes, as previously shown in figure 3. For example, a high amount of anthocyanin was visible on all three leaves of infiltrated plants (Figure S9a). Also, infiltration of the same construct combinations for production of the three basic anthocyanins in different batches of plants and at different dates repeatedly led to high‐level anthocyanin biosynthesis (Figure S9b). The amount of C3G that was produced in multiple experiments (Figures 5, 6, 7; Figures S8 and S9) was quantified using a standard curve made with a C3G standard. It ranged from 1306 to 3515 μM (0.6 to 1.7 mg/g FW), with an average of 2523 μM (1.22 mg/g FW).

Figure 6.

Biosynthesis of Arabidopsis thaliana anthocyanins in Nicotiana benthamiana line Nb 29–2. (a) Leaf of a N. benthamiana plant from line Nb 29–2 infiltrated with Agrobacterium strain mixes 1–4, as detailed below the leaf picture, for production of C3G and of Arabidopsis anthocyanins A5, A8 and A11. (b) LC–MS analysis of infiltrated tissues shown in (a). Compounds were identified by UV/VIS in maxplot detection from 280 to 600 nm and ESI‐MS between m/z 200 to 1200 in positive ionization mode [M + H]⁺. (c) Structure of Arabidopsis anthocyanins A5 (R1 = R2 = H), A8 (R1 = H, R2 = glucose), A9 (R1 = sinapoyl, R2 = H) and A11 (R1 = sinapoyl, R2 = glucose), showing enzymes required for incorporation of the various sugars and acyl groups.

Figure 7.

Biosynthesis of Arabidopsis thaliana A5 derivatives in Nicotiana benthamiana line Nb 29–2. (a) Leaf of a N. benthamiana plant from line Nb 29–2 infiltrated with Agrobacterium strain mixes 1–4, as detailed below the leaf picture, for production of C3G and of anthocyanins pelargonidin A5 (Pel A5), cyanidin A5 (Cya A5 = A5) and delphinidin A5 (Del A5). (b) LC–MS analysis of infiltrated tissues shown in (a). Compounds were identified by UV/VIS in maxplot detection from 280 to 600 nm and ESI‐MS between m/z 200 to 1200 in positive ionization mode [M + H]⁺. (c) Structures of the anthocyanins Pel A5 (R1 = R2 = H), Cya A5 (R1 = OH, R2 = H) and Del A5 (R1 = OH, R2 = OH).

Biosynthesis of complex anthocyanins

Anthocyanins usually show a more complex substitution pattern than simple 3‐O‐glycosylation (Saito et al., 2013). For example, Arabidopsis anthocyanins typically consist of a mix of compounds that contain a C3G backbone linked with up to three sugar residues and three acyl groups (Saito et al., 2013; Shi and Xie, 2014; Tohge et al., 2005). We have tried here to reconstitute the biosynthetic pathway for Arabidopsis anthocyanins.

One of the Arabidopsis anthocyanins, A5 (cyanidin 3‐O‐[6‐O‐(p‐coumaroyl)‐2‐O‐(beta‐D‐xylosyl)‐beta‐D‐glucosyl]‐5‐O‐(6‐O‐malonyl‐beta‐D‐glucoside)), requires the expression of four genes (UGT79B1/At5g54060, UGT75C1 also noted At 5GT/At4g14090, At 3AT1/At1G03940 and At 5MAT/At3g29590) for incorporation of two sugars (glucose and xylose) and two acyl groups (coumaroyl and malonyl, Figure 6c). Co‐infiltration of constructs for induction of anthocyanin biosynthesis (Rosea1), silencing of the endogenous F3′5′H genes and expression of additional Arabidopsis biosynthetic genes (ANS, F3′H, DFR and the four genes necessary for A5 biosynthesis) led to strong coloration. LC–MS analysis revealed two peaks with a molecular mass of 975 [M + H]⁺, consistent with the mass of the anthocyanin A5 (Figure 6b, mix 2). The earlier eluting peak was present in a lower amount and is proposed to be a cis‐coumaroyl isomer of A5, while the second, more prominent peak, should be the trans isomer (Rowan et al., 2009).

Co‐infiltration of one additional glucosyltransferase gene to add a glucose residue to A5 (At Bglu10/AT4G27830) led to a peak with a molecular ion [M + H]⁺ at m/z 1137, consistent with anthocyanin A8, as expected (Figure 6b, mix 3). A8 was, however, detected in a very small amount, and the majority of anthocyanin produced was still A5. The addition of yet one more gene for the addition of a ‘final’ sinapoyl residue (At SAT/At2G23000) did not lead to the biosynthesis of the expected anthocyanin, A11, but gave rise to the same pattern as obtained without this construct (Figure 6b, mix 4).

The biosynthesis of anthocyanin A5 in high amounts provided the opportunity to try to generate novel anthocyanins. We infiltrated sets of constructs to produce the pelargonidin and delphinidin versions of A5 (Figure 7). These would have the same decoration pattern as A5, but on pelargonidin and delphinidin backbones. Consistent with our expectations, infiltration of the constructs indeed led to the biosynthesis of the expected anthocyanins, with the corresponding molecular ions [M + H]⁺ at m/z of 959 and 991 for pelargonidin A5 and delphinidin A5, respectively (Figure 7b, mixes 2 and 4). In all three infiltrations, a major peak and a minor peak were observed, corroborating the two expected isomers. Delphinidin A5 is a novel anthocyanin that has not been previously described.

Discussion

The set of tools presented here allow us to reconstitute anthocyanin biosynthetic pathways in just a few days once all needed genes are cloned. Subcloning of biosynthetic genes in an expression construct can be done extremely easily since a binary vector that already contains a promoter (the 35S promoter for high expression in transient assays) and a terminator (the Nos terminator), pAGM53151, is available (Addgene #169093). Cloning of the genes in this vector is usually done with Golden Gate cloning using the enzyme BsaI, but can also be done by homology‐based cloning of a PCR product using Gibson assembly or any alternative method such as SLIC or TEDA (Xia et al., 2019).

In this work, we were able to produce the basic anthocyanins P3G, C3G and D3G and their rhamnosylated derivatives. Production of C3G using transcription factors was on average 1.2 mg/g of fresh weight, reaching an amount found in some anthocyanin‐rich fruits (Avula et al., 2023). Production of the basic anthocyanins requires infiltrating two constructs for D3G, four constructs for P3G and five constructs for C3G. One of the constructs that is needed harbours an anthocyanidin synthase gene, as the endogenous enzyme from the standard N. benthamiana lab strain is not working properly. The lab strain is able to express an enzyme with ANS activity, as a low amount of the rutinoside delphinidin is produced after infiltration of the MYB transcription factors Rosea1 or PAP1. However, much higher anthocyanin amounts can be produced by transiently co‐expressing a heterologous ANS gene together the MYB gene. The ANS of the lab strain is either expressed at a too low level, or one or both of the potential homologues may contain one or several mutations. A blast search of the N. benthamiana transcriptome of the University of Queensland (https://benthgenome.qut.edu.au/) using the Arabidopsis ANS as a query identified two transcripts annotated as anthocyanidin synthase, Nbv6.1trP1132 and Nbv6.1trP59416. Nbv6.1trP59416 contains a frameshift in coding sequences and seems to be inactive. Further work will be required to understand which gene contributes to ANS activity in the lab strain and if all the homologues are functional or not. It has recently been reported that the N. benthamiana cultivars Northern Territory and QLD are able to produce anthocyanins at a higher level than the standard lab strain (Bally et al., 2015; Ranawaka et al., 2023; Thole et al., 2019). It should be possible to generate a RhamT mutant in any of these backgrounds, as we have done for the standard lab strain, to produce anthocyanins by transient expression without the need for co‐infiltrating an ANS construct. Alternatively, the N. benthamiana lab strain could be stably transformed with a construct for ANS expression to make a line suitable for high‐level anthocyanin production without the need for co‐expression of an ANS construct. As a simpler alternative, we plan to subclone all genes needed for expression of the basic anthocyanins, including ANS, in a single T‐DNA construct. This will result in three constructs, each one for the production of a basic anthocyanin. With such constructs, it should be possible to produce any basic anthocyanin by infiltration of a single construct in the Nb 29–2 line in the standard N. benthamiana lab strain background.

Production of more complex anthocyanins can be performed by co‐infiltrating constructs carrying additional pathway genes. We were able to produce Arabidopsis anthocyanin A5 at a high level and in relatively pure form by expressing four genes in addition to the genes required for the production of C3G. Production of anthocyanin A8 was also successful, but only a very low amount was produced. Two alternative explanations are plausible. First, the glucose that was added to A5 is normally added as the last step in the biosynthesis of the major Arabidopsis anthocyanin A11. In natural conditions, a sinapoyl residue is first attached to A5, leading to anthocyanin A9, which is then converted to A11 by the addition of a final glucose residue (Miyahara et al., 2013; Yonekura‐Sakakibara et al., 2012). It is therefore possible that the addition of the glucose residue would be more efficient using A9 as a substrate rather than A5. However, A9 could not be produced at all. This is because the acyl sugar donor required for the biosynthesis of A9 from A5 by SAT is sinapoylglucose (Fraser et al., 2007), which is likely not present in N. benthamiana. The second explanation why only a small peak of A8 was obtained is that the last two steps of A11 anthocyanin biosynthesis take place in the vacuole by vacuolar‐localized enzymes. Unlike cytosolic UGTs that are catalysed by UDP‐sugar‐dependent UGTs, vacuolar glycosides are synthesized by acyl‐glucose‐dependent anthocyanin UGTs (Sasaki et al., 2014). In the case of Bglu10, the acyl sugar donor is normally sinapoylglucose, but the enzyme is known to also accept other acyl sugar donors (Miyahara et al., 2013). Therefore, the small amount of A8 obtained by expression of At Bglu10 was likely synthesized using a different type of acyl sugar donor, but less efficiently than if sinapoylglucose had been used.

The failure to make anthocyanin A11 indicates that the lack of some specialized metabolite precursors in N. benthamiana may be a limitation for reconstitution of the biosynthetic pathways of other complex anthocyanins. There are, however, potential solutions for this problem. Indeed, it should be possible to transiently express genes required for the biosynthesis of any specialized metabolite that is needed as a substrate, and we will test this in future work. Alternatively, the delivery of some chemically synthesized precursors by infiltration or even a combination of both approaches, that is the delivery of some chemical precursors and some biosynthetic enzymes, could be sufficient to engineer the biosynthesis of any needed substrate (Kwan et al., 2023).

Transient expression of transcription factors and/or biosynthetic genes may not always be sufficient for reconstitution of heterologous biosynthetic pathways, as sometimes the endogenous metabolism of the host plant interferes with the biosynthesis of the desired product. In the case of anthocyanin biosynthesis, a RhamT expressed endogenously in N. benthamiana leaves led to the addition of a rhamnose to all basic anthocyanin‐3‐O‐glucosides, preventing the biosynthesis of more complex anthocyanins that should not contain this sugar at this position. Infiltration of all genes necessary for the biosynthesis of the basic anthocyanins without using any transcription factor produced anthocyanin 3‐O‐glucosides, but only as part of a mix that also contained rutinoside derivatives. The ratio between the two peaks appears to be developmentally regulated, as the ratio varied in different leaves of the same plant (not shown). This suggests that the RhamT‐encoding gene(s) are expressed endogenously before infiltration. These genes are also strongly induced by the expression of Rosea1, as only the rhamnosylated version of delphinidin was produced when using the transcription factors PAP1 or Rosea1. Two strategies were tested to remove the RhamT activity. The first one consisted of silencing the two RhamT‐encoding genes by transient expression by RNAi using a hairpin construct. This worked quite well, but remnants of rhamnosylation were detected in the anthocyanins produced (Figure S10). In contrast, when both RhamT‐encoding genes were inactivated by CRISPR mutagenesis, rhamnosylation was completely eliminated in knockout plants. The residual RhamT activity that was observed when using a hairpin construct for silencing may come from a pool of RhamT enzyme already present in the leaf before infiltration, which, of course, could not be removed by silencing. Therefore, CRISPR mutagenesis, in this case, provided a more complete solution.

Other genes potentially interfering with anthocyanin biosynthesis are endogenous N. benthamiana F3′5′H genes that are induced by the expression of Rosea1. Expression of these genes is not a problem for making delphinidin‐based anthocyanins and is even beneficial for this purpose, but it must be prevented to produce other anthocyanins. Unlike with the RhamT encoding genes, F3′5′H activity could be completely suppressed by transient expression of a silencing hairpin construct, probably because the F3′5′H genes were not expressed before induction by Rosea1 transient expression. This is corroborated by the fact that expression of all biosynthetic genes to produce C3G minus the F3′H did not lead to the biosynthesis of D3G but only led to the formation of P3G and P3R (Figure 2). Being able to use a hairpin construct for silencing rather than CRISPR mutagenesis provides more flexibility/convenience for the user, as it does not require maintaining an additional N. benthamiana line in the greenhouse. Therefore, only the N. benthamiana Nb 29–2 line is necessary for producing any basic anthocyanin of choice, as well as some more complex anthocyanins. The standard wildtype N. benthamiana lab strain can still be used to make anthocyanins based on rhamnosylated basic anthocyanins or to make non‐rhamnosylated anthocyanins by co‐infiltration of the hairpin constructs pAGM81975 or pAGM81987 to transiently silence (but not completely) RhamT genes.

In conclusion, the system presented here should allow users to make any basic anthocyanin of choice, to produce complex anthocyanins found in other plant species and to engineer novel anthocyanins not found in nature. This system should be useful to help identify genes involved in the biosynthesis of complex anthocyanins for pathways that are not yet elucidated.

Experimental procedures

Generation of constructs

Gene coding sequences were amplified from cDNAs using gene‐specific primers and cloned as MoClo level 0 modules in plasmid pICH41308 using BpiI as previously described (Engler et al., 2014). Restriction sites for BsaI and BpiI were removed from internal sequences during cloning using primers to introduce silent mutations. All level 0 modules were sequenced. A list of all level 0 modules and level 1 constructs used for transient expression is shown in Figure S11. The sequence of all level 0 modules is given in Figure S12.

The Arabidopsis coding sequences for level 0 modules pMG211 (PAL, AT2G37040), pMG222 (C4H, AT2G30490), pMG233 ( 4CL , AT1G51680), pMG99 (CHS, AT5G13930), pMG100 (CHI, AT3G55120), pMG111 (F3H, AT3G51240), pMG133 (F3′H, AT5G07990), pMG122 (DFR, AT5G42800), pMG144 (ANS, AT4G22880), pAGM10503 (3GT, AT5G17050 (Tohge et al., 2005)), pAGM21785 (TT19, GST, AT5G17220), pAGM10211 (anthocyanin transporter TT12, AT3G59030), pAGM14091 (PAP1, AT1G56650, (Borevitz et al., 2000)), pAGM12961 (At3AT1, AT1G03940 (Luo et al., 2007)), pAGM12972 (At5GT, AT4G14090 (Tohge et al., 2005), pAGM12984 (At5MAT, AT1G03940 (D'Auria et al., 2007)), At79B1, pAGM12995 (AtSAT, AT2G23000 (Fraser et al., 2007)), pAGM13021 (AtBglu10, AT4G27830 (Miyahara et al., 2013)) were amplified from cDNAs prepared from tissues (leaves, stems and flowers) of Arabidopsis plants old enough to produce some anthocyanins.

Two other DFR‐coding sequences were cloned from Pelargonium zonale and tomato. The pelargonium sequence was amplified from P. zonale petal cDNAs with primers designed from GenBank sequence AB534774, resulting in level 0 module plasmid pAGM47851. The tomato DFR coding sequence was amplified from tomato leaf cDNAs with primers designed from GenBank sequence Z18277 (Bongue‐Bartelsman et al., 1994), resulting in level 0 module plasmid pAGM17641.

A petunia F3′5′H coding sequence was cloned from cDNA prepared from petunia purple/blue flowers. PCR primers were designed using GenBank sequence Z22545.1 (Holton et al., 1993). The cloned sequence was, however, found to be identical to the F3′5′H sequence from GenBank sequence EF371021. The plasmid containing the cloned level 0 module is pAGM10493. A F3′5′H sequence was also cloned from Campanula persicifolia. The 3′ end of the sequence was cloned by amplification from petal cDNAs using primers designed from the Campanula medium F3′5′H sequence (GenBank HW349464, primers bluecyp20, tt ggtctc a ACAA agccttctgtttctgccaatgacttgg) and bluecyp24, tt ggtctc a ACAA aagcctagacagtgtaagcacttggagg). The 5′ end of the sequence could not be amplified using primers designed from the C. medium sequence and was determined using 5’ RACE. The complete sequence, with BsaI and BpiI restriction sites removed using silent mutations, was cloned as a level 0 module, resulting in plasmid pAGM44931.

Coding sequences for the MYB and BHLH transcription factors Rosea1 (Schwinn et al., 2006) and Delila (Goodrich et al., 1992) were amplified from Antirrhinum majus petal cDNAs using primers designed from GenBank sequences DQ275529.1 (Rosea1, level 0 module plasmid pAGM44082) and AMADEL (Delila, resulting level 0 module plasmid pAGM44071).

A construct for silencing of the two N. benthamiana F3′5′H genes was made by amplifying a F3′5′H fragment from cDNA prepared from a N. benthamiana leaf infiltrated with pAGM45244 (Rosea1) and pAGM10775 (At ANS) 3 days before RNA extraction. Amplification of sense and antisense fragments was performed with primers F35s5 (tt gaagac aa CTCA AATG gTGGCCGGTGATCGGCGCACTAC) and F35s6 (tt gaagac aa CTCG ACCT tACATTTGCCCAATTTTCTAAGGCTTTTCCC), and F35s3 (tt gaagac aa CTCA CAGG TACATTTGCCCAATTTTCTAAGGCTTTTCCC) and f35s4 (tt gaagac aa CTCG AAGC GTGGCCGGTGATCGGCGCACTAC). Both PCR products were cloned using BpiI into cloning vector pAGM9121 (Addgene Plasmid #51833), and the resulting clones, pAGM81735 and pAGM81750, were sequenced. pAGM81735 and pAGM81750 were then assembled with a spacer sequence in a binary vector construct with the 35S promoter and the Nos terminator, resulting in construct pAGM81963 (sequence in Figure S13).

The constructs needed for producing anthocyanins in N. benthamiana will be deposited at Addgene. These include pAGM45244, pAGM10775, pAGM10764, pAGM54418, pAGM10440, pAGM81963, pAGM81975 and pAGM81987 for making basic anthocyanins from either the N. benthamiana wildtype or line 29–2. In addition, plasmids for making Arabidopsis‐specific anthocyanins, pAGM13414, pAGM13425, pAGM13437, pAGM19465, pAGM19477 and pAGM13451, are also available, as well as the empty level 1 expression vector containing the 35S promoter and Nos terminator, pAGM53151. The RhamT‐deficient N. benthamiana line 29–2 is available on request.

CRISPR mutagenesis

Constructs for CRISPR mutagenesis were designed using an intronized Cas9 sequence as previously described (Grutzner et al., 2021). A first CRISPR construct was designed to target the two RhamT homologues identified in the N. benthamiana genome. A target site present in both genes (rtd1, ggaggtagaccttcaacttg agg) was selected using CHOPCHOP (https://chopchop.cbu.uib.no/). The resulting CRISPR construct, pAGM44963, was transformed into the N. benthamiana standard lab strain. Transgenic lines with active Cas9 were selected by PCR amplification with two primers for sequences present in both genes, nibrt1 (ctcctactttggcttctccatgtc) and nibrt11 (cccttgagtcctgagagtacac), and by sequencing the PCR product with gene‐specific primers nibrt7 (cacacgctcaatattgtactacag) and nibrt8 (cactacaacacataattatactacagaatc). To identify all mutations present in positive lines, a PCR product was amplified from genomic DNA with primers in sequences conserved in both homologues, nibrt9‐p2: catttacaattatcgatac agctcaccattcattctacctacc and nibrt10‐p2: gcttgactctagaggatc gtaggaccgccatggaagctcttg (sequences in italics are 5′ extensions with homology to a cloning vector). The PCR product was cloned into vector pAGM71445 by homology‐based cloning, and 10 clones per plant were sequenced and analysed.

A second CRISPR construct was designed to target the two F3′5′H homologues identified in the N. benthamiana genome. A single guide RNA targeting both homologues (TGTGGCATGGCTCCTAAGTATGG) was selected using CRISPOR (http://crispor.tefor.net/). The resulting construct, pAGM70984, was transformed into N. benthamiana line Nb 29–2. To identify plants with mutations at the target sites, a PCR product was amplified from one of the two target genes with primers site49F (ggtgttatttactgagcttactatagcag) and site49R (cttgtgcattataggccaaatgggtg) from genomic DNA extracted from the transformants.

Transient expression in N. benthamiana

Constructs were transformed into Agrobacterium strain GV3101:pMP90. The transformed Agrobacterium strains were grown at 28 °C in LB medium supplemented with rifampicin and either carbenicillin for level 1 constructs or kanamycin for level 2 constructs (all at 50 μg/mL). The cultures were diluted to an OD600 of 0.2 in an infiltration solution containing 10 mM MES pH 5.5 and 10 mM MgSO₄ and infiltrated in the leaves of greenhouse‐grown N. benthamiana plants using a syringe without a needle. The three main leaves of 6–8‐week‐old plants (depending on season) were infiltrated, usually resulting in the highest expression level in the upper and middle leaves. The best of the three leaves, the upper or middle leaf, was used for analysis. For co‐expression of several constructs, all Agrobacterium strains at an OD600 of 0.2 in infiltration solution were mixed in equal amounts before infiltration.

Anthocyanin analysis and quantification

For all samples, 12 mg of leaf tissue were harvested in 2 mL tubes and frozen in liquid nitrogen. Three steel beads were added per tube, and the samples were ground two times for 30 s at 30 Hz with an electric mill. One hundred and twenty microliters of methanol buffer (50% methanol, 1 mM ascorbic acid and 0.5% formic acid) was added, and the samples were vortexed and then incubated on ice for 15 min. The samples were spun at 13 000 rpm for 10 min at 4 °C. The supernatant was centrifuged one more time. Two to ten microliters of the supernatant was used for the HPLC analysis.

Extracts were analysed by reversed‐phase HPLC/ESI‐MS on a Nucleoshell RP₁₈ 100–3 mm column (Macherey‐Nagel, Düren, Germany) at a flow rate of 0.45 mL/min with either one of two different linear gradient settings depending on the anthocyanins analysed: (a) for experiments with only basic anthocyanin 3‐O‐glycosides like P3G, C3G, D3G and C3R, a gradient from 2% solvent B (acetonitrile) up to 20% B in solvent A (0.1% trifluoracetic acid) at a rate of 1%/min; and (b) for experiments with anthocyanins with a complex substitution pattern, like A5, a gradient from 5% solvent B (acetonitrile) up to 30% B in solvent A (0.1% trifluoracetic acid) within 20 min at a rate of 1.25%/min. Separation was performed on an Alliance e2695 chromatography system (Waters, Eschborn, Germany), equipped with a Waters 2996 photodiode array and a Waters QDA mass detector, respectively. Compounds were identified by UV/VIS in maxplot detection from 280 to 600 nm and ESI‐MS between m/z 400 to 700 (basic anthocyanin glycosides) and m/z 200 to 1200 (complex anthocyanins) in positive ionization mode, cone voltage set at either 15 or 20 V, respectively, both analysed using the Empower 3 software (Waters). As a reference, standards of P3G, C3G, C3R and D3G were obtained from Merck (Darmstadt, Germany).

For anthocyanin quantification, a standard curve was made by running different concentrations of a commercially available C3G standard, giving the formula Y = 9810 X − 3790, with Y being the integrated area of the C3G peak and X the concentration of the sample in μM.

Author contributions

RG, KK, CH and CE performed research. KK, AL, TV and SM contributed to the anthocyanin analysis. SM designed the experiments and wrote the manuscript, with contributions from TV.

Conflict of interest

The authors have not declared a conflict of interest.

Supporting information

Figure S1 Infiltration of different combinations of pathway genes.

Figure S2 Comparison of Petunia and Arabidopsis GST and of Arabidopsis and tomato DFR.

Figure S3 Nucleotide alignment of RhamT gene sequences.

Figure S4 Nucleotide alignment of RhamT gene sequences.

Figure S5 Chromosomal mutations in RhamT genes in Nicotiana benthamiana lines 29–2.

Figure S6 Alignment of Nicotiana benthamiana F3′5′H cDNAs.

Figure S7 Screening of Nicotiana benthamiana F3′5′H CRISPR lines.

Figure S8 Biosynthesis of C3G and C3R in Nicotiana benthamiana line 29–2 and wildtype with and without heterologous expression of At DFR.

Figure S9 Reproducible high‐level production of basic anthocyanins.

Figure S10 Silencing of Nicotiana benthamiana RhamT genes by transient expression.

Figure S11 List of MoClo level 0 modules and corresponding level 1 constructs used for transient expression.

Figure S12 Sequence of MoClo level 0 modules.

Figure S13 Sequence of construct for silencing Nicotiana benthamiana F3′5′H genes, pAGM81963.

Data availability statement

The data that support the findings of this study are openly available in https://doi.org/10.22000/1831.