ABSTRACT
In bacteria, disulfide bonds contribute to the folding and stability of proteins important for processes in the cellular envelope. In Escherichia coli, disulfide bond formation is catalyzed by DsbA and DsbB enzymes. DsbA is a periplasmic protein that catalyzes disulfide bond formation in substrate proteins, while DsbB is an inner membrane protein that transfers electrons from DsbA to quinones, thereby regenerating the DsbA active state. Actinobacteria including mycobacteria use an alternative enzyme named VKOR, which performs the same function as DsbB. Disulfide bond formation enzymes, DsbA and DsbB/VKOR, represent novel drug targets because their inhibition could simultaneously affect the folding of several cell envelope proteins including virulence factors, proteins involved in outer membrane biogenesis, cell division, and antibiotic resistance. We have previously developed a cell-based and target-based assay to identify molecules that inhibit the DsbB and VKOR in pathogenic bacteria, using E. coli cells expressing a periplasmic β-Galactosidase sensor (β-Galdbs), which is only active when disulfide bond formation is inhibited. Here, we report the construction of plasmids that allows fine-tuning of the expression of the β-Galdbs sensor and can be mobilized into other gram-negative organisms. As an example, when expressed in Pseudomonas aeruginosa UCBPP-PA14, which harbors two DsbB homologs, β-Galdbs behaves similarly as in E. coli, and the biosensor responds to the inhibition of the two DsbB proteins. Thus, these β-Galdbs reporter plasmids provide a basis to identify novel inhibitors of DsbA and DsbB/VKOR in multidrug-resistant gram-negative pathogens and to further study oxidative protein folding in diverse gram-negative bacteria.
IMPORTANCE
Disulfide bonds contribute to the folding and stability of proteins in the bacterial cell envelope. Disulfide bond-forming enzymes represent new drug targets against multidrug-resistant bacteria because inactivation of this process would simultaneously affect several proteins in the cell envelope, including virulence factors, toxins, proteins involved in outer membrane biogenesis, cell division, and antibiotic resistance. Identifying the enzymes involved in disulfide bond formation in gram-negative pathogens as well as their inhibitors can contribute to the much-needed antibacterial innovation. In this work, we developed sensors of disulfide bond formation for gram-negative bacteria. These tools will enable the study of disulfide bond formation and the identification of inhibitors for this crucial process in diverse gram-negative pathogens.
KEYWORDS: disulfide bonds, MalF-LacZ102, β-Galdbs, DsbA, DsbB, VKOR, Pseudomonas, Acinetobacter, Klebsiella, Francisella, Salmonella, Haemophilus, Vibrio, Legionella, Burkholderia, Campylobacter, Helicobacter, antibacterial, antivirulence
INTRODUCTION
More than three decades ago, the enzymes that introduce disulfide bonds were discovered, thanks to a protein fusion that was developed as a complementary approach to studying membrane protein topology (1, 2). Froshauer et al. generated hybrid proteins of the membrane protein MalF with β-Galactosidase (β-Gal, LacZ). Cytoplasmic domain fusions exhibited high levels of β-Gal activity, whereas the periplasmic domain fusions expressed low activity. This approach complemented the use of PhoA fusions, which behaved oppositely to β-Gal and strengthened the evidence of membrane topology (1, 3, 4). One fusion, MalF-LacZ102 (aka β-Galdbs for disulfide bond-sensitive β-Gal), displayed low levels of β-Gal and was found to be an in-frame hybrid of 198 amino acids of MalF attached by a three-amino acid linker (Gly-Asp-Pro) to the residue 8 of β-Gal (Fig. 1) (1). The fusion occurred at the third transmembrane segment in the middle of the long hydrophilic domain, thus placing β-Gal in the periplasm (1, 5). When β-Galdbs is expressed in the periplasm of cells with an active disulfide bond formation system, β-Galdbs is inactivated with disulfide bonds, while an inactive disulfide bond machinery would produce active β-Galdbs (Fig. 1). This fusion has been a crucial tool for the seminal discovery of the disulfide bond formation pathway in Escherichia coli, through two decades later to identify inhibitors of this process.
Fig 1.
β-Galdbs (MalF-LacZ102) monitors disulfide bond formation in the bacterial periplasm. (A) In E. coli, DsbA and DsbB participate in introducing aberrant disulfide bonds (represented as yellow lines) into periplasmic β-Galactosidase; hence, misfolding and inactivating it. (B) The removal or inhibition of either dsbA or dsbB disrupts the formation of disulfide bonds, allowing β-Galactosidase to be folded.
Disulfide bond formation plays a role in protein folding for both eukaryotes and prokaryotes. In bacteria, disulfide bonds contribute to the folding and stability of proteins involved in crucial cellular processes in the cell envelope (6–8). In E. coli, disulfide bond formation is catalyzed by DsbA and DsbB enzymes, which work together to introduce disulfide bonds into many proteins (2, 9). DsbA is a periplasmic protein, a member of the thioredoxin family, which catalyzes the formation of disulfide bonds into substrate proteins through its Cys-X-X-Cys active site (2). DsbB is a membrane protein that regenerates DsbA’s activity by transferring electrons to quinones (9–12). Some pathogenic bacteria, like Pseudomonas aeruginosa, harbor more than one copy of the DsbA-DsbB proteins (7, 13); whereas, actinobacteria, cyanobacteria, and δ-proteobacteria use an alternative enzyme named VKOR (for vitamin K epoxide reductase) that performs the same function as DsbB (14). DsbB and VKOR share no protein sequence identity, but they exhibit similar structural features and contain a quinone cofactor to generate a disulfide bond (15, 16).
The viability of mutants lacking disulfide bond-forming machinery varies from organism to organism. E. coli dsb mutants are viable aerobically but not anaerobically (17). Overall, disulfide bond formation is required for virulence but not for in vitro growth of gram-negative bacteria (6, 7); whereas, it is essential in actinobacteria (18–20). Disulfide bond-forming enzymes represent a compelling new drug target because their inhibition could simultaneously affect several proteins localized in the cell envelope, including virulence factors, proteins involved in outer membrane biogenesis, cell division, and antibiotic resistance (6, 7, 21–23). Thus, we have previously developed a cell-based and target-based assay to find molecules that inhibit the membrane proteins, DsbB and VKOR, of pathogenic bacteria (24, 25). This assay uses E. coli ΔdsbB mutant expressing the β-Galdbs in which dsbB function is complemented with a plasmid carrying either dsbB or vkor genes from pathogens (24). We then perform parallel screens of compounds to look for inhibitors of each of the enzymes (24–26). The screens are performed in parallel to provide reciprocal controls that eliminate inhibitors that influence β-Gal activity by acting directly on E. coli DsbA or affecting membrane protein assembly as those molecules would likely appear as inhibitors of both DsbB and VKOR-expressing strains. We have identified several classes of DsbB and VKOR inhibitors using this method (24, 25, 27) and we have sought to expand the small molecule search by using cell-based and target-based approaches with gram-negative organisms for which antimicrobial resistance is posing a threat.
Here, we report the construction of a series of biosensor plasmids that allow fine-tuning of the expression of β-Galdbs and are mobilizable into other gram-negative bacteria. A plasmid carrying β-Galdbs introduced into P. aeruginosa UCBPP-PA14 behaves similarly as in E. coli. The strains expressing β-Galdbs respond to molecular inhibition of the two DsbB proteins and provide a basis to look for novel inhibitors of both enzymes using P. aeruginosa cells. These vectors represent tools to further study oxidative protein folding in other gram-negative pathogens and to identify inhibitors of DsbAB proteins against these organisms.
RESULTS
Use of tightly regulated promoters to control β-Galdbs expression
Previous attempts to move the β-Galdbs into other organisms including P. aeruginosa were unsuccessful because moving the plasmid resulted in toxicity, which prevented growth of transconjugants. Dwyer et al. have shown that periplasmic LacZ is toxic to E. coli, likely due to the presence of 16 cysteines, which cause aberrant disulfide bonds introduced by DsbA, rendering misfolded β-Gal (5). The original construct (Fig. 2A, pNG102) includes the maltose-binding protein, MalE, and β-Galdbs under the maltose promoter (Pmal) (1), which was then inserted into the chromosome at the lambda att site (28). We reasoned that the difficulty in introducing the β-Galdbs construct was perhaps a combination of the basal expression levels and/or the co-expression of MalE upstream of β-Galdbs. We thus cloned only β-Galdbs into four low-copy number plasmids (p15A ori) with promoters and regulators that have been engineered to have low background, low cross-reactivity, and high dynamic range (29). The promoters are inducible with cuminic acid (Cuma, PL23), vanillic acid (Van, PL25), 2,4-diacetylphophloroglucinol (DAPG, PL26), and anhydrotetracycline (aTc, PL31).
Fig 2.
Fine-tuning levels of β-Galdbs sensor in E. coli. (A) β-Gal activity of the λ::Pmal-MalE-β-Galdbs expressed in E. coli ΔdsbB strain grown in M63 0.2% glucose supplemented with 50 µg/mL of essential amino acids (except Cys) grown at 30°C for 10 h and induced with varying concentrations of maltose. An aliquot of cells was then used to quantify β-Gal by following the hydrolysis of ONPG at 28°C using whole cells. (B) β-Gal activity of the PCymR-β-Galdbs expressed in E. coli ΔdsbB strain induced with Cuma. (C) β-Gal activity of the PVanR-β-Galdbs expressed in E. coli ΔdsbB strain induced with Van. (D) β-Gal activity of the PPhlF-β-Galdbs expressed in E. coli ΔdsbB strain induced with DAPG. (E) β-Gal activity of the PTet-β-Galdbs expressed in E. coli ΔdsbB strain induced with aTc. Data represent the average ± SD of four independent experiments. Plasmid maps were created with BioRender.com.
We transformed the plasmids (PL23, PL25, PL26, PL31) into E. coli ΔdsbB mutant in which β-Galdbs would be active, and quantified the β-Gal activity in M63 minimal medium supplemented with 0.2% glucose, 50 µg/mL of all essential amino acids, except cysteine to prevent thiol rearrangement, and serial dilutions of inducers. We used whole cells to measure the velocity of o-nitrophenyl-β-galactoside (ONPG) hydrolysis without lysing cells (no chloroform-SDS step) because ONPG, while unable to enter the cytoplasm, is permeable to the outer membrane, and β-Galdbs is in the periplasm. All four plasmids (Fig. 2B and E) impart higher β-Gal activity compared to Pmal-β-Galdbs induced with maltose (Fig. 2A). To avoid overexpression and toxicity from Pmal-β-Galdbs, we mildly induced adding maltose in media containing glucose to weaken the expression of β-Gal (Fig. 2A). The four new vectors allow titration of β-Galdbs expression at desired levels to sensitize or strengthen the assay (Fig. 2). In addition, all the concentrations used to induce the β-Galdbs resulted in similar growth compared to the growth obtained in strains harboring the Pmal-β-Galdbs (Fig. S1). In the expression of the aTc-inducible β-Galdbs vector (PL31), the biosensor plasmid with the highest expression, we see a decrease in growth of the ΔdsbB mutant only at a very high induction with 10 µM aTc (Fig. S2).
Expression of β-Galdbs in P. aeruginosa UCBPP-PA14
P. aeruginosa is one of the six pathogens for which new antibacterial agents are most desperately needed (30, 31) and is often associated with extremely difficult-to-treat infections in immunosuppressed patients for whom current antibiotic treatments fail to work (32–35). Recalcitrant infections include acute pneumonia, ulcerative keratitis, bacteremia, urinary tract, intra-abdominal, chronic airway, and wound infections (32, 36).
Some P. aeruginosa virulence factors known to contain disulfide bonds include the pilin protein PilA (37, 38), the elastolytic metalloprotease elastase (LasB), exotoxin A (39–41), the chitin-binding protein (CbpD), the immunomodulating metalloprotease IMPa and proteases PaAP and PrpL, as well as type-III secretion components required for the delivery of the effectors ExoT and ExoU (37). Disulfide bond-forming enzymes in P. aeruginosa include two dsbA and two dsbB homologs. Disulfide bond formation is mainly driven by DsbA1, which is oxidized by both DsbB1 and DsbB2 proteins (13, 25, 37). The deletion of dsbA1 and the double deletion of dsbB1dsbB2 cause a decrease in virulence in pneumonia and keratitis mice models (25, 42). Thus, inhibitors of the disulfide bond-forming enzymes would affect the folding of several virulence factors.
To use the β-Galdbs biosensor system in other gram-negative bacteria, we subcloned the four regulators and promoters together with β-Galdbs into pJN105, a broad host range (BHR) plasmid. pJN105 plasmid harbors a gentamicin resistance cassette (43), a mob site to allow conjugal delivery from E. coli strains harboring RK2 transfer machinery (44), and a BHR origin of replication (pBBR) (43) that despite the origin similarity with plasmids of gram-positive bacteria, it resides in gram-negative bacteria and does not replicate by a rolling-circle mechanism (45).
We then moved the inducible plasmids (PL60, PL61, PL62, and PL63) into P. aeruginosa UCBPP-PA14 wild type as well as the single and double dsbB1 and dsbB2 mutant strains. Both P. aeruginosa DsbB proteins maintain oxidized DsbA1; hence, the single dsbB deletions are rescued by the remaining paralog and reactivate DsbA1 (13, 25). Indeed, high levels of β-Gal can be observed when we induce the expression of β-Galdbs in both the ΔdsbA1 and ΔdsbB1ΔdsbB2 mutants grown in M63 0.2% glucose medium supplemented with X-Gal (Fig. 3A). However, little to no activity is seen in the wild-type or single ΔdsbB1 or ΔdsbB2 mutants grown in X-Gal minimal media (Fig. 3A). When we quantified the β-Gal activity of the wild type and mutants carrying the biosensor inducible with Cuma (PL60), the Miller Units reflected the results seen in the X-Gal plates (Fig. 3B). Furthermore, when the ΔdsbB1ΔdsbB2 mutant was grown in different concentration of inducers, we observed a dose-dependent induction of β-Galdbs (Fig. 3C through F). The biosensors with the best inducible range were the Cuma- and aTc-inducible plasmids (Fig. 3C). The Van-inducible plasmid was the least induced (Fig. 3D). The Cuma- and aTc-inducible biosensors also displayed lower background activity in the absence of the inducer (depicted as 10−4, Fig. 3C through F) compared to what is observed in E. coli (Fig. 2C through F). Thus, the concentration of the inducer can be adjusted to the desired sensitivity of the assay when screening for inhibitors of the Dsb proteins (see below).
Fig 3.
Mobilizable β-Galdbs biosensors for gram-negative bacteria. (A) Phenotype of β-Galdbs biosensors in dsb mutants. Aliquots (10 µL) of overnight cultures were spotted onto M63 0.2% glucose supplemented with 120 µg/mL X-Gal and inducer (either 50 µM Cuma, 20 µM Van, 50 µM DAPG, or 50 nM aTc). Plates were incubated at 30°C for 2 d. (B) Low levels of β-Galdbs [limit of detection: 5 Miller Units (MU)] are detected in wild type, ΔdsbB1 and ΔdsbB2, where DsbA1 is still functional, while the ΔdsbA1 and double ΔdsbB1ΔdsbB2 mutants activate β-Gal due to lack of DsbA or its oxidation. P. aeruginosa UCBPP-PA14 wild type and dsb mutant strains carrying the biosensor plasmid PL60 were used to quantify β-Galdbs by ONPG hydrolysis in live cells that were grown for 18 h at 37°C in M63 0.2% glucose supplemented with 50µg/mL of essential amino acids (except Cys), antibiotics, and either 5 or 50 µM of Cuma to induce β-Galdbs. Data represent the average ± SD of at least two independent experiments. (C-F) The β-Gal activity is dose-dependent on the concentration of inducer in the double ΔdsbB1ΔdsbB2 mutant. β-Galdbs was measured as in (B) but with a serial dilution of inducers to induce β-Galdbs. Data represent the average ± SEM of at least two independent experiments, and non-linear regression was used to model the response. Plasmid maps were created with BioRender.com.
Inhibition of DsbB1 and DsbB2 using P. aeruginosa β-Galdbs sensor
As a proof of concept for a small molecule screen, we tested the ΔdsbB1 and ΔdsbB2 mutants against an inhibitor of the two proteins that we previously discovered, compound 12, a dichloro-pyridazinone (24). We used both agar (Fig. 4A) and liquid (Fig. 4B) assays to determine the inhibition of DsbB1 and DsbB2 proteins independently using the Cuma-inducible biosensor. The adaptation of a 384-well plate agar assay using X-Gal for the ΔdsbB1 mutant gave a dark blue color at high concentrations of compound 12 when β-Galdbs was induced at 5 µM Cuma (Fig. 4A, left). A higher concentration of β-Galdbs inducer, 25 µM Cuma, was needed for the ΔdsbB2 mutant to show observable activity, with even high concentrations of compound 12 only causing light blue pigmentation (Fig. 4A, right). We were also able to adapt a 96-well plate liquid assay from the E. coli assay by growing P. aeruginosa in M63 defined medium supplemented with 50 µg/mL of all essential amino acids except cysteine. As with the E. coli assay, the ONPG hydrolysis was measured without lysing P. aeruginosa cells. The quantification of β-Gal activity (Fig. 4B) reflected what was observed in the agar plates; the ΔdsbB1 mutant displays higher β-Gal activity at lower concentrations of compound 12 (EC50 = 0.19 µM) than the ΔdsbB2 mutant (EC50 = 0.74 µM). This is consistent with our previous findings using indirect assays for inhibition of DsbB proteins by measuring elastase activity in the supernatant of P. aeruginosa grown with the drug (25). Although compound 12 behaves as a strong inhibitor of the E. coli strains expressing P. aeruginosa DsbB1 (0.56 µM) or DsbB2 (0.28 µM), when using P. aeruginosa cells, the drug behaves as a stronger inhibitor of DsbB2 (ΔdsbB1 strain, IC50 = 0.01 µM) than DsbB1 (ΔdsbB2 strain, IC50 = 8.6 µM), and the drug does not reach full inhibition of elastase when the DsbB1 protein is present (Fig. S3) (25). This divergence between hosts was one of the motivations for the development of a target-based whole cell-based method using the native host, in this case, P. aeruginosa itself.
Fig 4.
β-Galdbs expression allows detection of DsbB inhibition in P. aeruginosa. (A) Inhibition of DsbB2 (ΔdsbB1, left) and DsbB1 (ΔdsbB2, right) with compound 12 can be observed by the generation of blue color when expressing β-Galdbs in the mutants. 384-well plates were prepared with 50 µL of M63 0.2% glucose supplemented with X-Gal and either 5 (ΔdsbB1) or 25 µM (ΔdsbB2) Cuma to induce β-Galdbs. A twofold serial dilution of 6-mM compound 12 was made in DMSO, and 1 µL of the diluted drug was pipetted into the agar surface. Bacteria (10 µL) were then added on top and incubated for 2 d at 30°C. Images represent the result of at least two independent experiments. (B) Quantification of β-Gal in ΔdsbB1 and ΔdsbB2 mutants grown in the presence of compound 12. β-Galdbs was measured by ONPG hydrolysis in live P. aeruginosa dsbB cells that were previously grown for 18 h at 37°C in M63 0.2% glucose supplemented with 50 µg/mL of essential amino acids (except Cys), 5 µM (ΔdsbB1) or 25 µM (ΔdsbB2) Cuma, and serially diluted compound 12. Data represent the average ± SD of three independent experiments, and non-linear regression was used to model the response.
DISCUSSION
The MalF-LacZ102 hybrid protein (β-Galdbs) has been an instrumental tool in studying disulfide bond formation in E. coli for over three decades. The use of LacZ allows for simple genetic selections and screens (3). Basal expression of the hybrid protein in M63 glucose minimal medium without maltose allowed the development of a heterologous platform to search for inhibitors of DsbB and VKOR proteins via high-throughput screening using E. coli (24, 25). However, the misfolding of β-Galdbs in the periplasm results in toxicity and cell death due to aberrant disulfide bonds formed by DsbA when the fusion was highly induced from Pmal-β-Galdbs in the presence of maltose and glycerol in the medium (5). Indeed, our previous attempts to use the β-Galdbs in other gram-negative organisms failed likely due to this toxicity problem. In this work, we showed that it is possible to express the β-Galdbs in a heterologous host, such as P. aeruginosa, when using tightly regulated promoters. The expression of β-Galdbs under the Cuma-inducible promoter was tolerated in P. aeruginosa cells, and no growth defect was observed at the maximum inducer concentration tested. Deletion of dsbA or both dsbB proteins in P. aeruginosa cells expressing the β-Galdbs allows the folding of periplasmic β-Gal and hence produces blue colonies in the presence of X-Gal, similar to what is observed for the single deletions of dsbA or dsbB in E. coli. We were also able to adapt our E. coli high- (384-well plate) and medium-throughput (96-well plate) methods expressing the β-Galdbs sensor in P. aeruginosa. The Cuma- and aTc-inducible promoters gave a good dynamic range to look for inhibitors of Dsb proteins in P. aeruginosa. The amount of inducer can be optimized to a desired level to increase the assay’s sensitivity. For instance, with more β-Galdbs expressed to a level where there is already a pale blue color (when DsbAB cannot misfold all β-Galdbs produced), one would detect weaker inhibitors, while less expression of the fusion would find stronger inhibitors (24).
Considering that disulfide bonds are required for the stability of virulence factors, toxins, antibiotic resistance, and cell envelope biogenesis proteins, lack of disulfide bond formation in many gram-negative pathogens results in virulence attenuation as well as antibiotic and phage susceptibility (6, 7, 21, 23, 46). However, the pathway is not essential for aerobic laboratory growth (17), thus facilitating the development of methods to search for molecules that identify molecules on-target in pathogenic bacteria, also known as target-based and whole cell-based approaches (47). The biosensor plasmids generated in this work could not only help to identify such Dsb inhibitors but could also help to study the variations of disulfide bond formation found in other bacteria (7, 14). Some gram-negative organisms encode two or more sets of DsbAB proteins that seem to play different roles but can substitute for each other in oxidizing particular substrates. Examples of organisms with multiple Dsb proteins include P. aeruginosa (13), Salmonella enterica serovar Typhimurium (48), Neisseria meningitidis (49, 50), and Campylobacter jejuni (51). In addition, some proteobacterial DsbA proteins such as Legionella pneumophila DsbA can perform both reduction and oxidation of disulfide bonds (52). The redundancy of Dsb proteins could perhaps provide a specialized activity for folding certain substrates that require priority under some environmental conditions. Using the single dsb mutants expressing the β-Galdbs, one could look for an array of growth conditions that inactivate the Dsb protein and render Lac+ cells. Similarly, one could also look for intragenic L. pneumophila dsbA mutations to either loose or gain a more oxidizing nature with the use of the β-Galdbs by looking for pale blue or white colonies, respectively. In addition, the β-Galdbs can be used to study bacterial interactions between organisms that share the same niche, such as the gut, to determine whether other bacteria could affect the oxidative protein folding of their neighbors through the secretion of quinones (53) or other redox molecules.
The use of translational LacZ fusions has advanced the study of membrane topology, protein targeting and secretion, as well as oxidative protein folding in E. coli since the 1970s (3). The use of the BHR plasmid-borne β-Galdbs disulfide bond biosensor we describe here should enable this analysis in a greater diversity of bacteria.
MATERIALS AND METHODS
Strains and growth conditions
The strains and plasmids used in this study are listed in Table 1. The primers used in this study are listed in Table 2. To construct PL23, 25, 26, and PL31, plasmid backbones without eYFP were amplified by PCR with PR41 and PR42 using Q5 Polymerase (New England Biolabs) and pAJM657, pAJM773, pAJM847, and pAJM011 as templates. The β-Galdbs insert was amplified with PR43 and PR44 using HK325 genomic DNA as a template. Insert and vectors were independently assembled using BsaI-HFv2 Golden Gate Assembly (NEBridge, New England Biolabs). Ligated products were transformed into HK320 electrocompetent cells and were plated on NZ Kanamycin, inducer (Cuma, Van, DAPG, or aTc), and X-Gal. One blue colony was used to purify the plasmid and sequence the insert using primers PR51 and PR52. To construct PL60-PL63, high-fidelity assembly (NEBuilder, New England Biolabs) was used using three PCR products. First, PR96 and PR97 were used to amplify the backbone with β-Galdbs without araC and arabinose promoter using pLEM2 vector. Second, the four regulators were amplified with PR98 and PR99, while the four promoters were amplified with PR100 and PR101 using pAJM657, pAJM773, pAJM847, and pAJM011 as templates. The three inserts were assembled independently using NEBuilder and were transformed into DH10β competent cells (New England Biolabs). Plasmids were sequenced with PR102 and PR46 to confirm the regulators and promoters. PL60 was then transformed into E. coli S17λpir electrocompetent cells and was used to conjugate the vector into P. aeruginosa strains. Nalidixic acid was used to counter-select the E. coli donor and gentamicin to select for the plasmids.
TABLE 1.
List of strains
| ID | Genotype | Reference |
|---|---|---|
| E. coli strains | ||
| HK320 | HK295 ΔdsbB | (54) |
| HK325 | HK295 ΔdsbB λPmal-malE ’Φ(malF-lacZ)102 | (54) |
| S17-1 λpir | F-, thi, pro, hsdR, [RP4-2 Tc::Mu Km::Tn7 (Tp Smr)],(Lambda-pir) | Kolter lab |
| P. aeruginosa strains | ||
| CL418 | P. aeruginosa UCBPP-PA14 | Lory lab |
| CL384 | P. aeruginosaΔdsbA1 | (25) |
| CL339 | P. aeruginosa ΔdsbB1 | (25) |
| CL355 | P. aeruginosa ΔdsbB2 | (25) |
| CL356 | P. aeruginosa ΔdsbB1ΔdsbB2 | (25) |
| LL81 | P. aeruginosa UCBPP-PA14, pJN105-Cuma-β-Galdbs | This study |
| LL264 | P. aeruginosa ΔdsbB1, pJN105-Cuma-β-Galdbs | This study |
| LL265 | P. aeruginosa ΔdsbB2, pJN105-Cuma-β-Galdbs | This study |
| LL266 | P. aeruginosa ΔdsbB1ΔdsbB2, pJN105-Cuma-β-Galdbs | This study |
| LL498 | P. aeruginosa ΔdsbA1, pJN105Cuma-β-Galdbs | This study |
| LL499 | P. aeruginosa UCBPP-PA14, pJN105Van-β-Galdbs | This study |
| LL500 | P. aeruginosa ΔdsbA1, pJN105Van-β-Galdbs | This study |
| LL501 | P. aeruginosa ΔdsbB1, pJN105Van-β-Galdbs | This study |
| LL502 | P. aeruginosa ΔdsbB2, pJN105Van-β-Galdbs | This study |
| LL503 | P. aeruginosa ΔdsbB1 ΔdsbB2, pJN105Van-β-Galdbs | This study |
| LL504 | P. aeruginosa UCBPP-PA14, pJN105Tet-β-Galdbs | This study |
| LL505 | P. aeruginosa ΔdsbA1, pJN105Tet-β-Galdbs | This study |
| LL506 | P. aeruginosa ΔdsbB1, pJN105Tet-β-Galdbs | This study |
| LL507 | P. aeruginosa ΔdsbB2, pJN105Tet-β-Galdbs | This study |
| LL508 | P. aeruginosa ΔdsbB1 ΔdsbB2, pJN105Tet-β-Galdbs | This study |
| LL509 | P. aeruginosa UCBPP-PA14, pJN105DAPG-β-Galdbs | This study |
| LL510 | P. aeruginosa ΔdsbA1, pJN105DAPG-β-Galdbs | This study |
| LL511 | P. aeruginosa ΔdsbB1, pJN105DAPG-β-Galdbs | This study |
| LL512 | P. aeruginosa ΔdsbB2, pJN105DAPG-β-Galdbs | This study |
| LL513 | P. aeruginosa ΔdsbB1 ΔdsbB2, pJN105DAPG-β-Galdbs | This study |
| Plasmids | ||
| pNG102 | Pmal-malE ’Φ(malF-lacZ)Hyb102, Ampr | (1) |
| pAJM657 | eYFP, CymR, Cuma promoter, Kmr, p15A ori | (29) |
| pAJM773 | eYFP, VanR, Kmr, p15A ori | (29) |
| pAJM847 | eYFP, PhlF, DAPG promoter, Kmr, p15A ori | (29) |
| pAJM011 | eYFP, TetR, Tet promoter, Kmr, p15A ori | (29) |
| pJN105 | AraC, ara promoter, Gmr, mob, pBBR ori | (44) |
| pLEM2 | pJN105-Pmal- malE ’Φ(malF-lacZ)102, Gmr | This study |
| PL23 | pAJM657-malF-lacZ102, Kmr | This study |
| PL25 | pAJM773-malF-lacZ102, Kmr | This study |
| PL26 | pAJM847-malF-lacZ102, Kmr | This study |
| PL31 | pAJM011-malF-lacZ102, Kmr | This study |
| PL60 | pJN105-Cuma-malF-lacZ102, Gmr | This study |
| PL61 | pJN105-Van-malF-lacZ102, Gmr | This study |
| PL62 | pJN105-Tet-malF-lacZ102, Gmr | This study |
| PL63 | pJN105-DAPG-malF-lacZ102, Gmr | This study |
TABLE 2.
Primer list
| ID | Sequence 5’ to 3’ |
|---|---|
| PR41.pAJMR_fwd | ggctacggtctcccaaattccagaaaagaggc |
| PR42.pAJMR_rev | ggctacggtctccttcccctctttctctagtattaaac |
| PR43.MalF_fwd | ggctacggtctccggaaatactagatggatgtcattaaaaagaaac |
| PR44.LacZ_rev2 | ggctacggtctcctttggtaccgagtcatttttgacaccagac |
| PR46. pAJMRFZ_rev | gggatcccccatcatcactttgttg |
| PR51. pAJMseq_fwd | tgagacacaaccaattattgaaggcc |
| PR52. pAJMseq_rev | ccgccattggaccaaaacgaaaa |
| PR96.pLEM2_fwd | atggatgtcattaaaaagaaacattggtg |
| PR97.pLEM2_rev | attgcgttgcgctcactg |
| PR98.Reg_fwd | ggcagtgagcgcaacgcaatgccggtgatgccggccac |
| PR99.Reg_rev | ttgtgtctcatttcgttttggtccaatggcggcg |
| PR100.Prom_fwd | caaaacgaaatgagacacaaccaattattg |
| PR101.Prom_rev | ttctttttaatgacatccatctagtatttcccctctttc |
| PR102.Gmprom_fwd | cgcgttggccgattcatt |
All E. coli strains were grown in NZ or M63 0.2% glucose and supplemented with 50 µg/mL of 19 essential amino acids (Ser, Val, Ile, Leu, Trp, Tyr, Met, Asp, Glu, Ala, Arg, Lys, Asn, Gln, Phe, Gly, Thr, His, and Pro) at 30–37°C when indicated. All P. aeruginosa strains were grown in lysogeny broth (LB) or M63 0.2% glucose supplemented with 50 µg/mL of 19 essential amino acids either broth or agar media at 30–37°C when indicated. The antibiotic concentrations used were nalidixic acid 10 µg/mL, kanamycin 40 µg/mL, gentamicin 3 µg/mL for E. coli and 10 µg/mL for P. aeruginosa.
Kanamycin was purchased from Sigma (USA). Nalidixic acid and gentamicin were purchased from GoldBio (USA). Inducers were purchased from Sigma (cuminic acid, vanillic acid, and anhydrotetracycline hydrochloride) and ChemCruz (2,4-diacetylphlorogucinol). Molecules were dissolved in dimethyl sulfoxide (DMSO) to make 100 mM (Cuma, Van, DAPG) and 1 mM (aTc) stocks, respectively. Compound 12 was purchased from Enamine (EN300-173996 purity 95%, Ukraine) and was dissolved in DMSO to 10 mg/mL (34.72 mM).
β-Galactosidase assays
β-Galactosidase assays were carried out by determining the velocity of hydrolysis of o-nitrophenyl-β-galactoside (ONPG, Sigma) in microtiter plates using a protocol previously described with slight modifications (24, 27, 55). Briefly, cultures were grown in M63 0.2% glucose medium with proper antibiotics at 37°C overnight. Cells were then inoculated to an OD600 of 0.01 into fresh M63 medium containing 0.2% glucose, 50 µg/mL of 19 essential amino acids (except cysteine), and proper antibiotics. Diluted bacteria (200 µL) were transferred to a 96-well plate (Corning), and a twofold serial dilution of the inducers was performed from columns 12 to 2. The plate was then sealed with a breathable film. The growth plate was incubated for 10 h at 30°C and fast-orbital shaking inside a Synergy H1 plate reader (BioTek). After growth, absorbance at 600 nm was read in a Synergy H1 plate reader (BioTek). Then, 100 µL of bacteria from the growth plate was transferred to the assay plate. Note that no cell lysis step is required because β-Galdbs is in the periplasm. The reaction was started by adding 100 µL of the ONPG buffer to the cells (a mixture of 8 mL of Z-buffer with 4 mL of 4 mg/mL ONPG dissolved in Z-buffer). The addition of β-mercaptoethanol was also omitted to avoid interference with the disulfide bonds formed in β-Galdbs. The absorbance at λ420 nm was measured every minute for 1–2 h to follow the kinetics of ONPG hydrolysis at 28°C in a Synergy H1 plate reader (BioTek). The velocity of the reaction was calculated by performing linear regression using GraphPad Prism Software. The slopes were then used together with OD600 and the following constants, 1.81 (CF1), 2.45 (CF2), and 3.05 (CF3), to calculate the Miller Units as reported before (55). P. aeruginosa β-Galactosidase assays were conducted in microtiter plates like the E. coli protocol with few modifications in the growth conditions. Cultures were grown in M63 0.2% glucose medium supplemented with 100 µL of NZ broth and proper antibiotics at 37°C overnight. Cells were then inoculated to an OD600 of 0.01 into fresh M63 medium containing 0.2% glucose, 50 µg/mL of 19 essential amino acids (except cysteine), proper antibiotics, and either a fixed concentration or a serial dilution of Cuma when indicated. Diluted bacteria (200 µL) were transferred to a 96-well plate (Corning). Compound 12 (100 µM) was added to column 12 and was twofold serially diluted to column 2. The plate was sealed with a breathable film and incubated for 18 h at 37°C and 700 rpm in an Incu-mixer MP (Benchmark). After growth, the same steps were performed like the E. coli assay indicated above. Non-linear regression using GraphPad Prism Software (Boston, USA) was used to model the data by using the equation [Agonist] vs response—variable slope (four parameters).
Agar assays
Drug testing was performed as previously described with slight modifications (24, 25). A liquid dispenser (BioTek) fitted with a small-bore tubing cartridge was used to dispense 50-µL aliquots of hot agar medium (M63 medium containing 0.2% glucose and 0.9% agar, supplemented with gentamicin [10 µg/mL], Cuma [5 or 25 µM], and X-Gal [120 µg/mL]) to 384-well tissue culture-treated plates (BD Falcon). In order to prevent agar solidification in the Wellmate tubing (at too-low temperatures) or inactivation of the antibiotics and X-Gal (at too-high temperatures), the medium was maintained in a 60°C oven. In addition, the Wellmate tubing was pre-warmed by washing with sterile hot water immediately prior to loading the agar medium. After the agar solidified, the plates were stored in a humidified sealed container at 4°C for no more than 2 d. Compound 12 was added by pipetting 1 µL of serial dilutions into the agar’s surface (final concentration of DMSO, 1.7%), and 10 µL of diluted P. aeruginosa cells (OD600 of 0.01) was dispensed with a liquid dispenser (BioTek). 384-well plates were sealed with a breathable film and then incubated in humidity boxes at 30°C for 2 days and then stored at 4°C for 2 days to determine the minimal concentration to produce a blue color. Photographs were taken using a white light-emitting diode (LED) transilluminator.
ACKNOWLEDGMENTS
To my dear friend and mentor, Jon Beckwith, for sharing your genius, your vision, your wisdom, and your generosity. We thank Laura McPartland for her help in constructing pLEM2. Drawings in Fig. 1, Fig. 2, and Fig. 3A were created using Biorender.com with publication licenses KF265H9JZ7 and BX265SG74U. We also thank Clay Fuqua for helpful suggestions and comments on this manuscript.
This work was supported by the Indiana University Bloomington and by the Cystic Fibrosis Foundation Pilot and Feasibility Award 004846I222 (to C.L.).
Contributor Information
Cristina Landeta, Email: clandeta@iu.edu.
Laurie E. Comstock, University of Chicago, Chicago, Illinois, USA
SUPPLEMENTAL MATERIAL
The following material is available online at https://doi.org/10.1128/jb.00433-23.
Figure S1 to S3.
ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.
REFERENCES
- 1. Froshauer S, Green GN, Boyd D, McGovern DBK, Beckwith J. 1988. Genetic analysis of the membrane insertion and topology of MaLF, a cytoplasmic membrane protein of Escherichia coli. J Mol Biol 200:501–511. doi: 10.1016/0022-2836(88)90539-6 [DOI] [PubMed] [Google Scholar]
- 2. Bardwell JCA, McGovern K, Beckwith J. 1991. Identification of a protein required for disulfide bond formation in vivo. Cell 67:581–589. doi: 10.1016/0092-8674(91)90532-4 [DOI] [PubMed] [Google Scholar]
- 3. Beckwith J. 2013. Fifty years fused to lac. Annu Rev Microbiol 67:1–19. doi: 10.1146/annurev-micro-092412-155732 [DOI] [PubMed] [Google Scholar]
- 4. Manoil C, Mekalanos JJ, Beckwith J. 1990. MINIREVIEW alkaline phosphatase fusions: sensors of subcellular location. J Bacteriol 172:515–518. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Dwyer RS, Malinverni JC, Boyd D, Beckwith J, Silhavy TJ. 2014. Folding LacZ in the periplasm of Escherichia coli. J Bacteriol 196:3343–3350. doi: 10.1128/JB.01843-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Heras B, Shouldice SR, Totsika M, Scanlon MJ, Schembri MA, Martin JL. 2009. DSB proteins and bacterial pathogenicity. Nat Rev Microbiol 7:215–225. doi: 10.1038/nrmicro2087 [DOI] [PubMed] [Google Scholar]
- 7. Landeta C, Boyd D, Beckwith J. 2018. Disulfide bond formation in prokaryotes. Nat Microbiol 3:270–280. doi: 10.1038/s41564-017-0106-2 [DOI] [PubMed] [Google Scholar]
- 8. Collet J-F, Cho S-H, Iorga BI, Goemans CV. 2020. How the assembly and protection of the bacterial cell envelope depend on cysteine residues. J Biol Chem 295:11984–11994. doi: 10.1074/jbc.REV120.011201 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Bardwell JC, Lee JO, Jander G, Martin N, Belin D, Beckwith J. 1993. A pathway for disulfide bond formation in vivo. Proc Natl Acad Sci U S A 90:1038–1042. doi: 10.1073/pnas.90.3.1038 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Missiakas D, Georgopoulos C, Raina S. 1993. Identification and characterization of the Escherichia coli gene dsbB, whose product is involved in the formation of disulfide bonds in vivo. Proc Natl Acad Sci U S A 90:7084–7088. doi: 10.1073/pnas.90.15.7084 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Bader M, Muse W, Ballou DP, Gassner C, Bardwell JCA. 1999. Oxidative protein folding is driven by the electron transport system. Cell 98:217–227. doi: 10.1016/s0092-8674(00)81016-8 [DOI] [PubMed] [Google Scholar]
- 12. Kadokura H, Beckwith J. 2002. Four cysteines of the membrane protein DsbB act in concert to oxidize its substrate DsbA. EMBO J 21:2354–2363. doi: 10.1093/emboj/21.10.2354 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Arts IS, Ball G, Leverrier P, Garvis S, Nicolaes V, Vertommen D, Ize B, Dufe VT, Messens J, Voulhoux R, Collet J-F. 2013. Dissecting the machinery that introduces disulfide bonds in Pseudomonas aeruginosa. mBio 4:e00912-13. doi: 10.1128/mBio.00912-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Dutton RJ, Boyd D, Berkmen M, Beckwith J. 2008. Bacterial species exhibit diversity in their mechanisms and capacity for protein disulfide bond formation. Proc Natl Acad Sci U S A 105:11933–11938. doi: 10.1073/pnas.0804621105 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Inaba K, Murakami S, Nakagawa A, Iida H, Kinjo M, Ito K, Suzuki M. 2009. Dynamic nature of disulphide bond formation catalysts revealed by crystal structures of DsbB. EMBO J 28:779–791. doi: 10.1038/emboj.2009.21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Li W, Schulman S, Dutton RJ, Boyd D, Beckwith J, Rapoport TA. 2010. Structure of a bacterial homologue of vitamin K epoxide reductase. Nature 463:507–512. doi: 10.1038/nature08720 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Meehan BM, Landeta C, Boyd D, Beckwith J. 2017. The disulfide bond formation pathway is essential for anaerobic growth of Escherichia coli. J Bacteriol 199:e00120-17. doi: 10.1128/JB.00120-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Dutton RJ, Wayman A, Wei J-R, Rubin EJ, Beckwith J, Boyd D. 2010. Inhibition of bacterial disulfide bond formation by the anticoagulant warfarin. Proc Natl Acad Sci U S A 107:297–301. doi: 10.1073/pnas.0912952107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Ke N, Landeta C, Wang X, Boyd D, Eser M, Beckwith J. 2018. Identification of the thioredoxin partner of VKOR in mycobacterial disulfide bond formation. J Bacteriol 200:e00137-18. doi: 10.1128/JB.00137-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Reardon-Robinson ME, Osipiuk J, Jooya N, Chang C, Joachimiak A, Das A, Ton-That H. 2015. A thiol-disulfide oxidoreductase of the gram-positive pathogen Corynebacterium diphtheriae is essential for viability, pilus assembly, toxin production and virulence. Mol Microbiol 98:1037–1050. doi: 10.1111/mmi.13172 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Furniss RCD, Kaderabkova N, Barker D, Bernal P, Maslova E, Antwi AAA, McNeil HE, Pugh HL, Dortet L, Blair JMA, Larrouy-Maumus G, McCarthy RR, Gonzalez D, Mavridou DAI. 2022. Breaking antimicrobial resistance by disrupting extracytoplasmic protein folding. Elife 11:1–37. doi: 10.7554/eLife.57974 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Depuydt M, Messens J, Collet J-F. 2011. How proteins form disulfide bonds. Antioxid Redox Signal 15:49–66. doi: 10.1089/ars.2010.3575 [DOI] [PubMed] [Google Scholar]
- 23. Kadeřábková N, Furniss RCD, Maslova E, Eisaiankhongi L, Bernal P, Filloux A, Landeta C, Gonzalez D, McCarthy RR, Mavridou DAI. 2023. Antibiotic potentiation and inhibition of cross-resistance in pathogens associated with cystic fibrosis. bioRxiv. doi: 10.1101/2023.08.02.551661 [DOI]
- 24. Landeta C, Blazyk JL, Hatahet F, Meehan BM, Eser M, Myrick A, Bronstain L, Minami S, Arnold H, Ke N, Rubin EJ, Furie BC, Furie B, Beckwith J, Dutton R, Boyd D. 2015. Compounds targeting disulfide bond forming enzyme DsbB of gram-negative bacteria. Nat Chem Biol 11:292–298. doi: 10.1038/nchembio.1752 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Landeta C, McPartland L, Tran NQ, Meehan BM, Zhang Y, Tanweer Z, Wakabayashi S, Rock J, Kim T, Balasubramanian D, Audette R, Toosky M, Pinkham J, Rubin EJ, Lory S, Pier G, Boyd D, Beckwith J. 2019. Inhibition of Pseudomonas aeruginosa and Mycobacterium tuberculosis disulfide bond forming enzymes. Mol Microbiol 111:918–937. doi: 10.1111/mmi.14185 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Landeta C, Meehan BM, McPartland L, Ingendahl L, Hatahet F, Tran NQ, Boyd D, Beckwith J. 2017. Inhibition of virulence-promoting disulfide bond formation enzyme DsbB is blocked by mutating residues in two distinct regions. J Biol Chem 292:6529–6541. doi: 10.1074/jbc.M116.770891 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Landeta C, Meehan BM, McPartland L, Ingendahl L, Hatahet F, Tran NQ, Boyd D, Beckwith J. 2017. Inhibition of virulence-promoting disulfide bond formation enzyme DsbB is blocked by mutating residues in two distinct regions. J Biol Chem 292:6529–6541. doi: 10.1074/jbc.M116.770891 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Tian H, Boyd D, Beckwith J. 2000. A mutant hunt for defects in membrane protein assembly yields mutations affecting the bacterial signal recognition particle and Sec machinery. Proc Natl Acad Sci U S A 97:4730–4735. doi: 10.1073/pnas.090087297 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Meyer AJ, Segall-Shapiro TH, Glassey E, Zhang J, Voigt CA. 2019. Escherichia coli “Marionette” strains with 12 highly optimized small-molecule sensors. Nat Chem Biol 15:196–204. doi: 10.1038/s41589-018-0168-3 [DOI] [PubMed] [Google Scholar]
- 30. Rice LB. 2010. Progress and challenges in implementing the research on ESKAPE pathogens. Infect Control Hosp Epidemiol 31 Suppl 1:S7–10. doi: 10.1086/655995 [DOI] [PubMed] [Google Scholar]
- 31. Murray CJL, Ikuta KS, Sharara F, Swetschinski L, Robles Aguilar G, Gray A, Han C, Bisignano C, Rao P, Wool E, et al. 2022. Global burden of bacterial antimicrobial resistance in 2019: a systematic analysis. Lancet 399:629–655. doi: 10.1016/S0140-6736(21)02724-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Page MGP, Heim J. 2009. Prospects for the next anti-pseudomonas drug. Curr Opin Pharmacol 9:558–565. doi: 10.1016/j.coph.2009.08.006 [DOI] [PubMed] [Google Scholar]
- 33. Maschmeyer G, Braveny I. 2000. Review of the incidence and prognosis of Pseudomonas aeruginosa infections in cancer patients in the 1990s. Eur J Clin Microbiol Infect Dis 19:915–925. doi: 10.1007/s100960000410 [DOI] [PubMed] [Google Scholar]
- 34. Fujitani S, Sun HY, Yu VL, Weingarten JA. 2011. Pneumonia due to Pseudomonas aeruginosa: part I: epidemiology, clinical diagnosis, and source. Chest 139:909–919. doi: 10.1378/chest.10-0166 [DOI] [PubMed] [Google Scholar]
- 35. Folkesson A, Jelsbak L, Yang L, Johansen HK, Ciofu O, Høiby N, Molin S. 2012. Adaptation of Pseudomonas aeruginosa to the cystic fibrosis airway: an evolutionary perspective. Nat Rev Microbiol 10:841–851. doi: 10.1038/nrmicro2907 [DOI] [PubMed] [Google Scholar]
- 36. Lyczak JB, Cannon CL, Pier GB. 2000. Establishment of Pseudomonas aeruginosa infection: lessons from a versatile opportunist. Microbes Infect 2:1051–1060. doi: 10.1016/s1286-4579(00)01259-4 [DOI] [PubMed] [Google Scholar]
- 37. Ha U-H, Wang Y, Jin S. 2003. DsbA of Pseudomonas aeruginosa is essential for multiple virulence factors. Infect Immun 71:1590–1595. doi: 10.1128/IAI.71.3.1590-1595.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Harvey H, Habash M, Aidoo F, Burrows LL. 2009. Single-residue changes in the C-terminal disulfide-bonded loop of the Pseudomonas aeruginosa type IV pilin influence pilus assembly and twitching motility. J Bacteriol 191:6513–6524. doi: 10.1128/JB.00943-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Madshus IH, Collier RJ. 1989. Effects of eliminating a disulfide bridge within domain II of Pseudomonas aeruginosa exotoxin A. Infect Immun 57:1873–1878. doi: 10.1128/iai.57.7.1873-1878.1989 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Braun P, Ockhuijsen C, Eppens E, Koster M, Bitter W, Tommassen J. 2001. Maturation of Pseudomonas aeruginosa elastase: formation of the disulfide bonds. J Biol Chem 276:26030–26035. doi: 10.1074/jbc.M007122200 [DOI] [PubMed] [Google Scholar]
- 41. Urban A, Leipelt M, Eggert T, Jaeger KE. 2001. DsbA and DsbC affect extracellular enzyme formation in Pseudomonas aeruginosa. J Bacteriol 183:587–596. doi: 10.1128/JB.183.2.587-596.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Kim SH, Park SY, Heo YJ, Cho YH. 2008. Drosophila melanogaster-based screening for multihost virulence factors of Pseudomonas aeruginosa PA14 and identification of a virulence-attenuating factor, HudA. Infect Immun 76:4152–4162. doi: 10.1128/IAI.01637-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Antoine R, Locht C. 1992. Isolation and molecular characterization of a novel broad‐host‐range plasmid from Bordetella bronchiseptica with sequence similarities to plasmids from gram‐positive organisms. Mol Microbiol 6:1785–1799. doi: 10.1111/j.1365-2958.1992.tb01351.x [DOI] [PubMed] [Google Scholar]
- 44. Newman JR, Fuqua C. 1999. Broad-host-range expression vectors that carry the L-arabinose-inducible Escherichia coli araBAD promoter and the araC regulator. Gene 227:197–203. doi: 10.1016/s0378-1119(98)00601-5 [DOI] [PubMed] [Google Scholar]
- 45. Szpirer CY, Faelen M, Couturier M. 2001. Mobilization function of the pBHR1 plasmid, a derivative of the broad-host-range plasmid PBBR1. J Bacteriol 183:2101–2110. doi: 10.1128/JB.183.6.2101-2110.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Bai J, Raustad N, Denoncourt J, van Opijnen T, Geisinger E. 2023. Genome-wide phage susceptibility analysis in Acinetobacter baumannii reveals capsule modulation strategies that determine phage infectivity. PLoS Pathog 19:e1010928. doi: 10.1371/journal.ppat.1010928 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Landeta C, Mejia-Santana A. 2022. Union is strength: target-based and whole-cell high- throughput screens in antibacterial discovery. J Bacteriol 204:e0047721. doi: 10.1128/JB.00477-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Heras B, Totsika M, Jarrott R, Shouldice SR, Guncar G, Achard MES, Wells TJ, Argente MP, McEwan AG, Schembri MA. 2010. Structural and functional characterization of three DsbA paralogues from Salmonella enterica Serovar typhimurium. J Biol Chem 285:18423–18432. doi: 10.1074/jbc.M110.101360 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Tinsley CR, Voulhoux R, Beretti JL, Tommassen J, Nassif X. 2004. Three homologues, including two membrane-bound proteins, of the disulfide oxidoreductase DsbA in Neisseria meningitidis: effects on bacterial growth and biogenesis of functional type IV pili. J Biol Chem 279:27078–27087. doi: 10.1074/jbc.M313404200 [DOI] [PubMed] [Google Scholar]
- 50. Sinha S, Langford PR, Kroll JS. 2004. Functional diversity of three different DsbA proteins from Neisseria meningitidis. Microbiology (Reading) 150:2993–3000. doi: 10.1099/mic.0.27216-0 [DOI] [PubMed] [Google Scholar]
- 51. Raczko AM, Bujnicki JM, Pawłowski M, Godlewska R, Lewandowska M, Jagusztyn-Krynicka EK. 2005. Characterization of new DsbB-like thiol-oxidoreductases of Campylobacter jejuni and Helicobacter pylori and classification of the DsbB family based on phylogenomic, structural and functional criteria. Microbiology (Reading) 151:219–231. doi: 10.1099/mic.0.27483-0 [DOI] [PubMed] [Google Scholar]
- 52. Kpadeh ZZ, Jameson-Lee M, Yeh AJ, Chertihin O, Shumilin IA, Dey R, Day SR, Hoffman PS. 2013. Disulfide bond oxidoreductase DsbaA2 of Legionella pneumophila exhibits protein disulfide isomerase activity. J Bacteriol 195:1825–1833. doi: 10.1128/JB.01949-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Fenn K, Strandwitz P, Stewart EJ, Dimise E, Rubin S, Gurubacharya S, Clardy J, Lewis K. 2017. Quinones are growth factors for the human gut microbiota. Microbiome 5:161. doi: 10.1186/s40168-017-0380-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Kadokura H, Bader M, Tian H, Bardwell JC, Beckwith J. 2000. Roles of a conserved arginine residue of DsbB in linking protein disulfide-bond-formation pathway to the respiratory chain of Escherichia coli. Proc Natl Acad Sci U S A 97:10884–10889. doi: 10.1073/pnas.97.20.10884 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Thibodeau SA, Fang R, Joung JK. 2004. High-throughput β-galactosidase assay for bacterial cell-based reporter systems. Biotechniques 36:410–415. doi: 10.2144/04363BM07 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Figure S1 to S3.




