Effect of exogenous bile salts supplementation on the performance and hepatic lipid metabolism of aged laying hens

Abstract

Bile acids (BA), a series of hydroxylated steroids secreted by the liver, are involved in the digestion and absorption of dietary fats. In the present study, the effect of exogenous BAs on the performance and liver lipid metabolism of laying hens was investigated. Three hundred and sixty 50-wk-old Hy-line Brown hens were randomly allocated into three groups and subjected to one of the following treatments: fed with the basal diet (control, Con), the basal diet supplemented with 0.1 g/kg (0.1 g/kg BAs), or 0.2 g/kg (0.2 g/kg BAs) porcine BAs. Laying performance, egg quality, and blood parameters were measured during the 8-wk experimental period. The expression of genes related to hepatic lipid metabolism was determined at the end of experiment. The results showed that BAs treatments had no influence (P > 0.05) on laying rate, egg weight, and feed efficiency. BAs treatment, however, significantly decreased mortality of hens (P = 0.006). BAs treatment showed a transient negative influence on eggshell quality at week 4 but not at week 8. The yolk color on week 8 was increased by BAs treatments (P < 0.0001) compared to control. The duodenum index showed a tendency to be increased (P = 0.053) and jejunum index were increased (P = 0.007) by BAs treatment. Compared to control, BAs treatments decreased lipid droplet content (P < 0.0001) and TG content (P = 0.002) of liver. Fatty acid synthase activity was also decreased as an effect of BAs dietary supplementation. Compared to the control group, 0.1 g/kg BAs treatment increased (P < 0.05) the mRNA expression of genes Farnesoid X receptor (FXR) (P = 0.042), cytochrome P450 family 7 subfamily A member 1 (CYP7A1) (P = 0.002), and cytochrome P450 family 8 subfamily B member 1 (CYP8B1) (P = 0.017), fatty acid synthase (FAS) (P = 0.020), acetyl-CoA carboxylase (ACC) (P = 0.032), sterol regulatory element binding protein-1c (SREBP-1c) (P = 0.037), proliferator-activated receptor gamma (PPARγ) (P = 0.002), apolipoprotein B (APO-B) (P = 0.020), and very low density lipoprotein receptor (VLDLR) (P = 0.024). In conclusion, the addition of exogenous BAs reduces lipid accumulation in liver. BA supplementation reduces the mortality of hens and improves egg yolk color, with no unfavorable effect on laying performance. The result suggests that suppressed FAS activity is involved in the reduced hepatic lipid accumulation by BAs treatment.

Bile acids suppress lipid accumulation in the liver of laying hens. Bile acids supplementation reduce the mortality of hens and improve egg yolk color.

Introduction

Fatty liver hemorrhagic syndrome (FLHS) is one of the most common metabolic disorders in laying hens and is characterized by disorders of lipid metabolism in the liver, manifested by fatty liver degeneration, and varying degrees of hemorrhage (Butler, 1976). FLHS often occurs in caged hens in good condition and with high egg production rates. The gradual decline in egg production during the later stages of laying, when energy intake exceeds the requirements for maintenance and egg production, leads to an accelerated rate of lipid deposition in the liver and a significant increase in lipid deposition, leading to the development of FLHS (Anene et al., 2023).

Bile acids (BA), a group of hydroxylated steroids synthesized from cholesterol in the liver, play an important role in lipid metabolism (Monte et al., 2016). BAs are synthesized in the liver, stored in the gallbladder, and flow into the intestine after eating (Chiang et al., 2018). BAs emulsify lipids in the intestinal tract, facilitating their digestion and absorption (Islam et al., 2011). In broilers, exogenous BAs can promote lipid absorption when a high-fat diet is offered (Lai et al., 2018; Ge et al., 2019). Supplementation with porcine BAs improves growth performance, nutrient digestibility and lipid metabolism, especially in broiler chickens fed diets with lard (Geng et al., 2022). Moreover, exogenous BAs addition can partially alleviate the unfavorable influence of heat stress on growth performance in broilers (Yin et al., 2021). The effect of BAs seems to be related to the dietary composition. The addition of BA in diets containing 3% wheat bran, barley bran, or soybean hulls had minor effect on growth performance of broilers (Hemati Matin et al., 2016).

Polin et al. (1980) showed that the addition of BAs to diets significantly increased the apparent digestibility of lipid in layer-type chicks. In laying hens, the supplemental effect of BAs seems contradictory. In aged hens (58-wk-old), dietary supplementation of porcine BAs from 60 to 3,000 mg/kg showed no influence on egg production, with the exception of 60 mg/kg BAs supplementation that resulted in an increase in egg mass (Yang et al., 2022a). In contrast, dietary supplementation of 60 mg/kg porcine BAs increased egg production and feed conversion and reduced abdominal fat percentage and body weight of laying hens around 45 wk of age (Yang et al., 2022b). The shaped gut microbiota and BA profile are associated with reduced fat deposition in the liver of 60-wk-old laying hens fed a diet with C. butyricum addition (Wang et al., 2020). Hence, the supplemental effect of exogenous BAs on the performance and lipid metabolism of laying hen needs further investigation.

Around 95% of BAs are reabsorbed at the end of the ileum and re-enter to liver via the portal vein to complete the hepatic-intestinal cycle (Russell, 2009). BAs not only promote lipid digestion and absorption by serving as an emulsifier but also act as signaling molecules involved in the metabolic processes of the body (Watanabe et al., 2006; Russell, 2009). BAs can activate nuclear farnesoid × receptor (FXR) and membrane Takeda G protein-coupled receptor 5 (TGR5) to alter lipid and energy metabolism (Chiang and Ferrell, 2020; Clifford et al., 2021). Hence, it is hypothesized that exogenous BAs supplementation could alter hepatic lipid metabolism and the development of fatty liver of laying hens in the late laying period.

The aim of this study is to evaluate the supplemental effect of exogenous BAs on the laying performance and hepatic lipid accumulation in aged laying hens fed with a ­corn–soybean basis diet. The egg production, mortality, egg quality, blood parameters, and the expression of genes related to lipid and bile acid metabolism in the liver were determined.

Materials and Methods

The experimental protocol used in this study was approved by the Animal Care Committee of Shandong Agricultural University.

Animals

Three hundred and sixty 50-wk-age Hy-line Brown hens were selected and randomly allocated into three groups subjected to one of the following treatments: fed a basal diet (Control, CON) or the basal diet supplemented with 0.1 and 0.2 g porcine BAs/ kg diet (Shandong Longchang Animal Health Products Co., LTD). In each treatment, there were eight replicates with five cages and each cage had five hens. The cage (60 cm length × 45 cm width × 50 cm height) was equipped with a nipple drinker and a feeder and each hen had 900 cm² floor area. The light regime was 16-h light and 8-h dark (16 L: 8 D). The basal diet was a typical corn–soybean layer diet formulated according to the recommendations of the National Research Council standard (NRC, 1994; Sun et al., 2020). The nutritional composition and nutrient content of the basal diet is presented in Table 1. The composition of the porcine BA was as follows: the total bile acid content, 97.1%; the hyocholic acid and hyodeoxycholic acid, 77.2%; the chenodeoxycholic acid, 19.9%. In the 8-wk experimental period, all the experimental hens had free access to feed and water.

Table 1.

Experimental diets and nutrient compositions

Ingredient	%
Corn	58.41
Wheat bran	5.91
Oil	1.00
Soybean meal, 46 %CP	22.68
Salt	0.35
Limestone	9.61
CaHPO4	1.44
Choline chloride	0.09
Lysine 99%	0.10
Methionine 99%	0.16
Vitamin premix1	0.05
Mineral premix2	0.20
Nutrient composition3
Crude protein	16.50
Metabolizable energy, Kcal/kg	2,700
Ca, %	3.50
Available P, %	0.53
Lysine	0.78
Methionine	0.40
Methionine + cystine	0.62
Threonine	0.51
Tryptophan	0.16

¹Vitamin premix provides the following per kg of diet: vitamin A, 6,000 IU; vitamin D3, 1,200 IU; vitamin E, 12 IU; vitamin K, 0.75 mg; vitamin B1, 1.95 mg; riboflavin, 3.3 mg; D-pantothenic acid, 16.5 mg; vitamin B5, 15 mg; vitamin B6, 4.5 mg; vitamin B12, 0.006 mg; biotin, 0.15 mg; folic acid, 0.375 mg.

²Mineral premix provides the following per kg of diet: Fe (as ferrous sulfate), 60 mg; Zn (as zinc sulfate), 80 mg; Mn (as manganese sulfate), 60 mg; Cu (as copper sulfate) 8 mg, I (as potassium iodide), 0.35 mg; and Se (as sodium selenite), 0.30 mg.

³The calculated values.

Egg production, egg weight, and the number of broken eggs were recorded daily, feed intake was recorded weekly, and feed efficiency was calculated. At week 4, one hen was randomly selected from each replicate and eight hens in total in each treatment. A blood sample was obtained from the brachial vein and collected with heparinized tube. Plasma samples were obtained after centrifugation at 3,000 × g at 4 °C for 15 min and stored at −20 °C for further analysis.

At the end of the experiment, one hen was randomly selected from each replicate and eight hens in total in each treatment. After a blood sample was obtained from the brachial vein with heparinized tube, the hens were euthanized by exsanguination after cervical dislocation (Close et al., 1997; Huang et al., 2015). Plasma was separated and stored at −20 °C for further analysis. The liver, abdominal fat pad, duodenum, jejunum, ileum, and cecum were excised and weighed. The liver samples were immediately snap frozen in liquid nitrogen and stored at −80 °C for further analysis of gene and protein expression.

Egg quality

At the last day of weeks 4 and 8, all the eggs laid were collected for the measurement of egg quality. The eggshell thickness was measured using an eggshell thickness gauge (EFG-0503, ROBOTMATION, Japan) in three areas of the egg: the middle part of the egg, the tip and the blunt end, and the average value was taken as the eggshell thickness. The egg shape index was calculated from the long/short diameter of the egg. Shell strength was measured using an eggshell strength tester (EFG-0503, ROBOTMATION, Japan). Yolk color, egg white height, and Haugh units were measured with a multifunctional egg tester (EFG-5200, ROBOTMATION, Japan). The percentages of yolk and shell were calculated as yolk weight and shell weight/egg weight, respectively, according to Hussein et al. (1992).

Plasma parameters analysis

The plasma concentrations of albumin (ALB), total bile acids (TBA), total protein (TP), triglycerides (TG), total cholesterol (TCHO), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were determined by commercial kits (Sichuan Mike Biotechnology Co., Ltd., China, Wang et al., 2018) with an automatic biochemical analyzer and according to manufacturer’s guidelines (7020 Clinical Analyser: Hitachi High-Tech Global, Japan).

Hepatic triglycerides and total cholesterol analysis

Hepatic TG and TCHO levels were measured using commercial kits and according to manufacturer’s guidelines (Zhejiang Dongou Diagnostic Products Co., Ltd., China).

FASN activity measurement

The activity of fatty acid synthase was measured according to the method of Hsu and Lardy (1969). Briefly, the liver tissue was homogenized in ice-cold buffer solution (0.25 mol/L sucrose (Tianjin Kaitong Chemical Reagent Co., Ltd., China), 1 mmol/L DTT (Beijing Sollerbauer Technology Co., Ltd., China), 1 mmol/L EDTA (Beijing Sollerbauer Technology Co., Ltd., China), pH = 7.4). The homogenate was then centrifuged at 100,000 × g for 1 h and the supernatant was aspirated to determine the enzyme activity in the tissue. A phosphoric acid buffer was prepared as the reaction solution containing NADPH (Beijing Sollerbauer Technology Co., Ltd., China) and acetyl-CoA (Sigma-Aldrich Shanghai Trading Co., Ltd., China). The reaction solution was preheating at 37 °C for 4 min and the supernatant enzyme solution and malonyl-CoA (Sigma-Aldrich Shanghai Trading Co., Ltd., China) was added. In the reaction system, fatty acid synthase catalyzes the production of long-chain fatty acids and NADP+. One unit of FAS activity was defined as 1 nmol of NADPH oxidized per minute per mg of liver protein.

Histology observation

HE staining

Liver tissues were excised and fixed in 4% paraformaldehyde for morphological analysis. The samples were then paraffin-embedded and sectioned into 5-μm sections on a coronal plane for staining with hematoxylin-eosin. Sections were dehydrated in alcohol, cleared with xylene and mounted on slides for visualization by light microscopy (400 £, Olympus, Tokyo, Japan).

Oil-Red O staining

Liver tissue was fixed in 4% paraformaldehyde, then dehydrated in a gradient of 15% and 30% sucrose solution and embedded with OCT reagent. Sections were cut into 4-μm sections on the coronal plane at −40 °C, routinely stained with Oil red O using a fully automated tissue stainer and sealed with glycerol gelatin. The histological sections were observed and digital images were obtained. Quantitative analysis of Oil Red O staining was performed using ImageJ software.

Total RNA extraction and real-time PCR analyses

The expression of FXR, small heterodimeric chaperone receptor 1 (SHP-1), liver receptor homologue 1 (LRH-1), cytochrome P450 family 7 subfamily A member 1 (CYP7A1), cytochrome P450 family 8 subfamily B member 1 (CYP8B1), fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), liver × receptor (LXR), sterol regulatory element binding protein-1c (SREBP-1c), peroxisome proliferator-activated receptor α (PPARα), proliferator-activated receptor gamma (PPARγ), lipoprteinlipase (LPL), l-carnitine palmityl transferase 1 (L-CPT1), very low density lipoprotein receptor (VLDLR), microsomal triglyceride transfer protein (MTP), fatty acid binding protein 4 (FABP4), apolipoprotein B (APO-B), apoVLDL-II, and vitellogenin (VTG) was determined by reverse transcription PCR (real-time RT-PCR). Total RNA was extracted from liver using TRIzol reagent (TransGen Biotech, China), followed by reverse transcription PCR and real-time quantitative PCR. The mRNA values were normalized to the expression of chicken GAPDH mRNA. mRNA relative expression levels were determined according to previous methods (Chen et al., 2018; Uerlings et al., 2018; Tang et al., 2019). Primer sequences for real-time PCR were designed using primer 5.0 software and synthesized by Sangon Bioteach (Shanghai, China), as shown in Table 2.

Table 2.

Gene-specific primer of related genes

Gene name	Genbank number	Primers position	Primers sequences (5ʹ→3ʹ)
GAPDH	NM_204305	Forward	CTACACACGGACACTTCAAG
		Reverse	ACAAACATGGGGGCATCAG
ACC	XM_046929960.1	Forward	AATGGCAGCTTTGGAGGTGT
		Reverse	TCTGTTTGGGTGGGAGGTG
Apo-B	NM_001044633.2	Forward	CACGCCTCACAGACCAAGTA
		Reverse	CCAGTCAAACGGCACATCTA
Apo-VLDL	NM_205483	Forward	AGGGCTGAACTGGTACCAACAAAC
		Reverse	GGATGACCAGCCAGTCACGA
CYP7A1	NM_001001753.2	Forward	GATCTTCCCAGCCCTTGTGG
		Reverse	AGCCTCTCCCAGCTTCTCAC
CYP8B1	NM_001397965.1	Forward	CCTCTGGAGAAGGGTTTTGTG
		Reverse	GCACCGTGAAGACATCCCC
FAS	NM_205155.4	Forward	CTATCGACACAGCCTGCTCCT
		Reverse	CAGAATGTTGACCCCTCCTACC
FABP4	NM_204290.2	Forward	TGAAGCAGGTGCAGAAGT
		Reverse	CAGTCCCACATGAAGACG
FXR	XM_046906255.1	Forward	AGTAGAAGCCATGTTCCTCCGTT
		Reverse	GCAGTGCATATTCCTCCTGTGTC
L-CPT1	XM_046922974.1	Forward	GGGACCTGAAACCAGAGAACG
		Reverse	ACAGAGGAGGGCATAGAGGATG
LPL	XM_046934870.1	Forward	CAGTGCAACTTCAACCATACCA
		Reverse	AACCAGCCAGTCCACAACAA
LRH	XM_046922343.1	Forward	GACTCAGGTGATCCAAGCTATGG
		Reverse	GAGAGGTTACAAAGGGGCTTCTG
LXR	XM_046917664.1	Forward	GTCCCTGACCCTAATAACCGC
		Reverse	GTCTCCAACAACATCACCTCTATG
MTP	NM_001109784.3	Forward	TTCACAGTACCCCTTCCTAGTCTGT
		Reverse	CCTTCCAACATTTCTGCTTTCC
PPARα	XM_046906400.1	Forward	AGACACCCTTTCACCAGCATCC
		Reverse	AACCCTTACAACCTTCACAAGCA
PPARγ	XM_046925952.1	Forward	CCAGCGACATCGACCAGTT
		Reverse	GGTGATTTGTCTGTCGTCTTTCC
SHP-1	NM_001030893.3	Forward	CACCTTCTGGAGCCTGGATTTGAG
		Reverse	ATGTCTGCGTTGCCGATGATGG
SREBP-1c	XM_046927256.1	Forward	GCCCTCTGTGCCTTTGTCTTC
		Reverse	ACTCAGCCATGATGCTTCTTCC
VLDLR	AB009283	Forward	AGCCTTCCTGCTTTGTCTG
		Reverse	ATCGTTGTGTATCCGCCTG
VTG	NM_001031276	Forward	CAACATATCTTCCGCTTGTAACATTG
		Reverse	TTCACAACAAAGATTTCTCCAGTAGC

Western blot analysis

Hepatic samples (0.1 g) were placed in 1 mL of RIPA buffer (Beyotime, China) and homogenized in an ice bath. The samples were then centrifuged at 4 °C at 12,000 × g for 10 min. Protein concentrations were measured by the BCA ­Protein Assay Kit (Beyotime, China). Protein samples were separated with 10% sodium dodecyl sulfate—PAGE (Bio-Rad, Richmond, 246 CA) and then transferred to polyvinylidene fluoride membranes (Millipore, Boston, MA) at 200 MA and 4 °C for 2 h. After blocking with western blocking buffer (Beyotime, China) for 1 h at room temperature, the membranes were blocked with anti-p-AMPK, anti-AMPK, anti-p-ACC, anti-ACC, anti-PPARγ, and anti-β-actin (Beyotime, Jiangsu, China) overnight at 4 °C. The membranes were then washed in 1 lb TBST buffer and probed with a 1:1,000 dilution of secondary antibody (HRP-conjugated anti-rabbit or anti-mouse IgG, Beyotime) for 4 h at 4 °C. Bands were then observed using Biospectrum 810 (UVP LLC, Jena, Germany) using Hyperfilm ECL reagent (Beyotime, Jiangsu, China).

Statistical analysis

Data are presented as mean ± SEM. The main effect of BAs treatment was estimated with a one-way ANOVA model by using SAS software (Version 8e, SAS Institute, Cary, NC). P < 0.05 was considered statistically significant.

Results

The result showed that BAs supplementation had no significant influence (P > 0.05) on laying rate, feed intake, egg weight, hen-day egg production, feed efficiency, and egg broken rate (Table 3). The mortality, however, was decreased (P = 0.006) by BAs treatment, compared to control (Table 3). Compared with control, dietary addition of BAs reduced eggshell thickness (P = 0.008), eggshell strength (P = 0.003), and percentage of eggshell (P = 0.016) at week 4, which; however, these differences were not detected at week 8 (P > 0.05, Table 4). BAs treatment improved yolk color at week 8 (P < 0.0001). In contrast, BAs supplementation had no significant (P > 0.05) influence on egg shape index, albumen height, Haugh unit, and percentage of yolk and eggshell (Table 4).

Table 3.

Effects of dietary bile acid supplementation on laying performance of hens

Items	Control	0.1 g/kg BAs	0.2 g/kg BAs	P-value
Laying rate, %	81.9 ± 1.0	82.0 ± 1.2	84.3 ± 2.6	0.616
Egg weight, g	64.41 ± 0.29	64.21 ± 0.34	64.46 ± 0.35	0.847
Feed intake, g/hen per d	135.3 ± 2.40	133.3 ± 0.70	134.3 ± 1.20	0.669
Hen-day egg production, g/d	52.74 ± 0.77	52.65 ± 1.18	54.32 ± 1.63	0.572
Feed efficiency, g/g	2.57 ± 0.04	2.55 ± 0.06	2.50 ± 0.09	0.707
Egg broken rate, %	1.45 ± 0.53	1.09 ± 0.21	0.54 ± 0.14	0.195
Mortality, %	4.00 ± 0.01a	1.00 ± 0.01b	0 ± 0b	0.006

^a,bMeans with different superscripts differ significantly (P < 0.05).

Data were presented as mean ± SE (n = 8).

Table 4.

Effects of dietary bile acid supplementation on week 4 egg quality of laying hens

Items	Control	0.1 g/kg BAs	0.2 g/kg BAs	P-value
Week 4
Egg weight, g	64.2 ± 0.6	64.5 ± 0.5	64.3 ± 0.4	0.866
Eggshell thickness, mm	0.334 ± 0.003a	0.318 ± 0.004b	0.319 ± 0.004b	0.008
Egg shape index	1.28 ± 0.0	1.29 ± 0.0	1.28 ± 0.1	0.562
Eggshell strength, kg. f	4.59 ± 0.05a	4.29 ± 0.06b	4.36 ± 0.06b	0.003
Albumen height, mm	5.31 ± 0.23	5.29 ± 0.13	5.44 ± 0.16	0.825
Yolk color	8.03 ± 0.39	8.02 ± 0.34	7.96 ± 0.14	0.985
Haugh units	68.9 ± 2.0	68.2 ± 1.0	69.7 ± 1.4	0.786
Percentage of yolk, %	28.3 ± 0.2	27.8 ± 0.3	28.6 ± 0.3	0.103
Percentage of eggshell, %	10.9 ± 0.2a	10.5 ± 0.1b	10.5 ± 0.1b	0.016
Week 8
Egg weight, g	64.7 ± 0.4	64.8 ± 0.4	64.9 ± 0.5	0.967
Eggshell thickness, mm	0.339 ± 0.004	0.337 ± 0.003	0.337 ± 0.003	0.451
Egg shape index	1.28 ± 0.0	1.29 ± 0.01	1.28 ± 0.01	0.451
Eggshell strength, kg. f	4.16 ± 0.12	3.93 ± 0.09	4.07 ± 0.08	0.289
Albumen height, mm	5.99 ± 0.06	5.97 ± 0.10	6.01 ± 0.11	0.964
Yolk color	6.72 ± 0.16b	7.90 ± 0.10a	8.01 ± 0.07a	<0.0001
Haugh units	74.8 ± 0.5	74.3 ± 0.7	74.2 ± 0.9	0.805
Percentage of yolk, %	27.9 ± 0.2	27.7 ± 0.3	27.8 ± 0.2	0.847
Percentage of eggshell, %	10.4 ± 0.0	10.4 ± 0.1	10.6 ± 0.1	0.076
Percentage of eggshell, %	10.9 ± 0.2a	10.5 ± 0.7b	10.5 ± 0.1b	0.016

^a,bMeans with different superscripts differ significantly (P < 0.05).

Data were presented as mean ± SE (n = 8).

Bile acids treatments had no significant influence (P > 0.05) on liver, abdominal fat pad, ileum, and cecum weight (Table 5). In contrast, duodenum weight (P = 0.072) and index (P = 0.053) and jejunum weight (P = 0.071) showed a tendency to be increased by 0.2 g/kg BAs treatment, compared with control. Compared with control, jejunum index was significantly increased by 0.1 and 0.2 g/kg BAs treatment (P = 0.007). The 0.2 g/kg BAs treatment had higher ileum weight (P < 0.05) compared to 0.1 g/kg BAs, whereas the organ index was not significantly changed (P > 0.05). H&E staining showed that the hens of control and BAs hens all had normal structure and no pathological change was detected in hepatic cords and sinusoidal structure (Figure 1A). The morphological observation of the liver showed that the BAs-hens had a reddish-brown color whereas the control hens presented a light-yellow color (Figure 1B). Histological observation showed that there were less lipid droplets in BAs treatments (P < 0.001), compared with control group (Figure 1C, D). The hepatic TG level was significantly decreased (P = 0.002), whereas TCHO level was not affected (P > 0.05) by BAs treatments (Figure 1E, F). The activity of FAS was significantly reduced by BAs treatments (P < 0.05, Figure 1G), compared to the control group.

Table 5.

Effect of dietary bile acid supplementation on the organ index of laying hens

Parameters	Control	0.1 g/kg BAs	0.2 g/kg BAs	P-value
Body weight, g	2.26 ± 0.11	2.04 ± 0.04	2.18 ± 0.06	0.114
Liver, g	42.83 ± 5.18	33.87 ± 1.91	34.04 ± 1.42	0.140
%	1.97 ± 0.25	1.66 ± 0.09	1.70 ± 0.10	0.386
Abdominal fat pad, g	139.9 ± 20.9	112.8 ± 11.0	141.0 ± 14.0	0.379
%	5.97 ± 0.73	5.49 ± 0.47	6.39 ± 0.51	0.557
Duodenum, g	8.25 ± 0.70b	9.57 ± 0.48a,b	10.29 ± 0.57a	0.072
%	0.37 ± 0.04b	0.47 ± 0.02a	0.48 ± 0.03a	0.053
Jejunum, g	15.00 ± 1.05b	16.00 ± 0.68a,b	17.88 ± 0.79a	0.071
%	0.64 ± 0.04b	0.79 ± 0.04a	0.82 ± 0.04a	0.007
Ileum, g	9.78 ± 0.49a,b	8.64 ± 0.29b	10.25 ± 0.45a	0.035
%	0.44 ± 0.03	0.42 ± 0.02	0.47 ± 0.01	0.240
Cecum, g	5.93 ± 0.37	5.74 ± 0.25	5.93 ± 0.33	0.892
%	0.27 ± 0.02	0.28 ± 0.01	0.27 ± 0.02	0.821

^a,bMeans with different superscripts differ significantly (P < 0.05).

Data were presented as mean ± SD (n = 8).

Figure 1.

Effect of dietary bile acid supplementation (0.1 and 0.2 g/kg diet) on the morphology and microstructure and triglyceride and total cholesterol concentration of the liver. (A) Morphology of liver, (B) HE staining of liver tissue sections, (C) Oil Red O staining of liver tissue, (D) lipid droplet content, (E) triglyceride level, (F) total cholesterol level, and (G) fatty acid synthase activity. Data were presented as the means ± SEM (n = 8). *P < 0.05, **P < 0.01, ***P < 0.001, compared with the control.

The plasma levels of TG, TCHO, HDL-C, LDL-C, TP, ALB, and TBA were not affected (P > 0.05) by BAs treatments (Table 6).

Table 6.

Effects of dietary bile acid supplementation on plasma concentrations of metabolites of hens

Items	Control	0.1 g/kg BAs	0.2 g/kg BAs	P-value
TBA, μmol/L	16.43 ± 2.62	16.92 ± 3.51	24.09 ± 3.99	0.232
ALB, g/L	17.01 ± 0.36	16.54 ± 0.38	17.35 ± 0.45	0.367
TP, μmol/L	53.78 ± 1.06	52.32 ± 0.92	54.85 ± 1.14	0.245
TG, mmol/L	12.46 ± 1.43	13.65 ± 1.28	14.46 ± 0.62	0.490
TCHO, mmol/L	2.67 ± 0.21	2.68 ± 0.19	2.88 ± 0.13	0.642
HDL-C, mmol/L	0.53 ± 0.03	0.52 ± 0.04	0.54 ± 0.02	0.938
LDL-C, mmol/L	0.64 ± 0.06	0.61 ± 0.03	0.66 ± 0.03	0.627

Data were presented as mean ± SD (n = 8). The concentrations of albumin (ALB), total bile acids (TBA), total protein (TP), triglycerides (TG), total cholesterol (TCHO), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C).

Compared with control, the mRNA level of genes related to bile acid metabolism FXR (P = 0.042), CYP7A1 (P = 0.002), and CYP8B1 (P = 0.017) were significantly increased by 0.1 g/kg BAs treatment, while SHP-1 and LRH-1 were not affected (P > 0.05, Figure 2A). In 0.2 g/kg BAs treatment, however, only the mRNA level of CYP7A1 was increased (P = 0.002), whereas the other measured genes were not influenced (P > 0.05). For the genes related to lipid synthesis and oxidation, 0.1 g/kg BAs increased the expression levels of FAS (P = 0.020), ACC (P = 0.032), SREBP-1c (P = 0.037), LPL (P = 0.033), and PPARγ (P = 0.002), whereas the expressions of LXR, PPARα, and L-CPT1 were not altered, compared to control (Figure 2B, C). In contrast, all the gene expressions in 0.2 g/kg BAs treatment had no difference with control. The expression of genes related to lipid transportation VLDLR (P = 0.024) and apoB (P = 0.020) was increased by 0.1 g/kg but not 0.2 g/kg BAs treatment (P > 0.05, Figure 2D). BAs treatments had no significant influence (P > 0.05) on the protein expression levels of AMPK, ACC, and PPARγ (Figure 2E, F, G, H).

Figure 2.

Effect of dietary bile acid supplementation (0.1 and 0.2 g/kg diet) on mRNA and protein expression of genes related to bile acid and lipid metabolism in the liver of laying hens. (A) The mRNA level of genes related to bile acid synthesis, (B) the mRNA level of genes related to lipid synthesis, (C) the mRNA level of genes related to lipid oxidation, (D) the mRNA level of genes related to lipid transportation, (E) the protein expression of gene related to lipid metabolism, (F) AMPK protein expression levels, (G) ACC protein expression levels, and (H) PPARγ protein expression levels. Data were presented as the means ± SEM (n = 8). *P < 0.05, **P < 0.01, ***P < 0.001, compared with the control.

Discussion

In this study, the supplemental effect of exogenous BAs on laying performance and hepatic lipid metabolism was evaluated in aged hens. Overall, the present results show that diet addition of 0.1 and 0.2 g/kg BAs reduce hepatic triglyceride accumulation and the mortality rate of aged hen. The result suggests that exogenous BAs supplementation is beneficial for the production of aged hens.

Fatty liver is a metabolic disorder in lipid metabolism characterized by excessive lipid accumulation in the liver of hens. BAs are the main products of cholesterol metabolism and play a crucial role in lipid absorption and metabolism. BAs emulsify lipid in the intestinal tract, facilitating the digestion and absorption of lipid in broilers, BAs addition can promote lipid absorption when fed a high-fat diet (Lai et al., 2018; Ge et al., 2019). In the present study, the laying performance was not significantly influenced by exogenous BAs at the dose of 0.1 and 0.2 g/kg diet. Recently studies indicated that in aged hens (58-wk-old), dietary supplementation of porcine BAs from 60 to 3,000 mg/kg for 8 wk showed no influence on egg production, with the exception of 60 mg/kg BAs supplementation that resulted in an increase in egg mass (Yang et al., 2022a), whereas a further work of this lab reported a positive effect of 60 mg/kg porcine BAs on egg production and feed conversion of laying hens (45 wk of age) in the 24 wk experimental period (Yang et al., 2022b). Hence, the result suggests that the supplemental effect of BAs seems to be related to the dose of BAs addition, age of hens, and supplemental duration. Recently, it is reported that the hens with low feed efficiency had higher abdominal and liver fat deposition and higher incidences of FLHS lesion score compared to high-feed efficiency hens (Anene et al., 2023). Hence, the incidence and extent of fatty liver of the laying flock may also contribute to the supplemental effect of BAs. In this study, however, addition of BAs to the diet significantly reduced the mortality rate compared to the control group. It is a pity that a pathological certification of the cause of death was not conducted and the hypothesis that the reduced mortality was a result of reduced FLS needs further investigation. Moreover, the laying performance of experimental hens was not maintained at the highest level and the supplemental effect of BAs on the performance of hens in peak-laying period needs to be studied further.

Fatty acid synthase is a key enzyme of the de novo biosynthesis of long-chain fatty acids (Wakil et al., 1983). The present result showed that BAs treatment significantly suppressed the activity of FAS, indicating that decreased hepatic lipid synthesis. This result was in accordance with the significantly reduced hepatic TG concentrations in BAs-hens, as well as the observation that the liver of BAs-hens had a reddish-brown color whereas the liver of control hens showed a light-yellow color. In laying hens, the increased lipid accumulation contributes to the development of fibrosis, and inflammation of the liver (Hamid et al., 2019). Hence, the result implies that exogenous BAs supplementation is beneficial for the health of aged hens.

Farnesoid × receptor is a nuclear receptor that is highly expressed in the liver, intestine, and kidney, for which bile acids are its endogenous ligands. In chicken as well as in mammals, FXR is highly expressed in the liver and ileum (Dai et al., 2020; Yin et al., 2021). BAs are natural ligands for FXR and the activation of FXR in the liver induces SHP expression and downregulates the expression of SREBP-1c and FAS, thereby inhibiting triglyceride synthesis, which inhibits the synthesis of triglycerides (Watanabe et al., 2004). FXR activates insulin receptor substrate (INS)/AKT signaling and inhibit mTORC1/pS6K-signaling to promote nuclear translocation of sterol regulatory element binding protein 1c (SREBP-1c) and lipogenesis (Chiang and Ferrell, 2020). Hence, the hepatic mRNA expression of genes related to lipid synthesis, transportation, and oxidation was further determined. The expression of genes related to lipogenesis FAS, ACC, and SREBP-1c was increased in 0.1 g/kg BAs but not in 0.2 g/kg BAs. In contrast, 0.1% and 0.5% chenodeoxycholic acid (CDCA) decreased the mRNA levels of key hepatic lipogenic genes (FAS, ACCα, ME, ATPcl, and SCD-1) and their related transcription factors SREBP-1/2 and PPARα in broilers (Piekarski et al., 2016). Hence, the result may imply that the effect of BA on hepatic lipogenesis is mainly observed in post transcriptional regulation. In the study, the upregulated expression of PPARγ, VLDLR, and ApoB in 0.1 g/kg BAs treatment, suggesting that the genes related to oxidation and transportation are coordinately increased. The protein level of PPARγ, however, was not significantly changed by BAs treatment, suggesting that regulating pathways related to lipid synthesis, oxidation, and transportation needs to be investigated in future.

It is well known that bile acids are synthesized in the liver, stored in gallbladder, and secreted into intestinal tract after feeding. BAs are reabsorbed at the end of ileum and transported to liver via the portal blood circulation (Li and Dawson, 2019). The reabsorbed BAs could regulate the bile acid pathway by changing the expression of genes CYP7A1 and CYP8B1 via LXR/ and FXR/SHP pathway (Russel, 2009). FXR regulates genes involved in many metabolic pathways, in addition to the well-established role of FXR in regulating bile acid homeostasis (de Aguiar Vallim et al., 2013). Bile acids activate FXR and in turn induce the negative nuclear receptor small heterodimer partner (SHP-1) to coordinately inhibit the transcription of CYP7A1 and other genes involved in bile acid biosynthesis in the liver (Goodwin et al., 2000). The increased transcriptional level of FXR, CYP7A1, and CYP8B1 in 0.1 g/kg BAs treatment indicated the activated FXR pathway. In 0.2 g/kg BAs treatment, however, the expression of genes was not obviously affected, except for CYP7A1. Hence, the result suggests that exogenous porcine BAs supplementation has no significant influence on endogenous BA synthesis. This speculation was supported by the observation that blood total BA concentration was not significantly affected by BAs treatment. However, this conclusion should be explained with caution, as there is another pathway to regulate the synthesis of bile acid. The enterocytes could secret FGF15/19, an FXR-responsive hormone, to bind with a heterodimeric receptor FGFR4/β-Klotho in hepatocytes and regulate the synthesis of bile acids (Russel, 2009, J. Lipid Res. 50: S120-S125). The influence of exogenous BAs on endogenous bile secretion needs to be studied further. The necessary discussion has been supplemented.

Cholesterol is the precursor of bile acids on the one hand, and conversion of cholesterol to bile acids is critical for maintaining cholesterol homeostasis on the other hand. The present result indicated that plasma total cholesterol, HDL-C, LDL-C, and hepatic cholesterol level were all not influenced by dietary BAs supplementation. This result was in line with previous work by Edwards et al. (1962), who reported that cholic acid supplementation had no effect on serum cholesterol. The result suggests that porcine BAs supplementation at the dose of 0.1 and 0.2 g/kg diet has no significant influence on cholesterol homeostasis.

Egg yolk color is an important feature for consumer’s purchase decision. It is well known that carotenoids play a critical role for the pigmentation of egg yolk and in birds that consumed carotenoid deficient diets pale hues of their egg yolk or skin are observed (Nabi et al., 2020). In this study, the addition of porcine BAs increased egg yolk color, suggesting that exogenous BAs may facilitate the absorption of carotenoids, which is consistent with the findings of El-Gorab (1973). At week 4, it is noted that the Haugh unit and albumin height were relatively low compared week 8. At week 4, all the eggs were collected and stored at room temperature overnight and assessed in the next day, whereas, at week 8, the egg quality was determined immediately after collection. The relative low values of Haugh unit and albumin height maybe a result of egg storage condition (Jones et al., 2018). Hence, the measuring time and storage condition should be made caution in the measurement of egg quality in future.

Bile acid can improve dietary calcium absorption. BAs facilitates calcium absorption indirectly by enhancing the absorption of vitamin D3 and directly by increasing the intestinal absorption of soluble calcium independent of the action of vitamin D (Webling and Holds worth, 1965). Similarly, ursodeoxycholic acid (UDCA) is proved to be a beneficial bile acid for intestinal Ca²⁺ absorption in chick (Rodríguez et al., 2013). In the present study, the eggshell thickness and eggshell strength were decreased in BAs treatments at week 4 and recovered to similar levels at week 8, compared with control hens. The result suggests that long-term supplementation of BAs has no unfavorable influence on eggshell quality. The mechanism of BAs influencing eggshell quality needs to be investigated further.

In conclusion, the addition of exogenous BAs reduces lipid accumulation in liver. BAs supplementation reduces the mortality of hens and improves egg yolk color, with no unfavorable effect on laying performance. The result suggests that suppressed FAS activity is involved in the reduced hepatic lipid accumulation by BAs treatment. The adequate dietary supplementary level of BAs in laying hens needs to be investigated further.

Glossary

Abbreviations:

ACC

acetyl-CoA carboxylase

ALB

albumin

APO-B

apolipoprotein B

BA

bile acids

CYP7A1

cytochrome P450 family 7 subfamily A member 1

CYP8B1

cytochrome P450 family 8 subfamily B member 1

FABP4

fatty acid binding protein 4

FAS

fatty acid synthase

FLHS

fatty liver haemorrhagic syndrome

FXR

Farnesoid × receptor

HDL-C

high-density lipoprotein cholesterol

L-CPT1

L-carnitine palmityl transferase 1

LDL-C

low-density lipoprotein cholesterol

LPL

lipoprteinlipase

LRH-1

liver receptor homologue 1

LXR

liver × receptor

MTP

microsomal triglyceride transfer protein

PPARα

peroxisome proliferator-activated receptor α

PPARγ

proliferator-activated receptor gamma

SHP-1

small heterodimeric chaperone receptor 1

SREBP-1c

sterol regulatory element binding protein-1c

TBA

total bile acids

TCHO

total cholesterol

TG

triglycerides

TGR5

Takeda G protein-coupled receptor 5

TP

total protein

UDCA

ursodeoxycholic acid

VLDLR

very low density lipoprotein receptor

VTG

vitellogenin

Conflict of Interest Statement

The authors declare that they have no conflicts of interest. We greatly thank the reviewers for their valuable comments and suggestions on the paper.