Skip to main content
PMC home page
Cancer Immunology, Immunotherapy : CII logoLink to Cancer Immunology, Immunotherapy : CII
. 2008 Mar 7;57(11):1625–1634. doi: 10.1007/s00262-008-0496-3

Immunotherapy of neuroblastoma by an Interleukin-21-secreting cell vaccine involves survivin as antigen

Michela Croce 1, Raffaella Meazza 2, Anna M Orengo 1, Marina Fabbi 1, Martina Borghi 1, Domenico Ribatti 4, Beatrice Nico 4, Barbara Carlini 3, Vito Pistoia 3, Maria Valeria Corrias 3, Silvano Ferrini 1,✉
PMCID: PMC11030971  PMID: 18324400

Abstract

Aim

IL-21 is the most recently identified member of the IL-2 cytokine family. Here we studied the therapeutic efficacy of IL-21-gene-modified cells (Neuro2a/IL-21) in a syngeneic metastatic neuroblastoma (NB) model.

Materials and methods

Neuro2a/IL-21 cells were tested as subcutaneous (sc) vaccine both in prophylactic and therapeutic settings. Depletion studies, cytotoxicity assay and immunohistochemical analyses were carried out to evaluate the mechanisms involved in tumor rejection.

Results

When injected sc in syngeneic A/J mice viable Neuro2a/IL-21 cells were rejected and induced resistance to a subsequent iv challenge with Neuro2a parental cells (Neuro2a/pc), suggesting the involvement of an immune response. More importantly, in mice bearing Neuro2a/pc micrometastases, a single sc injection of Neuro2a/IL-21 cells significantly increased the mean tumor-free survival of treated animals (43 vs. 22 days) and cured 14% of them. The administration of two or three doses of Neuro2a/IL-21 cell vaccine further increased the mean survival time to 54 and 75 days, and the cure rate to 27 and 33%, respectively, whereas the use of unmodified Neuro2a or mock-transfected cells had no effect. In vivo cell subset depletion and a Winn-assay indicated the involvement of CD8 + CTLs. Immunohistochemical analysis indicated a reduction of CD31+ and VEGFR2+ microvessels in late metastases from therapeutically vaccinated mice. A role of survivin as antigen was suggested by in vitro assays using survivin-synthetic CTL-epitopes.

Conclusions

Our present data indicate that IL-21-secreting NB cells are effective as therapeutic vaccine in mice bearing metastatic NB, through a specific CTL response involving survivin as antigen, and suggest a potential interest for IL-21 in NB immuno-gene therapy.

Electronic supplementary material

The online version of this article (doi:10.1007/s00262-008-0496-3) contains supplementary material, which is available to authorized users.

Keywords: Survivin, Cancer vaccine, Interleukin-21, Neuroblastoma

Introduction

Neuroblastoma (NB) is the most frequent solid extra-cranial tumor and the first cause of death in young children. It originates from the sympathetic nervous system and its clinical presentation ranges from spontaneous maturation followed by regression to very aggressive metastatic disease (stage 4) [21]. Since, in stage 4 NB conventional therapy, which is based on surgery, chemo- and radiotherapy, still results in poor survival rates [10], the search of new therapeutical approaches is warranted.

Tumor cells genetically modified to express immune stimulating cytokines have been considered an attractive tool to generate cellular vaccines for cancer immunotherapy [36].

The iv injection of Neuro2a parental cells (Neuro2a/pc) into syngeneic A/J mice induced a disseminated NB with a tissue distribution of micro- and macro-metastases similar to that observed in human stage 4 disease. Using this model, we previously showed that the sequential vaccination of NB-bearing mice with IL-12-engineered Neuro2a (for priming), followed by IL-15-engineered Neuro2a cells (for boosting), induced significant anti-tumor effects [9]. Nonetheless, the administration of either IL-12- or IL-15-enginereed cells alone showed only limited therapeutic activity. Thus, in the search of novel candidate adjuvant cytokines for NB cellular vaccines we have investigated here the potential role of IL-21.

IL-21 is a cytokine closely related to IL-2 and IL-15 and promotes the functional activities of T, B and NK cells through the interaction with a heterodimeric receptor composed of the specific IL-21R subunit and the common IL-2R-gamma chain subunit [12, 28]. IL-21 induces IL-15-activated NK cell terminal differentiation [16] and co-stimulates mature T and B cell proliferation [28]. IL-21 also promotes proliferation, cytotoxic function and IFN-γ production by murine and human CD8+ effector T cells [16, 33] and plays an important role in the regulation of B cell responses [26].

IL-21 has been involved in the development of autoimmunity in NOD mice [17] and we found that IL-21, differently from IL-2, is unable to support the proliferation of anti-CD3-activated regulatory T (Treg) cells [7]. Since Treg cells are involved in suppression of anti-tumor immunity [3], IL-21 may be more suitable than IL-2 to induce anti-tumor immunity. Indeed, experimental data in different mouse tumor models indicated that IL-21 gene transfer [7, 20, 32, 34] or recombinant-IL-21 [4, 23] can trigger anti-tumor effects, related to the induction of NK and/or CTL responses. In addition, recent studies showed that gene delivery of IL-21 potentiated the effect of antigen-specific vaccines in a NB [18] and in a colon cancer model [13].

In this study, we show that IL-21 gene-transduced NB cells are immunogenic in syngeneic mice and have therapeutic effect when administered as vaccine to mice bearing disseminated NB. This effect was significantly reduced in CD8+ cell-depleted mice, suggesting a predominant role of CTL responses. In addition, our data indicate that, in this model, an antigenic target of the CTLs is survivin, a pan-tumor antigen that has been involved in T cell responses in several malignancies, including human NB [8, 22].

Materials and methods

Cell line, transfection procedure and analysis of transfectants

Neuro2a/pc (CCL131, ATCC, Rockville, MD, USA), were grown in DMEM medium as described [9]. Cells were transfected with 6 μg of pmuIL-21IRES1neo [11] or with the empty vector, using FuGENE© (Roche Biochemicals, Milano, Italy). Stable transfectants were selected in culture medium containing 650 μg/ml G418 (Roche) and cloned by limiting dilution. IL-21 secretion by selected clones was assessed by ELISA (R&D Systems, Minneapolis, IL, USA). The clone used in the in vivo experiments secreted 50 ng/ml of IL-21.

Animal model and depletion procedure

A/J mice were purchased from Charles River (Brescia, Italy). Homozigous non-obese-diabetic (NOD)-SCID mice were originally obtained from the Jackson Laboratory (Bar Harbour, MA, USA) and were bred in-house. The animals were housed in pathogen-free colony, and experiments, performed according to the National Regulation on Animal Research Resources, were approved by the Review Board of the Istituto Nazionale per la Ricerca sul Cancro. To assess tumorigenicity, 5-week-old female A/J or NOD-SCID mice (6 mice/group) were injected sc with 106 per mouse Neuro2a/pc, Neuro2a/neo or Neuro2a/IL-21. Before injection, cells were washed three times in endotoxin-free PBS. Cells were mycoplasma-free and >90% viable. Wider and smaller diameters of sc tumors were measured using a caliper twice a week. The multiple of the wider and smaller diameter of each tumor was used as an estimate of the growth area, and data were displayed as mean ± SD for each group at a given time point. Statistical analysis was performed by the Mann–Whitney test; P < 0.05 values were considered as significant. Groups of 7–14 mice were injected iv in the tail vein with 1 × 106 Neuro2a/pc in a volume of 100 μl of serum-free medium. Mice were vaccinated by sc injections of 1 × 106 Neuro2a/IL-21 cells. Mice were monitored for disease symptoms every other day (starting from two-weeks after tumor challenge) and were killed by CO2 asphyxiation when they showed weight loss (≥15%), presence of tumour masses, or any other sign of disease. Autopsy was performed on all terminated mice and organs subjected to histopathological analysis.

Depletion studies were performed by intraperitoneal injection of 100 μl of a 1:10 dilution of rabbit anti asialo-GM1 antiserum (Wako Chemicals GmH, Düsseldorf, Germany). Anti-CD8 (24.3) rat mAb (ATCC, Rockville, MD) was used as reported [7]. Azide-free IgG2b Negative Control antibody, clone LO-DNP-11 (GeneTex Inc, San Antonio, TX, USA) and non-specific rabbit IgG were used as control of anti-CD8 and anti-NK depletion, respectively.

For Winn-assay, CD8+ cells were isolated from splenocytes from either therapeutically treated, or from naïve mice using an immunomagnetic cell sorting kit (Miltenyi Biotech, Germany). Purified CD8+ cells (>90% of purity) were admixed with Neuro2a/pc (5 × 105 cells/mouse) at a 10:1 cell ratio and with 104 IU rIL-2 and injected sc in NOD-SCID mice (6/group). Mice also received three daily doses of 104 IU rIL-2 by the i.p. route. An additional control group was injected sc only with Neuro2a/pc.

Statistical analyses

Survival curves were constructed by using the Kaplan–Meier method and the generalized Wilcoxon log-rank test (Peto) was used to compare the curves. A P value of less than 0.05 was considered statistically significant. Mean survival times were calculated with 95% confidence interval. All tests were two sided. Statistical analyses were performed using the Statsdirect software (Statsdirects Ltd, Cheshire, UK).

RT-PCR analysis for IL-21, tyrosine hydroxilase (TH), gp70env and survivin

Total RNA was extracted from bone marrow cells flushed from mouse femurs or from Neuro2a/pc and Neuro2a/IL-21 cells using the RNeasy kit (Qiagen, Cologne, Germany). One μg of total RNA was then reverse-transcribed and 5 μl of cDNA was separately amplified, in a final volume of 50 μl, with 2.5 IU Taq gold polymerase (Applied Biosystem, Foster City, CA, USA), using primers specific for the housekeeping gene β-actin, IL-21 [11], tyrosine hydroxylase (TH) [7], survivin (upper: 5′- TGGGCGGAGGTTGTGGTGACG, lower: 5′-GGATGCGTGGCTTAGATGTGG), and gp70env (upper: 5′-ACCTTGTCCGAAGTGACCG, lower: 5′-GTACCAATCCTGTGTGGTCG). The amplification products were then analyzed on 2% agarose gel stained with ethidium bromide.

Histological analysis

Neuro2a/pc metastatic tumors obtained from Neuro2a/neo or Neuro2a/IL-21 vaccinated mice were fixed in 4% paraformaldehyde for 3 h at room temperature, washed twice in PBS, dehydrated in 30% sucrose for 12 h at 4°C, embedded in Tissue-tec optimum cutting temperature compound, snap-frozen, and stored at −80° C until use. Sections were stained, after antigen retrieval, with primary antibodies against CD31 (goat anti-mouse, clone SC-1506, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and the vascular endothelial growth factor receptor 2 (mouse anti-human VEGFR-2, clone 89115, R&D Systems, Abington UK), according to manufacturer’s instructions. Immunodetection was performed with APAAP (Dako, Denmark) and Fast Red as chromogen, followed by hematoxylin counterstaining, as previously described [30].

FACS analysis

Induction of antibody responses was evaluated using a 1:200 dilution in PBS/2%BSA of serum from naïve, untreated and vaccinated mice. FITC-conjugated goat anti-mouse-IgG, -IgG2a, IgG2b or -IgM (Jackson Labs, West Grove, PA, USA) was used as second-step reagents. Samples were analyzed by a FACScan analyzer (Becton Dickinson, Milan, Italy).

Analysis of CTL activity, IFN-γ production and antibody responses

Spleen cells from naïve and vaccinated mice were stimulated in vitro for 5 days with 10 μg/ml of the following peptides (Tib MolBiol, Berlin, Germany): SPSYVYHQF (gp70env-derived AH1 peptide) [14], CPTENEPDL (SURV-1) and GWEPDDNPI (SURV-2) (survivin derived peptides) and YVLEETSVM (YM9 irrelevant peptide, kindly provided by Dr. F. Manca, Gaslini Institute, Genoa, Italy). Cultures were supplemented with 25 IU/ml rIL-2. Cytotoxicity was evaluated by a standard 51Cr-release assay.

IFN-γ enzyme-linked immunospot (ELISPOT) was performed on splenocytes from either naïve or vaccinated mice re-stimulated in vitro for 5 days with different peptides, as previously described [4]. Splenocytes were seeded at 3 × 105 cells per well in triplicate in the presence or absence of survivin-, AH1- or irrelevant peptide (10 μg/ml) on Multiscreen-IP plates (Millipore, Bedford, MA) coated overnight with 10 μg/mL of anti-IFN-γ (Endogen, Woburn, MA, USA). Plates were stained with AEC staining kit (Sigma, St. Louis, MO, USA) and spots were counted using a stereomicroscope. Blocking experiments were performed by using an anti-H2Kk-specific mAb (Abcam, Cambridge, UK) or irrelevant mAb at a final concentration of 5 μg/ml.

Results

Immunogenicity of Neuro2a/IL-21 cells in syngeneic mice

Neuro2a/pc cells transfected with the pmIL-21IRES-1neo plasmid (Neuro2a/IL-21) expressed IL-21 mRNA (Fig. 1a) and secreted IL-21 at a concentration of approximately 50 ng/ml/48 h/106 cells. Neuro2a/IL-21, as well as Neuro2a transfected with the empty plasmid (Neuro2a/neo), displayed in vitro growth kinetics similar to Neuro2a/pc (Fig. 1b). However, Neuro2a/IL-21 cells were not tumorigenic when injected sc into syngeneic mice (0/10 take rate), whereas mice injected sc with Neuro2a/pc or Neuro2a/neo showed 60% (8/14 mice) tumor take, similar to our previous report [4]. When injected sc in immunodeficient NOD-SCID mice (Fig. 1c) the tumor take of Neuro2a/pc, Neuro2a/neo and Neuro2a/IL-21 was 100% (6/6 mice), suggesting that the defective growth of Neuro2a/IL-21 in syngeneic mice is an immune-mediated phenomenon.

Fig. 1 .

Fig. 1 

Open in a new tab

a RT-PCR analysis of IL-21 mRNA expression in Neuro2a/pc cells and Neuro2a/IL-21 stable transfectant. C- is negative control without cDNA. b In vitro growth of Neuro2a/pc, Neuro2a/neo and Neuro2a/IL-21 cells. Viable cells were counted in a hemocytometer at different time-points (Neuro2a/IL-21 P = n.s. vs. Neuro2a/pc or /neo cells). c In vivo tumorigenicity of Neuro2a/pc, Neuro2a/neo and Neuro2a/IL-21 cells (each at 1 × 106 per mouse) injected sc in groups of 6 NOD-SCID mice; 100% of mice developed tumors (Neuro2a/IL-21 P = n.s. vs. Neuro2a/pc or /neo cells). d Syngeneic mice that had rejected viable Neuro2a/IL-21 cells show resistance to a subsequent challenge with Neuro2a/pc. 1 × 106 Neuro2a/pc were injected iv in naïve mice or in mice that were injected sc with Neuro2a/IL-21 cells or with irradiated Neuro2a/neo cells 30 days prior to challenge. The difference in tumor-free survival of Neuro2a/IL-21-treated mice is statistically significant (*P = 0.004 vs. Neuro2a/neo or Neuro2a/pc). The fractions indicate the proportion of tumor-free mice versus total mice of each experimental group. e RT-PCR analysis for TH and β-actin mRNA expression in bone marrow cells from three mice receiving only Neuro2a/pc challenge (lanes 1–3) and from the two vaccinated mice resistant to Neuro2a/pc challenge shown in panel d (lanes 4 and 5). C- is the control without cDNA

Mice that had rejected viable Neuro2a/IL-21 cells were then challenged iv with a fully tumorigenic dose of Neuro2a/pc cells in a prophylactic experimental setting. While 100% of naïve control mice developed metastatic disease within 27 days from iv challenge, Neuro2a/IL-21-primed mice had a significantly prolonged tumor-free mean survival time (Fig. 1d) (mean 44 vs. 21 days; P = 0.004). More importantly, 28% of them remained disease-free at long term, as assessed by histopathological analysis and RT-PCR for TH gene expression (Fig. 1e), regarded as a suitable marker for the detection of NB minimal residual disease [19]. Consistent data were obtained in a second experiment (2/6 protected mice = 33%). These data indicate that Neuro2a/IL-21 cells are immunogenic and are effective as vaccine in a prophylactic setting.

Immunotherapy of micrometastatic NB by Neuro2a/IL-21 vaccination

We then assessed the activity of a single dose of 106 Neuro2a/IL-21 cells in a therapeutic setting by sc injection in mice bearing disseminated NB, induced by Neuro2a/pc iv challenge 3 days prior to vaccination. As shown in Fig. 2a a single Neuro2a/IL-21 vaccine produced a significant increase in mean survival time (43 vs. 22 days; P = 0.001), and 14% of mice were disease free at 100 days. In agreement with our previous report [9], a single vaccination with IL-15-gene-modified Neuro2a cells (Neuro2a/IL-15) had virtually no effect (Fig. 2a), suggesting a stronger effect of IL-21 in this setting. In further experiments, the administration of two or three doses of Neuro2a/IL-21 vaccine further improved the therapeutic efficacy (Fig. 2b), leading to a mean survival time of 56 and 75 days, respectively (P = 0.005 and P = 0.0012 vs. untreated mice). Likewise, the proportion of cured mice, as assessed by histopathological analysis and RT-PCR for TH expression (data not shown), was increased up to 28 and 33% by the two- and three-dose vaccine schedules, respectively. Differently, the use of three doses of irradiated Neuro2a/pc or Neuro2a/neo in the same therapeutic setting produced no significant effects on tumor-free interval of NB-bearing mice (Fig. 2b). To evaluate whether the repeated vaccination induced long-lasting protective responses, in another experiment, 13 mice that had been cured by the Neuro2a/IL-21 vaccine were re-challenged on day 90 with Neuro2a/pc. As shown in Fig. 2c, 54% of them survived demonstrating that in most of the mice, Neuro2a/IL-21 cell vaccine immunotherapy induced a long-lasting immunity.

Fig. 2.

Fig. 2

Open in a new tab

a Effect of one sc injection of Neuro2a/IL-21, Neuro2a/neo or Neuro2a/IL-15 cellular vaccines administered 3 days after challenge with Neuro2a/pc (Kaplan–Meier analysis). The difference in tumor-free survival of Neuro2a/IL-21-treated mice with respect to untreated or to Neuro2a/neo-treated NB-bearing mice is statistically significant (*P = 0.001). Neuro2a/IL-15 or Neuro2a/neo showed no effect (P = n.s.). The fractions indicate the proportion of tumor-free mice versus total mice of each experimental group. b Immunotherapy of NB-bearing mice with two (at day +3 and +13 from Neuro2a/pc injection) or three (at day +3, +7, +14) sc injections of Neuro2a/IL-21 cellular vaccine. The survival was significantly increased (*P = 0.005 and **P = 0.0012 for the two- or three-dose schedule, respectively) in comparison to unvaccinated NB-bearing mice). Vaccination of a group of seven mice with three doses of irradiated Neuro2a/neo had no effect on survival (P = n.s. vs. untreated mice). c Mice cured by three doses of Neuro2a/IL-21 cellular vaccine show resistance to Neuro2a/pc re-challenge (**P = 0.001 vs. naïve mice)

Immunohistochemical analyses of metastatic tumors arising in Neuro2a/neo or Neuro2a/IL-21-vaccinated mice

In a previous study [11] we showed that the local secretion of IL-21 by genetically modified breast cancer cells induced CD8- and IFN-γ-dependent anti-angiogenic effects. In order to evaluate whether similar mechanisms could be involved in the protective effect of Neuro2a/IL-21 vaccination, we studied the angiogenetic process in late ovarian and renal metastasis from Neuro2a/IL-21-vaccinated mice, in comparison to metastases from Neuro2a/neo-treated control mice. As shown in Fig. 3, treatment with Neuro2a/IL21 led to a statistically significant decrease of CD31+ and VEGFR-2+ blood vessels (10 ± 2 CD31-positive cells vs. 35 ± 4, P < 0.001; 12 ± 3 VEGFR-2-positive cells vs. 24 ± 4, P < 0.001). Similar results were obtained in renal metastases (Electronic supplementary material Fig. 1), suggesting that anti-angiogenic effects may take part in the NB tumor growth inhibition mediated by Neuro2a/IL-21 vaccination.

Fig. 3.

Fig. 3

Open in a new tab

Immunohistochemical analysis of CD31 and VEGFR-2 expression in late Neuro2a/pc ovarian metastases developed in mice vaccinated with Neuro2a/neo (left panels) or Neuro2a/IL-21 cells (right panels). Original magnification: ×250

Role of CD8+ cells in NB immunotherapy by the Neuro2a/IL-21 cellular vaccine

IL-21 has been involved in the stimulation of T, NK and B cell proliferation and/or differentiation. To gain information on the mechanisms underlying the Neuro2a/IL-21 therapeutic effects, anti-CD8 and anti-NK cell depleting mAbs were administered to groups of A/J mice challenged iv with Neuro2a/pc cells and subsequently treated sc with three doses of Neuro2a/IL-21 vaccine. As shown in Fig. 4a, in CD8-depleted animals the Neuro2a/IL-21 vaccine showed a reduced efficacy, suggesting that CTLs were involved in tumor rejection (P = 0.026). Conversely, NK cell depletion did not significantly alter the outcome of Neuro2a/IL-21 vaccinated mice. In addition, an isotype-matched irrelevant antibody or non-specific rabbit IgG had no effect on immunotherapy (Fig. 4a). Consistent results were obtained in a second immunotherapy experiment, showing 100% of tumor development in anti-CD8-depleted mice (6/6) versus control-Ig (2/6). The lack of a possible B cell role was suggested by the low antibody (mostly IgM) titers reacting to Neuro2a/pc in sera from cured mice (ESM Fig. 2).

Fig. 4 .

Fig. 4 

Open in a new tab

a Effect of anti-CD8, anti-NK and isotype-matched antibodies on the survival of NB-bearing mice that received three doses of the Neuro2a/IL-21 cellular vaccine. Only treatment with the anti-CD8 depleting mAb significantly reduced the efficacy of immunotherapy (*P = 0.026 vs. mice receiving isotype matched unrelated mAb). The fractions indicate the proportion of tumor-free mice versus total mice of each experimental group. The schedule of Abs and vaccine administration is shown. b Winn-assay: three groups of NOD/SCID mice (6/group) were injected sc with Neuro2a/pc alone or mixed with purified CD8+ cells from either immune (therapeutically-treated mice surviving >100 days after iv NB cell challenge) or from naïve mice, as described in Materials and methods. Mice receiving immune CD8+ cells showed no tumor take (0%) (P < 0.02 vs. controls receiving no CD8+ cells or receiving naïve CD8+ cells)

The role of CTLs was further addressed by an in vivo Winn-assay. To this end, purified CD8+ T cells from either immunized mice, which had been therapeutically cured by vaccination or from naïve mice were co-injected sc with viable Neuro2a/pc at a 10:1 ratio into NOD-SCID mice. As shown in Fig. 4b, none of the mice (0/6) receiving tumor cells together with immune CD8+ cells developed tumors, whereas all the mice (6/6) receiving tumor cells alone or together with CD8+ cells from naïve mice developed tumors (P < 0.01).

Analysis of the possible antigen(s) recognized by CTLs

Since in vivo CD8-depletion and Winn assay experiments indicated an involvement of CTLs in the immunotherapeutic effect of the Neuro2a/IL-21 vaccine, we first analyzed the expression of known CTL-defined tumor antigens by Neuro2a/pc. As shown in Fig. 5a, Neuro2a/pc express the ecotropic retroviral mRNA encoding for the gp70env antigen, which is an immunodominant CTL-defined antigen in several murine tumors [14]. In addition, Neuro2a/pc display mRNA for the pan-tumor antigen survivin (Fig. 5a), which has been identified as a relevant target for several human tumors, including NB [8, 22]. Thus, splenocytes from mice cured by Neuro2a/IL-21 vaccine were stimulated in vitro with different synthetic peptides, corresponding to CTL epitopes of survivin and gp70 antigens. In particular, we used the gp70-derived AH1 synthetic epitope (Ld-restricted) [11] and two novel potentially antigenic Kk- or Ld-restricted epitopes of mouse survivin, identified by in silico analyses using algorythms defining Kk- or Ld-restricted peptide-binding motifs [27] combined with proteosomal degradation analysis [25].

Fig. 5 .

Fig. 5 

Open in a new tab

a RT-PCR analysis for gp70env, survivin and β-actin mRNA expression in Neuro2a/pc cells. MW molecular weight marker. C negative control without cDNA. b Cytotoxic activity against Neuro2a/pc target cells of splenocytes from prophylactically treated mice surviving >80 days from iv challenge. Splenocytes were re-stimulated in vitro by (i) a mixture of two potential CTL-epitopes derived from the survivin protein sequence, (ii) the AH-1 epitope of the gp70env retroviral antigen, (iii) an irrelevant peptide. Percentage of lysis of 51Cr-labeled Neuro2a/pc was evaluated after 4 h and SD did not exceed 5%. *P < 0.05 Survivin versus irrelevant peptide. c Cytotoxic activity of naïve mice splenocytes, re-stimulated in the same conditions as in b. d Cytolytic activity of splenocytes from therapeutically treated (three-dose schedule of Neuro2a/IL-21 vaccine) mice, which survived >100 days after iv challenge. *P < 0.05 Survivin versus irrelevant peptide. e ELISPOT analysis for IFN-γ production by therapeutically treated mice splenocytes in response to the indicated antigenic peptides. *P < 0.05 Survivin versus irrelevant peptide. f IFN-γ production by SURV-2-peptide stimulated splenocytes from therapeutically treated mice was inhibited (*P < 0.05 versus irrelevant Ab or no Ab) by the simultaneous presence of an anti-H2Kk-specific mAb (5 μg/ml)

In a first set of experiments the peptides were used to re-stimulate splenocytes from naïve mice or from mice which survived to Neuro2a/pc challenge after Neuro2a/IL-21 vaccine in the prophylactic setting. As shown in Fig. 5b, splenocyte re-stimulation using a mixture of the two survivin-derived peptides induced a consistent cytolytic activity against Neuro2a/pc, while the gp70env-derived Ld-restricted peptide induced a lower activity, albeit slightly higher than that of an irrelevant peptide. Splenocytes from naïve mice failed to develop significant cytolytic activity regardless of the peptide used for in vitro stimulation (Fig. 5c). Consistent data were obtained in two additional experiments.

In a second set of experiments, splenocytes from mice cured in the therapeutic setting with three doses of Neuro2a/IL-21 vaccine were collected 100 days after NB injection and re-stimulated in vitro with the aforementioned peptides. Again, a high cytolytic activity against Neuro2a/pc was observed upon splenocyte stimulation with survivin-derived peptides (Fig. 5d). However, splenocytes from these mice showed a high background cytolytic activity in the absence of peptide re-stimulation (not shown), or following re-stimulation with the irrelevant peptide (Fig. 5d), possibly in relationship to a stronger in vivo activation. Immune splenocytes stimulated in vitro with a mixture of the two survivin peptides, were analyzed for IFN-γ production by ELISPOT using for re-stimulation each survivin peptide alone or an irrelevant peptide. The GWEPDDNPI (SURV-2) survivin epitope allowed a strong IFN-γ response, while the CPTENEPDL (SURV-1) peptide induced a response similar to that of the irrelevant peptide (Fig. 5e). In a second set of experiments the SURV-2 peptide confirmed its ability to induce an IFN-γ response by immune-splenocytes, which was inhibited (on average by 42%) by the presence of an anti-H2Kk-specific antibody (a representative experiment out of two, showing consistent results, is shown in Fig. 5f).

Altogether, these data support the involvement of survivin as a target CTL-defined antigen in Neuro2a/IL-21 vaccinated mice and identify a murine survivin Kk-restricted epitope, similar to a previuosly reported Kd-restricted one [31].

Discussion

In this study, we show that murine Neuro2a cells genetically modified to express IL-21 are immunogenic, since they were rejected by syngeneic mice and conferred resistance to parental cell challenge. More importantly, Neuro2a/IL-21 cells were effective as therapeutic vaccine in mice bearing disseminated NB, reaching a three-fold increase in mean survival time as compared to untreated mice and a 33% of long-term mice cure rate with a three-dose schedule. It is of note that these mice had really cleared NB cells, because they did not show macro/micro-metastases and their bone marrows were negative for TH mRNA expression by RT-PCR. The efficacy of the Neuro2a/IL-21 vaccine was superior to that of IL-15-engineered Neuro2a cells. Moreover, with a three dose-schedule of Neuro2a/IL-21 the antitumor activity was similar to that previously reported by the use of a sequential vaccination with IL-12- and IL-15-Neuro2a engineered cells [9].

Antibody depletion experiments and an in vivo Winn-assay indicated that CD8+ CTLs were involved in the therapeutic effect of the Neuro2a/IL-21 cellular vaccine. In other tumor models, induction of CTL responses was found to represent the main effector mechanism involved in IL-21-triggered anti-tumor effects [7, 20, 23, 32]. Moreover, a previous study showed that induction of CTL responses targeting TH as NB-associated antigen by a DNA vaccine successfully protected syngeneic mice from NB [29]. Here, the protective role of CTLs was further supported by the study of other potential NB-associated antigens, showing that Neuro2a/pc cells express survivin and gp70env mRNA. Survivin is an anti-apoptotic protein involved in NB aggressiveness [1, 15], and has been found to induce CTL responses in different human tumors, including NB [8, 22]. In addition, survivin is expressed by endothelial cells during tumor neo-angiogenesis, and DNA vaccines targeting the survivin antigen suppressed neo-angiogenesis [37]. Gp70 is a glycoprotein of an endogenous murine retrovirus, expressed in several tumors that may act as an immunodominant CTL-defined antigen [7, 14]. Splenocytes from Neuro2a/IL-21-vaccinated mice resistant to Neuro2a/pc challenge, showed cytolytic activity against Neuro2a/pc upon in vitro re-stimulation using survivin CTL epitopes, while the AH1 epitope of the gp70 antigen induced weaker cytolytic activity. Similar findings were also obtained using splenocytes from NB-bearing mice that were cured by Neuro2a/IL-21 cell vaccine injection, suggesting that survivin is a relevant antigen in the Neuro2a NB model. However, in this case higher levels of background cytotoxicity were observed, possibly reflecting a more intense antigenic stimulation.

The use of two survivin synthetic epitopes in a IFN-γ ELISPOT assay on re-stimulated immune cells, indicated that one of them stimulates CTLs, and that IFN-γ produced by CTLs may be involved in the IL-21-triggered response. The finding that the resposes to the SURV-2 survivin epitope was reproducible but in general modest may depend on the low frequency of survivin-specific CTLs and suggest the possible involvement of other, yet unknown NB antigens. In previous studies, we showed that IFN-γ was crucial for immunotherapy by an IL-21-modified breast cancer cellular vaccine [7]. Indeed, we previously demonstrated that paracrine IL-21 secreted by IL-21-gene modified breast cancer cells induced local IFN-γ-dependent anti-angiogenic effects, related to anti-angiogenic chemokines [11]. Here we show that repeated vaccination by Neuro2a/IL-21 cells significantly reduced the number of microvessels in late out-growing metastases, suggesting that anti-angiogenic mechanisms may also take part systemically in IL-21-based therapy of murine NB. These anti-angiogenic effects could be related both to an immune response involving IFN-γ and to the targeting of survivin as antigen [37]. In addition, IFN-γ gene transfer reduced the proliferative potential of human NB cell in vitro and in vivo [2], and induced the expression of anti-angiogenic chemokines [30]. Moreover IFN-γ up-regulates caspase-8 expression in NB cells, through a direct action on its promoter [6], rendering NB cells more susceptible to apoptosis.

In other tumor models NK cells have been involved in the therapeutic effect of IL-21 [34]. In addition, NK cells played a role in NB immunotherapy by the use of antibody-targeted IL-2 [19]. Although in this study NK cell depletion by anti-asialo GM1 anti-serum had no effect on NB immunotherapy, a contribution of NK cells cannot be completely excluded. In a previous work [7] we showed that IL-21 anti-tumor activity did not require CD4+ T cell help. This finding came as no surprise because IL-21 is a T helper factor, which can directly stimulate CD8+ T cell proliferation and functional activities [28, 33]. In addition, IL-21 may inhibit Th1 development [35] and dendritic cell differentiation [5]. Altogether, these findings may reflect a late role of IL-21 in the immune response, as a factor driving the transition from an early innate immune response to CTL-mediated immunity [16], while inhibition of Th1 and dendritic cell differentiation may represent a feedback mechanism to prevent an excessive immune response.

A previous study in IL-21R deficient mice indicated that IL-21 has a relevant and non-redundant role in regulating B cell responses [26] and antibody responses were shown to be involved in IL-21-based immunotherapy in a murine tumor model [24]. Nonetheless, the detection of low IgM titers reacting with Neuro2a/pc cells in sera of Neuro2a/IL-21 vaccinated mice suggests that in our NB model IL-21 was unable to trigger a protective antibody response (ESM Fig. 2).

In conclusion, our data suggest that CTL responses against survivin were involved in the therapeutic effects of a whole-cell IL-21 gene-modified cellular vaccine and indicate a potential role of IL-21 in NB immunotherapy.

Electronic supplementary material

Below is the link to the electronic supplementary material.

(PDF 582 kb) (582.3KB, pdf)

Acknowledgments

This work was supported by grants awarded by AIRC, Italian Ministry of Health, Italian Neuroblastoma Foundation and CIPE. MC and BC are recipients of fellowships awarded by Italian Neuroblastoma Foundation. The excellent secretarial support of Ms C Bernardini is deeply acknowledged.

Footnotes

M. V. Corrias and S. Ferrini contributed equally to this work.

References

  • 1.Adida C, Berrebi D, Peuchmaur M, Reyes-Mugica M, Altieri DC. Anti-apoptosis gene, survivin, and prognosis of neuroblastoma. Lancet. 1998;351:882–883. doi: 10.1016/S0140-6736(05)70294-4. [DOI] [PubMed] [Google Scholar]
  • 2.Airoldi I, Meazza R, Croce M, Di Carlo E, Piazza T, Cocco C, D’Antuono T, Pistoia V, Ferrini S, Corrias MV. Low-dose interferon-gamma-producing human neuroblastoma cells show reduced proliferation and delayed tumorigenicity. Br J Cancer. 2004;90:2210–8. doi: 10.1038/sj.bjc.6601842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Beyer M, Schultze JL. Regulatory T cells in cancer. Blood. 2006;108:804–811. doi: 10.1182/blood-2006-02-002774. [DOI] [PubMed] [Google Scholar]
  • 4.Brady J, Hayakawa Y, Smyth MJ, Nutt SL. IL-21 induces the functional maturation of murine NK cells. J Immunol. 2004;172:2048–2058. doi: 10.4049/jimmunol.172.4.2048. [DOI] [PubMed] [Google Scholar]
  • 5.Brandt K, Bulfone-Paus S, Foster DC, Ruckert R. Interleukin-21 inhibits dendritic cell activation and maturation. Blood. 2003;102:4090–4098. doi: 10.1182/blood-2003-03-0669. [DOI] [PubMed] [Google Scholar]
  • 6.Casciano I, De Ambrosis A, Croce M, Pagnan G, Di Vinci A, Allemanni G, Banelli B, Ponzoni M, Romani M, Ferrini S. Expression of the caspase-8 gene in neuroblastoma cells is regulated through an essential interferon-sensitive response element (ISRE) Cell Death Differ. 2004;11:131–134. doi: 10.1038/sj.cdd.4401327. [DOI] [PubMed] [Google Scholar]
  • 7.Comes A, Rosso O, Orengo AM, Di Carlo E, Sorrentino C, Meazza R, Piazza T, Valzasina B, Nanni P, Colombo MP, Ferrini S. CD25+ regulatory T cell depletion augments immunotherapy of micrometastases by an IL-21-secreting cellular vaccine. J Immunol. 2006;176:1750–1758. doi: 10.4049/jimmunol.176.3.1750. [DOI] [PubMed] [Google Scholar]
  • 8.Coughlin CM, Vance BA, Grupp SA, Vonderheide RH. RNA-transfected CD40-activated B cells induce functional T-cell responses against viral and tumor antigen targets: implications for pediatric immunotherapy. Blood. 2004;103:2046–2054. doi: 10.1182/blood-2003-07-2379. [DOI] [PubMed] [Google Scholar]
  • 9.Croce M, Meazza R, Orengo AM, Radic L, De Giovanni B, Gambini C, Carlini B, Pistoia V, Mortara L, Accolla RS, Corrias MV, Ferrini S. Sequential immunogene therapy with interleukin-12- and interleukin-15-engineered neuroblastoma cells cures metastatic disease in syngeneic mice. Clin Cancer Res. 2005;11:735–742. [PubMed] [Google Scholar]
  • 10.De Bernardi B, Nicolas B, Boni L, Indolfi P, Carli M, Cordero Di Montezemolo L, Donfrancesco A, Pession A, Provenzi M, di Cataldo A, Rizzo A, Tonini GP, Dallorso S, Conte M, Gambini C, Garaventa A, Bonetti F, Zanazzo A, D’Angelo P, Bruzzi P, Italian Co-Operative Group for Neuroblastoma Disseminated neuroblastoma in children older than one year at diagnosis: comparable results with three consecutive high-dose protocols adopted by the Italian Co-operative Group for Neuroblastoma. J Clin Oncol. 2003;21:1592–1601. doi: 10.1200/JCO.2003.05.191. [DOI] [PubMed] [Google Scholar]
  • 11.Di Carlo E, Comes A, Orengo AM, Rosso O, Meazza R, Musiani P, Colombo MP, Ferrini S. IL-21 induces tumor rejection by specific CTL and IFN-gamma-dependent CXC chemokines in syngeneic mice. J Immunol. 2004;172:1540–1547. doi: 10.4049/jimmunol.172.3.1540. [DOI] [PubMed] [Google Scholar]
  • 12.Di Carlo E, De Totero D, Piazza T, Fabbi M, Ferrini S. Role of IL-21 in immune-regulation and tumor immunotherapy. Cancer Immunol Immunother. 2007;56:1323–1334. doi: 10.1007/s00262-007-0326-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hoffmann D, Bayer W, Grunwald T, Wildner O. Intratumoral expression of respiratory syncytial virus fusion protein in combination with cytokines encoded by adenoviral vectors as in situ tumor vaccine for colorectal cancer. Mol Cancer Ther. 2007;6:1942–1950. doi: 10.1158/1535-7163.MCT-06-0790. [DOI] [PubMed] [Google Scholar]
  • 14.Huang AY, Gulden PH, Woods AS, Thomas MC, Tong CD, Wang W, Engelhard VH, Pasternack G, Cotter R, Hunt D, Pardoll DM, Jaffee EM. The immunodominant major histocompatibility complex class I-restricted antigen of a murine colon tumor derives from an endogenous retroviral gene product. Proc Natl Acad Sci USA. 1996;93:9730–9735. doi: 10.1073/pnas.93.18.9730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Islam A, Kageyama H, Takada N, Kawamoto T, Takayasu H, Isogai E, Ohira M, Hashizume K, Kobayashi H, Kaneko Y, Nakagawara A. High expression of Survivin, mapped to 17q25, is significantly associated with poor prognostic factors and promotes cell survival in human neuroblastoma. Oncogene. 2000;19:617–623. doi: 10.1038/sj.onc.1203358. [DOI] [PubMed] [Google Scholar]
  • 16.Kasaian MT, Whitters MJ, Carter LL, Lowe LD, Jussif JM, Deng B, Johnson KA, Witek JS, Senices M, Konz RF, Wurster AL, Donaldson DD, Collins M, Young DA, Grusby MJ. IL-21 limits NK cell responses and promotes antigen-specific T cell activation: a mediator of the transition from innate to adaptive immunity. Immunity. 2002;16:559–569. doi: 10.1016/S1074-7613(02)00295-9. [DOI] [PubMed] [Google Scholar]
  • 17.King C, Ilic A, Koelsch K, Sarvetnick N. Homeostatic expansion of T cells during immune insufficiency generates autoimmunity. Cell. 2004;117:265–277. doi: 10.1016/S0092-8674(04)00335-6. [DOI] [PubMed] [Google Scholar]
  • 18.Kowalczyk A, Wierzbicki A, Gil M, Bambach B, Kaneko Y, Rokita H, Repasky E, Fenstermaker R, Brecher M, Ciesielski M, Kozbor D. Induction of protective immune responses against NXS2 neuroblastoma challenge in mice by immunotherapy with GD2 mimotope vaccine and IL-15 and IL-21 gene delivery. Cancer Immunol Immunother. 2007;56:1443–1458. doi: 10.1007/s00262-007-0289-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lode HN, Xiang R, Dreier T, Varki NM, Gillies SD, Reisfeld RA. Natural killer cell-mediated eradication of neuroblastoma metastases to bone marrow by targeted interleukin-2 therapy. Blood. 1998;91:1706–1715. [PubMed] [Google Scholar]
  • 20.Ma HL, Whitters MJ, Konz RF, Senices M, Young DA, Grusby MJ, Collins M, Dunussi-Joannopoulos K. IL-21 activates both innate and adaptive immunity to generate potent antitumor responses that require perforin but are independent of IFN-gamma. J Immunol. 2003;171:608–615. doi: 10.4049/jimmunol.171.2.608. [DOI] [PubMed] [Google Scholar]
  • 21.Maris JM, Matthay KK. Molecular biology of neuroblastoma. J Clin Oncol. 1999;17:2264–2279. doi: 10.1200/JCO.1999.17.7.2264. [DOI] [PubMed] [Google Scholar]
  • 22.Morandi F, Chiesa S, Bocca P, Millo E, Salis A, Solari M, Pistoia V, Prigione I. Tumor mRNA-transfected dendritic cells stimulate the generation of CTL that recognize neuroblastoma-associated antigens and kill tumor cells: immunotherapeutic implications. Neoplasia. 2006;8:833–842. doi: 10.1593/neo.06415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Moroz A, Eppolito C, Li Q, Tao J, Clegg CH, Shrikant PA. IL-21 enhances and sustains CD8+ T cell responses to achieve durable tumor immunity: comparative evaluation of IL-2, IL-15, and IL-21. J Immunol. 2004;173:900–909. doi: 10.4049/jimmunol.173.2.900. [DOI] [PubMed] [Google Scholar]
  • 24.Nakano H, Kishida T, Asada H, Shin-Ya M, Shinomiya T, Imanishi J, Shimada T, Nakai S, Takeuchi M, Hisa Y, Mazda O. Interleukin-21 triggers both cellular and humoral immune responses leading to therapeutic antitumor effects against head and neck squamous cell carcinoma. J Gene Med. 2006;8:90–99. doi: 10.1002/jgm.817. [DOI] [PubMed] [Google Scholar]
  • 25.Nielsen M, Lundegaard C, Lund O, Kesmir C. The role of the proteasome in generating cytotoxic T cell epitopes: Insights obtained from improved predictions of proteasomal cleavage. Immunogenetics. 2005;57:33–41. doi: 10.1007/s00251-005-0781-7. [DOI] [PubMed] [Google Scholar]
  • 26.Ozaki K, Spolski R, Feng CG, Qi CF, Cheng J, Sher A, Morse HC, 3rd, Liu C, Schwartzberg PL, Leonard WJ. A critical role for IL-21 in regulating immunoglobulin production. Science. 2002;298:1630–1634. doi: 10.1126/science.1077002. [DOI] [PubMed] [Google Scholar]
  • 27.Parker KC, Bednarek MA, Coligan JE. Scheme for ranking potential HLA-A2 binding peptides based on independent binding of individual peptide side-chains. J Immunol. 1994;152:163–175. [PubMed] [Google Scholar]
  • 28.Parrish-Novak J, Dillon SR, Nelson A, Hammond A, Sprecher C, Gross JA, Johnston J, Madden K, Xu W, West J, Schrader S, Burkhead S, Heipel M, Brandt C, Kuijper JL, Kramer J, Conklin D, Presnell SR, Berry J, Shiota F, Bort S, Hambly K, Mudri S, Clegg C, Moore M, Grant FJ, Lofton-Day C, Gilbert T, Rayond F, Ching A, Yao L, Smith D, Webster P, Whitmore T, Maurer M, Kaushansky K, Holly RD, Foster D. Interleukin-21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature. 2000;408:57–63. doi: 10.1038/35040504. [DOI] [PubMed] [Google Scholar]
  • 29.Pertl U, Wodrich H, Ruehlmann JM, Gillies SD, Lode HN, Reisfeld RA. Immunotherapy with a posttranscriptionally modified DNA vaccine induces complete protection against metastatic neuroblastoma. Blood. 2003;101:649–654. doi: 10.1182/blood-2002-02-0391. [DOI] [PubMed] [Google Scholar]
  • 30.Ribatti D, Nico B, Pezzolo A, Vacca A, Meazza R, Cinti R, Carlini B, Parodi F, Pistoia V, Corrias MV. Angiogenesis in a human neuroblastoma xenograft model: mechanisms and inhibition by tumour-derived interferon-gamma. Br J Cancer. 2006;94:1845–1852. doi: 10.1038/sj.bjc.6603186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Siegel S, Wagner A, Schmitz N, Zeis M. Induction of antitumour immunity using survivin peptide-pulsed dendritic cells in a murine lymphoma model. Br J Haematol. 2003;122:911–914. doi: 10.1046/j.1365-2141.2003.04535.x. [DOI] [PubMed] [Google Scholar]
  • 32.Ugai S, Shimozato O, Kawamura K, Wang YQ, Yamaguchi T, Saisho H, Sakiyama S, Tagawa M. Expression of the interleukin-21 gene in murine colon carcinoma cells generates systemic immunity in the inoculated hosts. Cancer Gene Ther. 2003;10:187–192. doi: 10.1038/sj.cgt.7700552. [DOI] [PubMed] [Google Scholar]
  • 33.van Leeuwen EM, Gamadia LE, Baars PA, Remmerswaal EB, ten Berge IJ, van Lier RA. Proliferation requirements of cytomegalovirus-specific, effector-type human CD8+ T cells. J Immunol. 2002;169:5838–5843. doi: 10.4049/jimmunol.169.10.5838. [DOI] [PubMed] [Google Scholar]
  • 34.Wang G, Tschoi M, Spolski R, Lou Y, Ozaki K, Feng C, Kim G, Leonard WJ, Hwu P. In vivo antitumor activity of interleukin 21 mediated by natural killer cells. Cancer Res. 2003;63:9016–9022. [PubMed] [Google Scholar]
  • 35.Wurster AL, Rodgers VL, Satoskar AR, Whitters MJ, Young DA, Collins M, Grusby MJ. Interleukin 21 is a T helper (Th) cell 2 cytokine that specifically inhibits the differentiation of naïve Th cells into interferon gamma-producing Th1 cells. J Exp Med. 2002;196:969–977. doi: 10.1084/jem.20020620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wysocki PJ, Karczewska-Dzionk A, Mackiewicz-Wysocka M, Mackiewicz A. Human cancer gene therapy with cytokine gene-modified cells. Expert Opin Biol Ther. 2004;4:1595–1607. doi: 10.1517/14712598.4.10.1595. [DOI] [PubMed] [Google Scholar]
  • 37.Xiang R, Mizutani N, Luo Y, Chiodoni C, Zhou H, Mizutani M, Ba Y, Becker JC, Reisfeld RA. A DNA vaccine targeting survivin combines apoptosis with suppression of angiogenesis in lung tumor eradication. Cancer Res. 2005;65:553–561. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

(PDF 582 kb) (582.3KB, pdf)

Articles from Cancer Immunology, Immunotherapy : CII are provided here courtesy of Springer

RESOURCES