Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Apr 6;103(6):103722. doi: 10.1016/j.psj.2024.103722

Molecular characterization of Marek's Disease virus reveals reticuloendotheliosis virus-long terminal repeat integration in the genome of the field isolates in Egypt

Aya Emad *, Ali A El-Kenawy *,2, Mohamed El-Tholoth *,†,1,2
PMCID: PMC11036097  PMID: 38626691

Abstract

The highly contagious, immunosuppressive, and cancer-causing Marek's disease virus (MDV) infects chickens. The financial costs of Marek's disease (MD) are significant for the chicken industry. In this study, a total of 180 samples from chicken farms suspected to be MDV-infected were collected. The chickens were sampled during the period between the months of October 2016 and February 2018 at Dakahlia and Damietta Governorates, Egypt. A total of 36 pooled samples were created. The prepared samples were inoculated into embryonated chicken eggs (ECEs). Indirect fluorescent antibody technique (IFAT) and ICP4 gene-based polymerase chain reaction (PCR) were used for MDV identification. For the genetic characterization of the identified virus, The ICP4 gene sequence was identified and compared with the sequences available from various regions of the world. Furthermore, the genomes of all detected MDVs were screened for the long terminal repeat (LTR) region of reticuloendotheliosis (REV) in their genomes. The results showed that 31 out of 36 pooled samples (86.1%) inoculated into ECEs displayed the characteristic pock lesions. By using IFAT and PCR to identify MDV in ECEs, positive results were found in 27 samples (75%). The Egyptian virus is thought to be genetically closely related to MDVs circulating in Ethiopia, China, and India. REV-LTR was amplified from 6 out of 27 field isolates genomes (22.2 %) while MDV vaccine strains were free from REV-LTR insertion. The integrated REV-LTRs depicted a close genetic relationship with those integrated in fowl poxvirus (FWPV) circulating in Egypt as well as those integrated in FWPVs and MDVs from China, USA, South Africa, and Australia. To the best of our knowledge, this investigation represents the first identification and characterization of REV-LTR insertions in Egyptian MDV field isolates. Given the findings above, additional research in the future seems crucial to determine how the REV-LTR insertions affect MDV pathogenesis, virulence, and insufficient vaccination protection.

Key words: Marek's disease virus, Egypt, ICP4 gene, reticuloendotheliosis virus, LTR

INTRODUCTION

Three viral groups: Marek's disease virus (MDV), reticuloendotheliosis virus (REV), and avian leukosis virus are responsible for the chicken neoplastic disease (Payne and Venugopal, 2000). Marek's disease (MD), a lymphoproliferative disease that affects chickens all over the world, is one of the highly contagious diseases. Immunosuppression, polyneuritis, and T-cell lymphomas are the hallmarks of MD. MDV is an etiological agent that is an oncogenic avian herpesvirus (Boodhoo et al., 2016).

Gallid herpesvirus 2 (GaHV-2), Gallid herpesvirus 3 (GaHV-3), and Meleagrid herpesvirus 1 (MeHV-1) (formerly known as Marek's disease virus (MDV) serotype 1 (MDV-1), MDV serotype 2 (MDV-2), and MDV serotype 3 (MDV-3) or herpesvirus of turkeys (HVT), respectively) are species in the genus Mardivirus, family Herpesviridae, subfamily Alphaherpesvirinae (Gatherer et al., 2021; WOAH, 2023). GaHV-2 (hereafter referred to as MDV-1) includes all highly contagious virulent oncogenic strains and their attenuated derivatives, while MeHV-1 (hereafter referred to as HVT) and GaHV-3 are avirulent and are used as vaccine strains (Islam and Walkden-Brown, 2007; Reddy et al., 2017). Serotype 1-MDV is further classified into various pathotype strains, ranging from mild to very virulent plus strains (Witter, 1983; Witter et al., 2005).

The most prevalent clinical sign in the classical MD with one or more enlarged peripheral nerves is partial or total paralysis of the legs and wings. Solid tumors originating from transformed T-lymphocytes in the liver, spleen, gonads, lungs, kidneys, proventriculus, and heart are the typical finding in acute MD (Chauhan et al., 2021; WOAH, 2023). The first case of MD was reported in Egypt in 1954 (Soliman et al., 1954), and several studies, including pathological, virological, and/or seroepidemiological studies, have been published (Sheble et al., 1973; El-Sawy et al, 1992; Amin et al., 2001; Awad, 2002; Hussein et al., 2004; Hassanin et al, 2013; Lebdah et al., 2017; El-Kenawy et al., 2019; Ewies et al., 2021).

The viral particles that cause MD are similar to those that have been reported for other herpesviruses. Herpesviruses had a complex architecture including a viral DNA genome, capsid, a tegument, and a lipid bilayer with the envelope glycoproteins. The linear double-stranded DNA-MDV genome is 160–180 kb in length approximately, which represented by a unique long (UL) and a unique short (US) sequences. Internal repeat (IR) and terminal repeat (TR) sequences bordered the 2 sequences (Tulman et al., 2000; Osterrieder et al., 2006). It is known that the MDV genome is susceptible to recombination and the insertion of segments from other viral genomes, particularly retroviruses like the REV (Isfort et al., 1992; Jones et al., 1996; Zhang and Cui, 2005). MDV ICP4 gene is locating within the IR flanking the MDV genome-US (Cantello et al., 1994). ICP 4 is one of the genes involved in the replication and oncogenesis of the virus through inhibiting MDV reproduction while the virus is in a latent state (Woźniakowski et al., 2010a).

Clinical signs and postmortem inspection are used to provide a tentative diagnosis of the disease (Bulbula et al., 2022), while viral isolation through propagation on SPF embryonated chicken eggs (ECEs) or on tissue cultures, such as chicken embryo fibroblasts (CEF) and chicken embryo kidney cells (CEKC) or chicken kidney cells (CKC), is used to make a definite diagnosis (Schat, 2005). The fluorescent antibody test (FAT), serum neutralization (SN), agar gel precipitation (AGPT), and antigen capture ELISA are all methods that can be used to identify the MDV antigen (Davidson et al., 1986; Kurokawa and Yamamoto, 2022). Real-time polymerase chain reaction (PCR) and conventional PCR have both been cited as quick and accurate diagnostic techniques for MDVs (Gall et al., 2018; Oluwayinka et al., 2023). One of the best examples of protection against tumors induced by viruses is vaccination against MD. Monovalent or multivalent live virus vaccines could be administered in ovo or at hatch to control the disease (Witter, 1998). Vaccination does not prevent infection by MDV in the field, but it protects against clinical signs and decreases horizontal transmission by reducing MDV shedding in dander (Woźniakowski et al., 2010a).

Reticuloendotheliosis virus (REV) is an immunosuppressive virus which affects both cellular and humoral immunity of infected chickens (Woźniakowski et al., 2018). REV genome comprises 3 major genes, gag, pol, and env, along with 2 flanking long terminal repeat (LTR) regions (Chacón et al., 2022). The LTR regions of REV include signals for initiation and termination of the genome transcription (Ridgway, 1992). An additional concern is that REV has the capacity to integrate a segment or the full genome into the DNA of MDV (Isfort et al., 1992; Jones et al., 1993). REV-LTR insertion into MDV genome may have an impact on the virus virulence (Davidson and Borenshtain, 2001). The insertion of REV-LTR does not result in production of active REV (Kost et al., 1993). The historical, phylogenetic, and paleovirological data suggest a scenario in which REVs originated as retroviruses in mammals, were iatrogenically introduced into avian hosts, and later integrated into the genomes of FWPV and MDV, resulting in the creation of recombinant DNA viruses that currently circulate among wild birds and poultry. These findings mark the initial indication that horizontal gene transfer between different virus families could amplify the consequences of unintentional transmission events, prompting concerns about the potential unintended effects of live, recombinant vector vaccines (Niewiadomska and Gifford, 2013).

To the best of our knowledge, no published information addressing the integration of REV in the genome of Egyptian MDV field isolates. In this study, we investigate the molecular characterization of MDV circulating in commercial poultry farms between October 2016 and February 2018 in Dakahlia and Damietta Governorates, Egypt. The REV-LTR insertions in the identified field isolates of MDVs were also molecularly investigated as part of our study.

MATERIALS AND METHODS

Ethical Statement

Collection of samples from chickens and extracted nucleic acid transfer were conducted in compliance with the ethical guidelines of University Mansoura and The ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines. Approval for all experimental procedures was obtained by a local administrative panel on Laboratory Animal Care Committee in Faculty of Veterinary Medicine, Mansoura University. Farms Owners had given informed consent according to the national ethical regulations.

Chickens and Sampling

A total of 180 samples of the feather follicle epithelium, ovary, spleen, kidney, and liver were collected from layer chicken farms suspected to be MDV-infected. The chickens were sampled between October 2016 and February 2018 from Dakahlia and Damietta Governorates, Egypt (Figure 1). As per the protocol described by Cannon and Roe, 1982, the sampling and sample size were carried out. A total of 36 pooled samples were created. Each pooled sample is composed of tissues of 5 birds belonging to the same flock (one pooled sample/flock). These farms had a history of receiving HVT- FC126 strain and MDV-1-CVI 988/Rispens strain vaccinations against MDV (Supplementary Materials, Table S1). Diseased chickens (aged 90–360 d) displayed clinical signs of lethargy, leg and wing paralysis, neck twisting (torticollis), ataxia, and the development of grey eyes. The postmortem inspection revealed enlargement of peripheral nerves, an ovarian appearance resembling cauliflower, as well as enlarged liver and kidney with localized nodular lesions (Figure 2). Pooled samples of feather follicle epithelium, ovary, spleen, kidneys and liver were collected from apparently healthy and MDV- unvaccinated chickens, confirmed to be MDV-free by PCR from a different farm at 175 d of age to serve as negative controls. The samples were collected immediately after the chickens were culled to preserve the MDV viability and kept at –20°C until they were used for the purposes of virus isolation and identification.

Figure 1.

Figure 1

Egypt map showing Dakahlia and Damietta Governorates (in red circles) involved in this study.

Figure 2.

Figure 2

Marek's disease virus (MDV) showing: (A) Paralysis of wing and leg, (B) Eye lesion (Gray eye), (C) Cauliflower-like appearance of the ovary, (D) Peripheral nerve enlargement, (E) Enlarged liver with grey-white nodules, (F) Enlarged kidney with focal nodules.

Collected Tissue Samples Preparation

It was conducted as previously described by Demeke et al. 2017 and WOAH, 2023 for preparing cell-free MDVs. Using sterile scissors, the tissue samples were cut up into little pieces. A mortar and pestle were used to homogenize the tissue. 20% (W/V) suspension was made using sterile phosphate buffer saline (PBS) solution containing antibiotics (100 IU/mL of penicillin and 1000 μg/mL streptomycin. The suspensions were subjected to 3 cycles of freezing and thawing. After centrifuging the suspensions for 15 min at 10,000 rpm, the supernatants were collected and stored at –20°C until use.

Standard Viruses

MDV-1 live vaccine (Rispens CVI 988 Strain) (MERIAL, INC., Gainesville, GA,) was used as a positive control in PCR for MDV detection and was tested for detection of REV-LTR. FC-126 strain of HVT (FaTRo veterinary pharmaceutical in-dustry, Ozzano dell'Emilia (BO) Italy) was used for testing the presence of REV-LTR.

Synthetic REV-LTR DNA Fragments

Synthesized DNA fragments based on a reference REV nucleotides sequence (Accession number: KJ909531.1) (Supplementary Materials, Table S2) that mimic the REV-LTR target was obtained from IDT Company (Coralville, IA). It was used as a positive control in PCR for REV inserts detection.

MDV Isolation via Embryonated Chicken Eggs

Nine-day-old SPF (Specific Pathogen-Free) ECEs were acquired from Egyptian S.P.F. Eggs Production Farm in Fayoum, Egypt. On the 10th day, a random selection of twenty eggs was screened using real-time PCR to ensure they were not contaminated with vertically transmitted REV contamination by real-time PCR, as previously described (Li et al., 2012). Following confirmation, the supernatant fluid from each sample was inoculated into 11-day-old REV-free SPF ECE (0.2 mL/ECE) via the chorioallantoic membrane (CAM) route. The inoculated eggs were then incubated for a period of 6 d at 35°C. Subsequently, the CAMs were examined for the presence of specific pock lesions, and CAMs were collected. Three passages were conducted for each pooled sample. From each CAM, a single distinct pock lesion was picked from the CAM, homogenized with PBS, subjected to centrifugation, and the resulting supernatant fluids were stored at –20°C until use for PCR analysis (Biggs and Milne, 1971; Burleson et al., 1992).

Identification of the Isolated Virus

Indirect Fluorescence Antibody Test (IFAT)

Following Naito et al. (1970) instructions, prepared cryostat slides from inoculated CAMs were fixed with cold acetone for 10 min, then incubated at 37°C for 1 h with a few drops of the prepared rabbit hyperimmune serum against MDV-1-Rispens CVI 988 Strain (1:100) in a humidified place. This hyperimmune serum was prepared as previously described (Mikami and Bankowski, 1971) and showed specificity against both standard HVT and MDV-1. PBS pH 7.2 was used to wash the slides 3 times for a total of 30 min each. Slides were treated with a few drops of antirabbit FITC conjugate (1:200 dilution; Sigma Aldrich Company) for 30 min at 37°C in a dark, humidified atmosphere. The slides were then thoroughly cleaned with PBS 3 times for a total of 15 min (5 min each), mounted with glycerol, covered with a cover slip, and viewed under a fluorescence microscope to check for a yellowish-green color that indicates a positive outcome.

Molecular Detection of the Isolated Virus

DNA Extraction

In accordance with the instructions provided with the kit, 27 tested isolates (homogenates from distinct pock lesions) were subjected to DNA extraction along with non-infected CAMs (negative control) and MDV-1-Rispens CVI 988 Strain (positive control) using the QIAamp MinElut Virus Spin Kit (QIAGEN, GmbH, Hilden, Germany).

Polymerase Chain Reaction (PCR) for Detection of MDV-ICP4 gene

Oligonucleotide primers were created according to Kalyani et al. (2010) for amplifying MDV- ICP4 gene. Table 1 lists the oligonucleotide primers used in the PCR process, which were created by Metabion International AG in Planegg, Germany. The primers arrived in lyophilized form and were then reconstituted in Tris/EDTA (TE) buffer to achieve a final concentration of 10 pmol, specifically designed to amplify a targeted segment of 318 bp. The reaction mixture consisted of 25 μL of Dream Taq Green PCR MasterMix (2X) from Thermo Scientific in Waltham, MA, 4 μL of DNA, 1 μL each of forward and reverse primers, and nuclease-free water was added to reach a total volume of 50 μL. In every PCR run, both a positive control (Rispens CVI 988 Strain) and a negative control (using noninfected CAM) were included.

Table 1.

Details of the 2 sets of primers that were used for the amplification of the MDV ICP4 gene and REV -LTR.

Primers Sequence (5′– 3′) Direction Target Product size (bp) References
MDV M1.1 forward primer GGATCGCCCACCACGATTACTACC ICP4 gene 318 Kalyani et al., 2010
MDV M1.8 reverse primer ACTGCCTCACACAACCTCATCTCC
REV LTR 3 forward primer GCGCTGGCTCGCTAACTG REV-LTR 200 Moore et al., 2000
REV LTR 4 reverse primer TTCGATCTCGTGTTTGTTCGTGATT

The PCR protocol was executed in a thermal cycler (Biometra T-Gradient, Göttin-gen, Germany) as follows: an initial denaturation step at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 1 min, annealing at 60.8°C for 1 min, and a final extension at 72°C for 1 min. Additionally, there was a final incubation at 72°C for 10 min. Subsequently, a 1.5% agarose gel in 0.5% Tris-Borate EDTA buffer (both from Sigma-Aldrich, Cairo, Egypt) was used to separate the PCR products, alongside a 100-base pair DNA ladder (Jena Bioscience in Jena, Germany). The DNA bands were visualized using a UV transilluminator.

PCR for Detection of REV-LTR Gene in the Isolated MDVs and Vaccine Strains

PCR protocol for the detection of REV integration was carried out based on the amplification of REV-LTR from DNA extracted from homogenates of separate MDVs pock lesions on CAMs of ECEs. MDV-1 vaccine (Rispens CVI 988 Strain) and HVT-F126 vaccine were tested for presence of REV. REV integration was detected with a forward primer that anneals at nucleotides 272 to 290 and a reverse primer that anneals at nucleotides 472 to 448 of a reference REV genome (M22224) (Moore et al., 2000) as shown in Table 1. The reaction done as described previously but with the amplification program for REV-LTR gene as follows: A denaturation step at 94°C for 10 min followed by 35 cycles at 95°C for 1 min, 55°C for 45 s, and 72°C for 30 s. A final extension cycle was conducted at 72°C for 6 min. In every PCR run, synthetic DNA fragments (IDT Company, Coralville, IA) that mimic the REV target and non-infected CAM were used as positive and negative controls, respectively.

Sequencing of MDV ICP4 Gene and REV-LTR Gene

For nucleotide sequencing, 3 PCR products were chosen. These samples came from flocks with high mortality rates and were selected based on the PCR product band intensity in the gel. The QIAquick PCR gel purification kit (Qiagen Inc., Valencia, CA) was then used to extract and purify the amplified DNA bands of the MDV ICP4 gene (318 bp) and REV-LTR (200 bp) from the gel in accordance with the kit's instructions. The purified PCR products were subsequently shipped to Macrogen Clinical Laboratory (Korea) for bidirectional DNA sequencing. The acquired nucleotide sequences were deposited into GenBank (http://www.ncbi.nlm.nih.gov/Genbank) (Table 2).

Table 2.

Details of the MDV ICP4 protein gene and REV-LTR DNA sequences, including gene name year of isolation, Governorate and accession numbers.

Virus Gene Isolate Year of isolation Governorate Accession number
GaHV-2 ICP4 gene DK-05-17 2017 Dakahlia OR420923
GaHV-2 ICP4 gene DT-02-18 2018 Damietta OR420924
GaHV-2 ICP4 gene DK-11-16 2016 Dakahlia OR420925
REV REV-LTR DK-12-16 2016 Dakahlia OR420920
REV REV-LTR DK-10-18 2018 Dakahlia OR420921
REV REV-LTR DT-02-17 2017 Damietta OR420922

GaHV-2, Gallid alphahepesvirus-2; REV, Reticuloendotheliosis virus.

Sequencing Data Analysis

ClustalW2 (https://www.ebi.ac.uk/Tools/msa/clustalw2/) version 2.1 was used to analyze the collected sequencing data. The phylogenetic Neighbor Joining (NJ) and bootstrap NJ analyses with 1000 repeat bootstrap tests were performed using the alignment output files and MEGA X software version 2 (http://www.megasoftware.net/).

RESULTS

MDV Isolation

Out of the 36 pooled collected samples, 31 (86%) samples had positive results. The collected CAM showed pock lesions in positive cases. These lesions became more pronounced in the second and third passages (Figures 3A and B). In positive cases, the embryos had dwarfism, swollen pale-green livers, and a pallid heart. On the other hand, the negative control ECEs inoculated with prepared samples from healthy chickens showed no alterations.

Figure 3.

Figure 3

Isolation of MDV on CAMs of ECEs showing; (A) Control noninfected CAM, (B) Scattered pock lesions on CAM of inoculated ECE. Indirect fluorescent antibody technique (IFAT) for MDV identification in inoculated ECE showing; (C) Control non-infected CAM, (D) Yellowish green color in cryostat section of infected CAM.

Identification of the Isolated Virus

IFAT results indicated the detection of MDV antigens in 27 of 36 (75%) CAMs that were inoculated, as evidenced by a yellowish-green coloration. The control CAMs, which were not infected, exhibited negative results (Figures 3C and D). ICP4 gene-MDV was amplified positively with the right size (318 bp) in also 27 samples based on analysis of the PCR products from the amplification reaction of extracted nucleic acids of inoculated CAMs by agarose gel electrophoresis. There was no amplified product seen in the negative control sample.

Detection of the REV-LTR Gene in the Isolated MDVs Genome and Vaccine Strains

Out of 27 extracted DNA samples from homogenates of separate MDV pock lesions, 6 isolates (22.2%) were confirmed to have REV-LTR integration in their genome, with an amplicon of 200 bp. Moreover, the remaining 21 tested isolates as well as the MDV-1 vaccine (Rispens CVI 988 Strain) that expressed ICP4 gene amplification did not show any amplified bands for REV-LTR. Moreover, no REV-LTR gene was detected in HVT- FC-126 vaccine strain. In our study, no clear differences were observed in the clinical picture of chickens infected with MDV-1, whether they had the LTR insert or not.

Sequencing and Phylogenetic Analysis of the MDV ICP4 Gene and REV- LTR Gene

The amplified DNA bands of the MDV ICP4 gene (318 bp) and REV-LTR (200 bp) were subjected to DNA sequencing. The obtained sequences (Table 2) were then submitted to GenBank and analyzed in comparison to the reference ICP4 genes and REV-LTR gene sequences from GenBank (Figure 4, Figure 5)

Figure 4.

Figure 4

Phylogenetic tree based on MDV ICP4 protein gene nucleotide sequences of our MDV isolates (blue triangles) from diseased chickens with other MDVs whose ICP4 genes were retrieved from the GenBank database sequences. Numbers at the internal nodes represent the bootstrap probabilities (1000 replicates).

Figure 5.

Figure 5

Phylogenetic Neighbor-Joining tree with 1000 repeats bootstrap of our REV-LTR nucleotide sequences (blue triangles) with other REV-LTR genes of REV (black color), FWPV (purple color), and GaHV-2 (red color) retrieved from the GenBank database sequences.

The MDV ICP4 gene phylogenic tree based on nucleotide sequences (Figure 4) was separated into clades: our isolates (OR420923, OR420924, and OR420925) were included in the same clade and showed a high percentage of identity (≥ 97.5%). The isolates showed high percentage of identity ranging from 97.5 to 98.8 with the Ethiopian strains (OP485106.1, OP485107.1, and OP485108.1) isolated in 2020, Chinese strains (MW531728.1, and JQ314003.1) isolated in 2007 and 2008 and Indian strains (KT921791, KT921786, and KT921796) isolated in 2013 and 2014 retrieved from GenBank. Whereas, German, Serbian, and Indian isolates were grouped along with another Egyptian strain isolated previously in Egypt (MT748031) identified in the period of 2018 to 2020 (Yehia et al., 2021).

On the other hand, as shown in Figure 5, REV-LTR nucleotide sequences identified in this study (OR420920.1, OR420921.1, and OR420922.1) showed a high percentage of identity to each other (97.0–98.5%). The identified REV-LTR sequences showed a high degree of genetic identity (98.8%) with REV- 5′LTR integration identified in fowl poxvirus isolate identified previously in Dakahlia/2017 (MT251362.1). Also, the identified REV-LTR sequences showed a high degree of identity (95.0-98.5%) with identified REV-LTR integrated in FWPV and GaHV-2 from China, USA, South Africa, and Australia. Importantly, the obtained REV-LTR sequences (200 bp) in this study were aligned with the full-genome sequence of MDV-1 GX0101 (JX844666) field isolate as a reference MDV-1 (Zhang and Cui, 2005) using the NCBI BLAST tool to pinpoint the insertion site of REV-LTR in the MDV-1 genomes. The comparison findings indicated that the amplified 200-bp of REV probably falls between nucleotide no. 152775 and 152775 in the US region near the IRS region of MDV-1 genomes. Further study on the molecular characterization of Egyptian MDV isolates through full genome sequencing is crucial to accurately pinpoint the insertion site of REV-LTR or other REV genes within the MDV genomes.

DISCUSSION

Our data presents interesting findings on the isolation and molecular characterization of MDVs from pooled samples from the Egyptian governorates of Dakahlia and Damietta. In addition, the same samples were screened for the existence of REV-LTR in their genomes using molecular identification and sequence analysis. To the best of our knowledge, our study is the first to identify and describe REV-LTR insertions in Egyptian MDV field strains.

As depicted by our findings, the examined chickens suspected of being diseased displayed the enlargement of peripheral nerves, an ovary with a cauliflower-like appearance, as well as enlarged liver and kidneys with focal nodular lesions. These observations align with those documented in prior research (Hassanin et al., 2013; Zhuang et al., 2015; Boodhoo et al., 2016; El-Kenawy et al., 2019; Stamilla et al., 2020; Ewies et al., 2021; Birhan et al., 2023). Notably, 31 of 36 (86%) clinical samples inoculated on CAM of 11-day-old SPF ECEs (REV-free), showed pock lesions, embryo dwarfism, a swollen greenish pale liver, and a pale appearance of the heart. These results are in line with previous studies (Evans et al., 1971; El-Kenawy et al., 2019).

In this study, IFAT and PCR techniques were used for the detection of MDVs in the inoculated CAMs as a rapid, effective, and specific methods for laboratory identification of the virus (Purchase, 1969; Naito et al., 1970; Davidson et al., 1995; Teng et al., 2023). MDVs were detected in 27 inoculated CAMs (75%) by both IFAT and PCR. It is possible that the presence of herpesviruses other than MDVs, which replicate with little to no clinical signs of infection, could account for the 4 samples that demonstrated the formation of pock lesions on CAMs but did not yield positive results in IFAT and PCR (Kaleta and Docherty, 2007). It is crucial for future work to retest all samples using assays that can differentiate between the virulent MDV-1 field strain, the attenuated MDV-1 vaccine strain as well as the HVT vaccine strain (Bulow and Biggs, 1975; Cho, 1981; Silva, 1992; Woźniakowski et al., 2013; Mescolini et al., 2022).

Furthermore, the analysis of the sequence of the MDV ICP4 gene revealed that our isolates (OR420923, OR420924, and OR420925) were closely related genetically to each other with ≥ 97.5% identity percentage. The isolates showed high similarity in the nu-cleotides sequences (97.5–98.8%) with the Ethiopian strains (OP485106.1, OP485107.1, and OP485108.1) isolated in 2020, Chinese strains (MW531728.1, and JQ314003.1) isolated in 2007 and 2008 and Indian strains (KT 921791, KT921786, and KT921796) isolated in 2013 and 2014. The results suggest potential transmission of the virus between Egypt and Ethiopia with the possibility of virus transmission from China and/or India. The incorporation of Meq gene sequences from MDV-1 isolates into future studies is warranted, as it is a widely employed approach for virulence prediction and MDV-1 genotype classification (Woźniakowski et al., 2010b; Cui et al., 2016). Moreover, further study is crucial for deeper knowledge of the genetic diversity among MDVs in Egypt and to reveal show potential patterns of virus transmission at a greater resolution by molecular characterization of the virus-based complete genome sequencing.

In the present study, REV-LTR was successfully amplified in 6 isolates, confirming the integration of REV-LTR into MDV circulating in Egypt. While the PCR analysis for identifying REV-LTR was performed on DNA extracted from a homogenized sample of distinct MDV pock lesions, it would be advantageous for subsequent research to employ primers that amplify segments of both the MDV and REV genomes as an additional confirmation. Similar results were reported by Zhang and Cui, 2005 who confirmed the integration of REV in the field strain of MDV circulated in China. Detection of REV in MDV-infected CAMs via immunostaining using anti-REV monoclonal antibodies is essential for further study.

The identified REV-LTR sequences showed a high degree of genetic identity (98.8%) with REV- 5′LTR integration identified in fowl poxvirus (FWPV) isolates identified previously in Dakahlia/2017 (MT251362.1) (Mosad et al., 2020) The results indicate the circulation of REV in the Egyptian poultry farms with the possibility of integration of REV in both viruses (FWPV and MDV). the identified REV-LTR sequences showed a high degree of identity (95–98.5%) with identified REV-LTR integrated in FWPV and GaHV from China, USA, South Africa, and Australia, suggesting potential transmission of the virus from these countries. The present findings provide interesting insights into the possible effects of infection with recombinant MDV on chickens, as they might lead to more severe forms of diseases that cause tumors and immunosuppression (Payne, 1998; Witter and Fadly, 2003; Du et al., 2022). To comprehend the effects of the REV-LTR insertions on the pathogenesis, pathogenicity, and insufficient vaccination protection against MDV, additional future research is recommended.

CONCLUSIONS

Our results indicate that MDV is circulating in poultry farms in Egypt. The genetic similarity of these viruses to Ethiopian, Indian and Chinese MDVs is another interesting finding of the current investigation. Importantly, 6 MDV isolates had REV-LTR insertions. Our study revealed the potential for co-infection of both MDVs and REV in the poultry farms in Egypt. Further research is required to determine the impact of REV -LTR insertions in MDV strains on the pathogenesis, virulence, and insufficient vaccine protection against MDVs in Egypt, given the paucity of information on the studied topic and the potential for coinfection of both MDVs and REV. Investigations on the epidemiology of these viruses in the Egyptian environment and the impact of REV-LTR insertion on the gradual acquisition of evolutionary traits over time in certain regions of MDV genomes is crucial as a future studies.

ACKNOWLEDGMENTS

The authors express their gratitude to the veterinarians and clinic directors for their invaluable support in supplying the data and facilitating sample collections throughout the duration of the study.

DISCLOSURES

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in the present study.

Footnotes

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.103722.

Appendix. Supplementary materials

mmc1.docx (23.8KB, docx)

REFERENCES

  1. Amin A., Aly M., El Sawy A., Tanious N., Khafagy A., Ahmed A.A.S. Seroepidemiological and virological studies on virus-induced tumors in chickens in Egypt. Vet. Med. J. 2001;49:237–247. [Google Scholar]
  2. Awad, A. M., 2002. Studies on Marek's disease in commercial broiler chickens. Ph.D. Thesis, Faculty of Veterinary. Medicine, Alexandria University, Egypt.
  3. Biggs P.M., Milne B.S. Use of the embryonating egg in studies on Marek's disease. Am. J. Vet. Res. 1971;32:1795–1809. [PubMed] [Google Scholar]
  4. Birhan M., Gelaye E., Ibrahim S.M., Berhane N., Abayneh T., Getachew B., Zemene A., Birie K., Deresse G., Adamu K., Dessalegn B., Gessese A.T., Kinde M.Z., Bitew M. Marek's disease in chicken farms from Northwest Ethiopia: gross pathology, virus isolation, and molecular characterization. Virol. J. 2023;20:45. doi: 10.1186/s12985-023-02003-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Boodhoo N., Gurung A., Sharif S., Behboudi S. Marek's disease in chickens: a review with focus on immunology. Vet. Res. 2016;47:119. doi: 10.1186/s13567-016-0404-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bulbula A., Borena B., Tadesse B., Aliy A., Negessu D. Isolation and Molecular Detection of Marek's disease virus from outbreak cases in chicken in South Western Ethiopia. Vet. Med. (Auckl). 2022;13:265–275. doi: 10.2147/VMRR.S376795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bulow V.V., Biggs P.M. Differentiation between strains of Marek's disease virus and turkey herpesvirus by immunofluorescence assays. Avian Pathol. 1975;4:133–146. doi: 10.1080/03079457509353859. [DOI] [PubMed] [Google Scholar]
  8. Burleson F.G., Chambers T.M., Wiedbrauk D.L. 1st ed. Academic press I; 1992. Virology, A laboratory Manual. [Google Scholar]
  9. Cannon R.M., Roe R.T. A.G.P.S.; 1982. Livestock Disease Surveys. A field manual for veterinarians. Australian Bureau of Animal Health. [Google Scholar]
  10. Cantello J.L., Anderson A.S., Morgan R.W. Identification of latency associated transcripts that map antisense to the ICP4 homolog gene of Marek's disease virus. J. Virol. 1994;68:6280–6290. doi: 10.1128/jvi.68.10.6280-6290.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chauhan R., Singh A., Singh P.K., Teja E.S., Varshney R. Dynamics of Marek's disease in poultry industry. Pharma Inov. 2021;10:80–83. [Google Scholar]
  12. Chacón R.D., Sedano-Herrera B., Alfaro-Espinoza E.R., Quispe W.U., Liñan-Torres A., De la Torre D., de Oliveira A., Astolfi-Ferreira C.S., Ferreira A.J.P. Complete genome characterization of Reticuloendotheliosis virus detected in chickens with multiple viral coinfections. Viruses. 2022;14:798. doi: 10.3390/v14040798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cho B.R. A simple in vitro differentiation between turkey herpesvirus and Marek's disease virus. Avian Dis. 1981;25:839–846. [PubMed] [Google Scholar]
  14. Cui N., Su S., Sun P., Zhang Y., Han N., Cui Z. Isolation and pathogenic analysis of virulent Marek's disease virus field strain in China. Poult. Sci. 2016;95:1521–1528. doi: 10.3382/ps/pew073. [DOI] [PubMed] [Google Scholar]
  15. Davidson I., Borovskaya A., Perl S., Malkinson M. Use of the polymerase chain reaction for the diagnosis of natural infection of chickens and turkeys with Marek's disease virus and reticuloendotheliosis virus. Avian Pathol. 1995;24:69–94. doi: 10.1080/03079459508419050. [DOI] [PubMed] [Google Scholar]
  16. Davidson I., Borenshtain H. In vivo events of retroviral long terminal repeat integration into Marek's disease virus in commercial poultry: detection of chimeric molecules as a marker. Avian Dis. 2001;45:102–121. [PubMed] [Google Scholar]
  17. Davidson I., Maray T., Malkinson M., Becker Y. Detection of Marek's disease virus antigens and DNA in feathers from infected chickens. J. Virol. Methods. 1986;13:231–244. doi: 10.1016/0166-0934(86)90017-0. [DOI] [PubMed] [Google Scholar]
  18. Demeke B., Jenberie S., Tesfaye B., Ayelet G., Yami M., Lamien C.E., Gelaye E. Investigation of Marek's disease virus from chickens in central Ethiopia. Trop. Anim. Health Prod. 2017;49:403–408. doi: 10.1007/s11250-016-1208-1. [DOI] [PubMed] [Google Scholar]
  19. Du X., Zhou D., Zhou J., Xue J., Cheng Z. Marek's disease virus and Reticuloendotheliosis virus coinfection enhances viral replication and alters cellular protein profiles. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.854007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. El-Kenawy A., Emad A., El-Tholoth M. Isolation and identification of marek's disease virus (MDV) from feather follicle epithelium and internal organs of diseased chickens in Dakahlia Governorate, Egypt. Mansoura. Vet. Med. J. 2019;20:6–11. [Google Scholar]
  21. El-Sawy A.M., Tantawi L.A., Naser G.F. Pathological studies on some forms of leucosis complex in laying hen farms. Pages 50–58 Proc. Fifth Sci. Cong., Fac. Veterinary Medicine; Assuit University, Egypt; 1992. [Google Scholar]
  22. Evans D.L., Patterson L.T., Beasley J.N. Pathological response of chicken embryo to an agent which causes acute leukosis (Marek's disease) Appl. Microbiol. 1971;21:321–326. doi: 10.1128/am.21.2.321-326.1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ewies S.S., Mady W.H., Hamad E.M., Arafa A.A., Tamam S.M., Madbouly H.M. Isolation and molecular characterization of Marek's disease virus from layer chickens in Egypt. J. Vet. Med. Res. 2021;27:182–190. [Google Scholar]
  24. Gall S., Kőrösi L., Cortes A.L., Delvecchio A., Prandini F., Mitsch P., Gimeno I.M. Use of real-time PCR to rule out Marek's disease in the diagnosis of peripheral neuropathy. Avian Pathol. 2018;47:427–433. doi: 10.1080/03079457.2018.1473555. [DOI] [PubMed] [Google Scholar]
  25. Gatherer D., Depledge D.P., Hartley C.A., Szpara M.L., Vaz P.K., Benkő M., Brandt C.R., Bryant N.A., Dastjerdi A., Doszpoly A., Gompels U.A., Inoue N., Jarosinski K.W., Kaul R., Lacoste V., Norberg P., Origgi F.C., Orton R.J., Pellett P.E., Schmid D.S., Spatz S.J., Stewart J.P., Trimpert J., Waltzek T.B., Davison A.J. ICTV virus taxonomy profile: Herpesviridae 2021. J. Gen. Virol. 2021;102:1673. doi: 10.1099/jgv.0.001673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hassanin O., Abdallah F., El-Araby I.E. Molecular characterization and phylogenetic analysis of Marek's disease virus from clinical cases of Marek's disease in Egypt. Avian Dis. 2013;57:555–561. doi: 10.1637/10337-082912-Reg.1. [DOI] [PubMed] [Google Scholar]
  27. Hussein H., Sultan H., El-Safty M. Pages 59–76 Proc. 6th Sci. Cong., Egy. Vet. Poul. Assoc. Cairo, Egypt. 2004. A very virulent plus Marek's disease virus (EgMD-C) associated with an acute transient paralysis and protection induced by bivalent vaccination against the isolated virus in broiler breeder chickens. [Google Scholar]
  28. Isfort R., Jones D., Kost R., Witter R., Kung H.J. Retrovirus insertion into herpesvirus in vitro and in vivo. Proc. Natl. Acad. Sci. USA. 1992;89:991–995. doi: 10.1073/pnas.89.3.991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Islam A., Walkden-Brown S.W. Quantitative profiling of the shedding rate of the three Marek's disease virus (MDV) serotypes reveals that challenge with virulent MDV markedly increases shedding of vaccinal viruses. J. Gen. Virol. 2007;88:2121–2128. doi: 10.1099/vir.0.82969-0. [DOI] [PubMed] [Google Scholar]
  30. Jones D., Brunovskis P., Witter R., Kung H.J. Retroviral insertional activation in a herpesvirus: transcriptional activation of US genes by an integrated long terminal repeat in a Marek's disease virus clone. J. Virol. 1996;70:2460–2467. doi: 10.1128/jvi.70.4.2460-2467.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Jones D., Isfort R., Witter R., Kost R., Kung H.J. Retroviral insertions into a herpesvirus are clustered at the junctions of the short repeat and short unique sequences. Proc. Natl. Acad. Sci. U S A. 1993;90:3855–3859. doi: 10.1073/pnas.90.9.3855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kaleta E.F., Docherty D.E. In: Pages 63–86 Infectious Diseases of Wild Birds. Nancy TJ, Bruce HD, Carter AT, editors. Blackwell Publishing; 2007. Avian herpesviruses. editors. [Google Scholar]
  33. Kalyani I.H., Tajpara M.M., Jhala M.K., Bhanderi B.B., Nayak J.B., Purohit J.H. Characterization of the ICP4 gene in pathogenic Marek's disease virus of poultry in Gujarat, India, using PCR and sequencing. Vet. Arhiv. 2010;80:683–692. [Google Scholar]
  34. Kost R., Jones D., Isfort R., Witter R., Kung H.J. Retrovirus insertion into herpesvirus: characterization of a Marek's disease virus harboring a solo LTR. Virology. 1993;192:161–169. doi: 10.1006/viro.1993.1018. [DOI] [PubMed] [Google Scholar]
  35. Kurokawa A., Yamamoto Y. Development of monoclonal antibodies specific to Marek disease virus-EcoRI-Q (Meq) for the immunohistochemical diagnosis of Marek disease using formalin-fixed, paraffin-embedded samples. J. Vet. Diagn. Invest. 2022;34:458–464. doi: 10.1177/10406387221080444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lebdah M.A., Nassif S.A., Shahein A.M., El-Basrey Y.F.H. Isolation and identification of very virulent strains of Marek's disease virus from MDV-vaccinated flocks in Egypt. Zagazig Vet. J. 2017;45:197–205. [Google Scholar]
  37. Li K., Gao H., Gao L., Qi X., Qin L., Gao Y., Xu Y., Wang X. Development of TaqMan real-time PCR assay for detection and quantitation of reticuloendotheliosis virus. J. Virol. Methods. 2012;179:402–408. doi: 10.1016/j.jviromet.2011.12.001. [DOI] [PubMed] [Google Scholar]
  38. Mescolini G., Baigent S.J., Catelli E., Nair V.K. Rapid, sensitive, and species-specific detection of conventional and recombinant herpesvirus of Turkeys vaccines using loop-mediated isothermal amplification coupled with a lateral flow device readout. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.873163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mikami T., Bankowski R.A. Pathogenetic and serologic studies of type 1 and type 2 plaque-producing agents derived rom Cal-1 strain of Marek's disease virus. Am. J. Vet. Res. 1971;32:303–317. [PubMed] [Google Scholar]
  40. Moore K.M., Davis J.R., Sato T., Yasuda A. Reticuloendotheliosis virus (REV) long terminal repeats incorporated in the genomes of commercial fowl poxvirus vaccines and pigeon poxviruses without indication of the presence of infectious REV. Avian Dis. 2000;44:827–841. [PubMed] [Google Scholar]
  41. Mosad S.M., El-Tholoth M., El-Kenawy A.A., Abdel-Hafez L.J.M., El-Gohary F.A., El-Sharkawy H., Elsayed M.M., Saleh A.A., Elmahallawy E.K. Molecular detection of Reticuloendotheliosis virus 5′ long terminal repeat integration in the genome of Avipoxvirus field strains from different avian species in Egypt. Biology. 2020;9:257. doi: 10.3390/biology9090257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Naito M., Ono K., Tanabe S., Doi T., Kato S. Detection in chicken and human sera of antibody against herpes type virus from a chicken with Marek's disease and EB virus demonstrated by the indirect immunofluorescence test. Biken J. 1970;13:205–212. [PubMed] [Google Scholar]
  43. Niewiadomska A.M., Gifford R.J. The extraordinary evolutionary history of the Reticuloendotheliosis viruses. PLoS Biol. 2013;11 doi: 10.1371/journal.pbio.1001642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Oluwayinka E.B., Otesile E.B., Oni O.O., Ajayi O.L., Dunn J.R. Molecular characterization and phylogenetic analysis of Marek's disease virus in chickens from Ogun State, Nigeria. Avian Pathol. 2023;52:401–411. doi: 10.1080/03079457.2023.2243838. [DOI] [PubMed] [Google Scholar]
  45. Osterrieder N., Kamil J.P., Schumacher D., Tischer B.K., Trapp S. Marek's disease virus: from miasma to model. Nat. Rev. Microbiol. 2006;4:283–294. doi: 10.1038/nrmicro1382. [DOI] [PubMed] [Google Scholar]
  46. Payne L.N., Venugopal K. Neoplastic diseases: Marek's disease, avian leukosis and reticuloendotheliosis. Rev. Sci. Tech. 2000;19:544–564. doi: 10.20506/rst.19.2.1226. [DOI] [PubMed] [Google Scholar]
  47. Payne L.N. Retrovirus-induced disease in poultry. Poult. Sci. 1998;77:1204–1212. doi: 10.1093/ps/77.8.1204. [DOI] [PubMed] [Google Scholar]
  48. Purchase H.G. Immunofluorescence in the study of Marek's disease. I. Detection of antigen in cell culture and an antigenic comparison of eight isolates. J. Virol. 1969;3:557–565. doi: 10.1128/jvi.3.6.557-565.1969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Reddy S.M., Izumiya Y., Lupiani B. Marek's disease vaccines: current status, and strategies for improvement and development of vector vaccines. Vet Microbiol. 2017;206:113–120. doi: 10.1016/j.vetmic.2016.11.024. [DOI] [PubMed] [Google Scholar]
  50. Ridgway A.A. Reticuloendotheliosis virus long terminal repeat elements are efficient promoters in cells of various species and tissue origin, including human lymphoid cells. Gene. 1992;121:213–218. doi: 10.1016/0378-1119(92)90124-8. [DOI] [PubMed] [Google Scholar]
  51. Schat KA. Isolation of Marek's disease virus: revisited. Avian Pathol. 2005;34:91–95. doi: 10.1080/03079450500059289. [DOI] [PubMed] [Google Scholar]
  52. Sheble, A., Barhouma, N., Saber, M.S., El-Assily, S., El-Sabbagh, A., Ibrahim, S.N., Allam, M.S., Sabban, M.S., Nafie, E., Almassy, K., Ahmed, A.A.S., 1973. Preliminary investigations on Marek's disease in Egypt. Page 41 Abstracts 11th Arab Vet. Cong., Cairo, Egypt.
  53. Silva R.F. Differentiation of pathogenic and non-pathogenic serotype 1 Marek's disease viruses (MDVs) by the polymerase chain reaction amplification of the tandem direct repeats within the MDV genome. Avian Dis. 1992;36:521–528.. [PubMed] [Google Scholar]
  54. Soliman K.N., El- Agroudi M.A., Nadim S., Abdilhalim M.I. The Occurrence of the neural type of the avian leukosis complex in Egypt. Br. Vet. J. 1954;110:271–277. [Google Scholar]
  55. Stamilla A., Messina A., Condorelli L., Licitra F., Antoci F., Lanza M., Loria G.R., Cascone G., Puleio R. Morphological and immunohistochemical examination of lymphoproliferative lesions caused by Marek's disease virus in breeder chickens. Animals. 2020;10:1280. doi: 10.3390/ani10081280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Teng M., Liu J.L., Luo Q., Zheng L.P., Yao Y., Nair V., Zhang G.P., Luo J. Efficient cross-screening and characterization of monoclonal antibodies against Marek's disease specific Meq oncoprotein using CRISPR/Cas9-gene-edited viruses. Viruses. 2023;15:817. doi: 10.3390/v15040817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Tulman E.R., Afonso C.L., Lu Z., Zsak L., Rock D.L., Kutish G.F. The genome of a very virulent Marek's disease virus. J. Virol. 2000;74:7980–7988. doi: 10.1128/jvi.74.17.7980-7988.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Witter R.L. Characteristics of Marek's disease viruses isolated from vaccinated commercial chicken flocks: association of viral pathotype with lymphoma frequency. Avian Dis. 1983;27:113–132. [PubMed] [Google Scholar]
  59. Witter R.L. The changing landscape of Marek's disease. Avian Pathol. 1998;27:46–53. [Google Scholar]
  60. Witter R.L., Calnek B.W., Buscaglia C., Gimeno I.M., Schat K.A. Classification of Marek's disease viruses according to pathotype: philosophy and methodology. Avian Pathol. 2005;34:75–90. doi: 10.1080/03079450500059255. [DOI] [PubMed] [Google Scholar]
  61. Witter R., Fadly A. Pages 517–536 In Diseases of Poultry. U.S. Department of Agriculture (USDA); 2003. Reticuloendotheliosis. [Google Scholar]
  62. WOAH . WOAH Terrestrial Manual, France; 2023. World Organisation for Animal Health, chapter 3.3.13: Marek's Disease; pp. 1–15.https://www.woah.org/fileadmin/Home/fr/Health_standards/tahm/3.03.13_MAREK_DIS.pdf Available online: Accessed on Feb. 2024. [Google Scholar]
  63. Woźniakowski G., Frant M., Mamczur A. Avian reticuloendotheliosis in chickens - an update on disease occurrence and clinical course. J. Vet. Res. 2018;62:257–260. doi: 10.2478/jvetres-2018-0036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Woźniakowski G., Samorek-Salamonowicz E., Kozdruń W. Occurrence of main Marek's disease genes during infection of chickens. Bull. Vet. Inst. Pulawy. 2010;54:123–127. [Google Scholar]
  65. Woźniakowski G., Samorek-Salamonowicz E., Kozdruń W. Sequence analysis of meq oncogene among Polish strains of Marek's disease. Pol. J. Vet. Sci. 2010;13:263–267. [PubMed] [Google Scholar]
  66. Woźniakowski G., Samorek-Salamonowicz E., Kozdruń W. Comparison of loop-mediated isothermal amplification and PCR for the detection and differentiation of Marek's disease virus serotypes 1, 2, and 3. Avian Dis. 2013;57:539–543. doi: 10.1637/10328-082012-ResNote.1. [DOI] [PubMed] [Google Scholar]
  67. Yehia N., El-Sayed H.S., Omar S.E., Erfan A., Amer F. Genetic evolution of Marek's disease virus in vaccinated poultry farms. Vet. World. 2021;14:1342–1353. doi: 10.14202/vetworld.2021.1342-1353. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zhang Z., Cui Z. Isolation of recombinant field strains of Marek's disease virus integration with reticuloendotheliosis virus genome fragments. Sci. China C. Life Sci. 2005;48:81–88. doi: 10.1360/03yc0270. [DOI] [PubMed] [Google Scholar]
  69. Zhuang X., Zou H., Shi H., Shao H., Ye J., Miao J., Wu G., Qin A. Outbreak of Marek's disease in a vaccinated broiler breeding flock during its peak egg-laying period in China. BMC Vet Res. 2015;11:157. doi: 10.1186/s12917-015-0493-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.docx (23.8KB, docx)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES