Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Mar 30;103(6):103706. doi: 10.1016/j.psj.2024.103706

Oligomeric proanthocyanidins ameliorates osteoclastogenesis through reducing OPG/RANKL ratio in chicken's embryos

Gengsheng Yu *,†,‡,1, Xiaohui Fu *,†,‡,1, Anqing Gong *,†,‡, Jianhong Gu *,†,‡, Hui Zou *,†,‡, Yan Yuan *,†,‡, Ruilong Song *,†,‡, Yonggang Ma *,†,‡, Jianchun Bian *,†,‡, Zongping Liu *,†,‡, Xishuai Tong *,†,‡,2
PMCID: PMC11040129  PMID: 38631227

Abstract

Skeletal disorders can seriously threaten the health and the performance of poultry, such as tibial dyschondroplasia (TD) and osteoporosis (OP). Oligomeric proanthocyanidins (OPC) are naturally occurring polyphenolic flavonoid compounds that can be used as potential substances to improve the bone health and the growth performance of poultry. Eighty 7-day-old green-eggshell yellow feather layer chickens were randomly divided into 4 groups: basal diet and basal diet supplementation with 25, 50, and 100 mg/kg OPC. The results have indicated that the growth performance and bone parameters of chickens were significantly improved supplementation with OPC in vivo, including the bone volume (BV), the bone mineral density (BMD) and the activities of antioxidative enzymes, but ratio of osteoprotegerin (OPG)/receptor activator of NF-κB (RANK) ligand (RANKL) was decreased. Furthermore, primary bone marrow mesenchymal stem cells (BMSCs) and bone marrow monocytes/macrophages (BMMs) were successfully isolated from femur and tibia of chickens, and co-cultured to differentiate into osteoclasts in vitro. The osteogenic differentiation derived from BMSCs was promoted treatment with high concentrations of OPC (10, 20, and 40 µmol/L) groups in vitro, but emerging the inhibition of osteoclastogenesis by increasing the ratio of OPG/RANKL. In contrary, the osteogenic differentiation was also promoted treatment with low concentrations of OPC (2.5, 5, and 10 µmol/L) groups, but osteoclastogenesis was enhanced by decreasing the ratio of OPG/RANKL in vitro. In addition, OPG inhibits the differentiation and activity of osteoclasts by increasing the autophagy in vitro. Dietary supplementation of OPC can improve the growth performance of bone and alter the balance of osteoblasts and osteoclasts, thereby improving the bone health of chickens.

Key words: oligomeric proanthocyanidins (OPC), osteoclastogenesis, osteoprotegerin (OPG), RANKL, chicken

INTRODUCTION

Skeletal disorders are one of the major factors affecting the growth and development of layer chickens, and exhibit several typical symptoms, such as ataxia, lameness, soft shell eggs, increased egg breakage rate, and even osteoporosis (OP) or bone fracture during the egg-laying period (Whitehead and Fleming, 2000; Szafraniec et al., 2022). Nutritional interventions are commonly used to alleviate bone diseases (Fleming, 2008), such as the dietary supplementation with calcium (Ca) or vitamin D3 (Saunders-Blades and Korver, 2014). However, the resorption or utilization of nutritional supplements by layer chickens is limited. Therefore, poultry farming should operate safer and more effective approaches to improve bone health by regulating bone metabolism.

In recent years, several plant extracts have been used as feed additives to improve the growth performance of livestock or poultry by increasing the resistance to diseases and the feed conversion ratio (Yang et al., 2017; Wu et al., 2019; Guo et al., 2021; Jamil et al., 2022). Oligomeric proanthocyanidins (OPC) as the plant derived extracts and is a polyphenolic flavonoid compound with the widely effects, including anti-inflammatory (Liu et al., 2017), antioxidant (Smeriglio et al., 2017), antibacterial (Nawrot-Hadzik et al., 2021), improves intestinal microbiota (Chen et al., 2023) and immunoregulation (Park et al., 2013). For example, OPC can restore the function of liver by reducing the deposition of fat and the cholesterol content of yolk and ovarian steroids, thereby indirectly improving the egg quality by augmenting antioxidant capacity (Barbe et al., 2020a). In addition, previous study has shown that daily oral administration of proanthocyanidins-rich grape seed extract (GSE) prevents bone loss of the lumbar vertebrae and the femur in ovariectomized (OVX) mice. Correspondingly, histological and histomorphometric analyses indicate that osteoclastogenesis is accelerated in the lumbar vertebrae of OVX mice, but GSE could counteract this transversion (Tenkumo et al., 2020). Proanthocyanidins extracted from red cranberry fruits as the potential therapeutic agent can treat the periodontitis through three possible mechanisms, including the inhibition of osteoclast differentiation and activity, bacterial and host-derived proteolytic enzymes and host inflammatory responses (Feghali et al., 2012). These studies indicate that plant extracts, especially the proanthocyanidins, have the positive effects in animal and may be attributed to the multiple regulatory mechanisms.

Nutritional regulation is an important principle for improving early growth, and especially the early bone development of layer chickens determines their later bone health (Johnsson et al., 2015). Physiological bone metabolism is constantly in dynamic equilibrium, including the bone formation mediated by osteoblast and the bone resorption mediated by osteoclast (Tong et al., 2020; van Gastel and Carmeliet, 2021). The growth and development of bones were destroyed when this balance is disrupted, leading to metabolic bone related diseases (Srivastava et al., 2022). Importantly, bone marrow mesenchymal stem cells (BMSCs) were first isolated from mice bone marrow in 1976 (Friedenstein, 1976). Thereafter, BMSCs are easily isolated from bone marrow cavity of animals and have the ability to differentiate into various cells, such as osteoblast, adipocyte, chondrocyte and myoblast. (Walmsley et al., 2016). Likewise, BMSCs were also successfully separated from bone marrow cavity of chicken, and was induced to differentiate into osteoblast, adipocyte and endothelial cell (Khatri et al., 2009; Bai et al., 2013).

BMSCs were co-cultured with bone marrow monocytes/macrophages (BMMs) to form osteoclasts and undergo the various steps including such as differentiation, maturation and activation (Varin et al., 2013; Takano et al., 2014). Osteoclasts are the unique cells with bone resorption, and their lysosomes can secrete acidic degrading enzymes such as catalase K (CTSK) and tartrate-resistant acid phosphatase (TRAP), which are subsequently transported to the bone resorption lacuna to degrade the bone matrix (Infante et al., 2019). Importantly, osteoclastogenesis is regulated by the “osteoprotegerin (OPG)/receptor activator of NF-κB (RANK) ligand (RANKL)/RANK” axis, which is the critical signal transduction pathway (Lacey et al., 2012). RANKL binds to the membrane receptor RANK to promote the formation and function of osteoclasts. OPG is a secreted glycoprotein that acts as a decoy receptor for RANKL and can competitively prevent the binding of RANKL to its receptor RANK, thereby blocking the intracellular signaling cascades to inhibit the osteoclastogenesis (Tsukasaki et al., 2020). Therefore, the dynamic equilibrium of OPG/RANKL ratio has considerable significance for maintaining osteoclastogenesis and even bone metabolism. Our previous study found that OPG inhibit osteoclastogenesis by promoting the fusion of lysosomes with autophagosome and AMP-activated protein kinase (AMPK) signaling pathway-mediated autophagy (Tong et al., 2020). In addition, late endosomal/lysosomal adaptor and mitogen activated protein kinase (MAPK) and mTOR activator (LAMTOR) is a scaffold protein complex and anchors on late endosomes/lysosomes (Lamberti et al., 2020). LAMTOR is not only a component of mTORC1 signaling, but also necessary for its lysosomal activation, and it also provides a scaffold for AMPK and MAPK signaling (Nada et al., 2009; Zhang et al., 2014; Liebscher et al., 2023). However, lysosomes as important organelles involved in autophagy and how to specific action in OPG-inhibited osteoclastogenesis is still unclear, including whether they have a regulatory relationship with AMPK.

In this study, the regulatory roles of OPC on bone metabolism in femur and tibia of chickens was evaluated by the ratio of OPG/RANKL in vivo or chicken's embryos in vitro. Next, the inhibitory effects of OPG on osteoclastogenesis derived from chicken's embryos were further explored in vitro. Overall, this study aimed to determine the effects of OPC on bone metabolism during growth and development of layer chickens, and may be provided the novel insights for nutritional action of OPC through in vivo experiments and in vitro regulatory mechanisms.

MATERIALS AND METHODS

Animals and Experimental Design

Total of 80 one-day-old green-eggshell yellow feather layer chickens were purchased from the Yangzhou Xianglong Poultry Industry Development Co. Ltd. (Yangzhou, Jiangsu, China). All of chickens were randomly divided into 4 groups (20 per group), and then were placed in a comfortable temperature with the basal diet and water ad libitum. The ingredient compositions of basic diet to see the Table 1. All of experiments were approved by the Animal Care and Use Committee of Yangzhou University (SYXK [Su] 2021-0027). All of treatments was followed after 5 d of adaptive breeding: only basal diet group and basal diet supplementation with the different concentration of OPC (25, 50, and 100 mg/kg; Shanghai Yuanye Biotechnology Co. Ltd., Shanghai, China) groups. The light was kept for 18 h/d, and the dark period was gradually increased to 6 h maintaining for 30 d, and until the end of the experiment.

Table 1.

Ingredient compositions and nutritional percentage of basal diet.

Basal ingredients Value (%) Nutritional compositionb Value (%)
Corn 66 Crude protein 20
Soybean meal 20 Methionine 0.5
Feather meal 1 Ca 1.2
Fish meal 1 Total P 1.5
CaCO3 7 Crude fiber 6
Premixa 5 NaCl 0.8
Open in a new tab
a

The premix contains the nutrients of the diet per kilogram, as following: vitamin A of 8,000 IU, vitamin D3 of 2,000 IU, vitamin E of 20 IU, vitamin K3 of 0.5 mg, vitamin B1 of 1.5 mg, vitamin B2 of 4 mg, vitamin B6 of 2 mg, niacin of 30 mg, folic acid of 0.5 mg, pantothenic acid of 10 mg, biotin of 0.15 mg, chloride choline of 500 mg, sodium chloride of 2500 mg, Cu of 20 mg, Fe of 70 mg, Mn of 100 mg, Zn of 70 mg and Se of 0.5 mg.

b

The table of feed composition and nutritional level were calculated from the feed database of China.

Collection of Blood and Bone Samples of Femur and Tibia From Chickens

All chickens were starved for 12 h before the end of the experiment, but provided drink water ad libitum. All of the chickens were weighed and were humanely euthanized. Blood samples were collected in 15 mL centrifuge tubes (without anticoagulant). Then, the serum samples were separated using the centrifugation after standing for 15 min at room temperature (25°C), divided into 1.5 mL centrifuge tubes for further biochemical analysis, and stored at –80°C. In addition, the bone samples of femur and tibia were separated after remove of the skin and muscle, and the bone were weighed, and the length were measured for further testing. The bone samples were stored at –80°C.

Analysis of Growth Performance in Chickens

The daily feed consumption of chickens was recorded. The average daily feed intake (ADFI), the average daily gain (ADG), the feed conversion (F/G) and the bone coefficient were calculated, and their following the formulas: ADFI (g/d) = total feed intake/d/chickens’ number, ADG = ([terminal weight – original weight])/ d/chickens’ number, F/G = total feed intake/ (terminal weight – original weight), and bone coefficient = bone weight/body weight.

Measurement of Ca, P, and Trace Elements of Bone From Chickens

Bone tissue was sliced into petty pieces, and cleaned with PBS. The bone pieces were dried at a high temperature (80°C) for 24 h as previously described (Tong et al., 2022). The dry bone pieces were ground into powder. Weigh 0.2 mg of sample powder was transferred into a digestion tube for further determination using a Microwave digestion instrument (Anton Paar [Shanghai] Trading Cd., Ltd.; Shanghai, China). The tubes were supplemented with 4 mL guaranteed grade of nitric acid (HNO3) solution, and then samples were digested for executing a gradual heating method: 90°C, 120°C up to 170°C for 25 min as previous described (Tong et al., 2022). After digestion and colling down, all tubes were diluted into 10 mL ultrapure water per tube at room temperature (25°C). The content of Ca, P, iron (Fe), magnesium (Mg), copper (Cu) and manganese (Mn) were measured by the PinAAcle 900F flame atomic absorption spectrometer (PerkinElmer Inc.; Waltham, MA).

Estimation of Antioxidant Enzymes, the Activities of ALP and TRAP in Serum from Chickens

The activities of total antioxidant capacity (T-AOC), catalase (CAT), glutathione peroxidase (GSH-Px) and the level of alkaline phosphatase (ALP) and TRAP in serum of chickens were determined using corresponding commercial kits based on the manufacturers’ instructions (Nanjing Jiancheng Bioengineering Co., Ltd.; Nanjing, Jiangsu, China).

Enzyme-Linked Immunosorbent (ELISA) Profiling

The levels of OPG, RANKL and osteocalcin (OCN) in serum of chickens were measured using ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd.; Shanghai, China) according to the correspondingly manufacturers’ instructions. Briefly, set the standard (50 μL standard sample) and blank (without adding samples and enzyme-labeling reagents) plate wells as the negative and blank control respectively, and the samples (10 μL sample is diluted in 40 μL dilution per well) of serum or cultural supernatant (in vitro cell research) were transferred into the plates of precoated with for OPG, RANKL and OCN specific antibodies at room temperature (25°C). Then, recognition antigen labeled by horseradish peroxidase (HRP) was added. In addition to blank plate wells, 100 μL enzyme-labeling reagents were added to each well for incubation for 60 min at 37°C. The liquid was discarded and then washed with phosphate-buffered saline (PBS). The combined HRP catalyzes tetramethyl benzidine (TMB) into blue after evade the light preservation for 15 min at 37°C and turns yellow by the stop solution. Blank group set to zero, the reaction has absorption peak under 450 nm wavelength, and the absorbance of each well was determined using a BioTek SynergyHTX Multimode Reader (Winooski, Vermont).

Hematoxylin and Eosin (HE) Staining of Tibia from Chickens

The samples of tibia were immersed in EDTA solution for decalcification of 1 wk, and then for gradient dehydration using the different concentrations of ethanol solution. Next, the proximal bone of tibia was embedding with paraffin for further slicing with thickness of 5 μm. The slices were stained with HE staining kit (Servicebio Technology Co., Ltd.; Wuhan, Hubei, China) for further transferring to the glass slide as previous reported (Tong et al., 2023). Images were captured using a normal inverted microscope (Leica; Wetzlar, Germany).

TRAP and ALP staining of Tibia from Chickens

The slices of tibia were fixed in 4% paraformaldehyde solution for 10 min at room temperature (25°C), and then stained using a TRAP staining kit (Sigma‐Aldrich; St. Louis, MI) according to the correspondingly manufacturers’ instructions. TRAP-positive multinucleated cells (≥ 3 nucleus) were considered as the osteoclasts using a TRAP staining kit according to the correspondingly manufacturers’ instructions. In addition, the slices were stained using an ALP staining kit (Beyotime Biotech. Inc.; Shanghai, China) according to the correspondingly manufacturers’ instructions. Images were captured using a normal inverted microscope (Leica; Wetzlar, Germany).

Immunohistochemistry

Immunohistochemistry for CTSK and Runt-related transcription factor 2 (Runx2), OPG and RANKL were performed as previous study (He et al., 2020). The slices from tibia were incubated in oven at 52°C for 1 h, and then dewaxed in dimethylbenzene for 3 times, further hydration using the correspondingly ethanol solution at different concentrations (70% to 100%). Next, the slices were incubated with 1% hydrogen peroxide (H2O2) for 10 min at room temperature (25°C). The slices were incubated with primary antibodies against the CTSK, Runx2, OPG and RANKL at 4°C overnight. After the end of incubation, secondary antibodies were incubated for 30 min at 37°C. Finally, the antigen-antibody complexes were obtained by 3,30-diaminobenzidine (DAB). Images were captured using a normal inverted microscope (Leica; Wetzlar, Germany).

Observation of Trabecular Bone Microstructure of Femur from Chickens

Bone microstructure of femur from chickens was estimated in different treatments using a micro-computed tomography (Micro-CT; Skyscan1276 X-Ray Microtomography; Bruker Corporation; Karlsruhe, Germany). The methods as following: the resolution ratio (10.2 microns per pixel) was selected to the regions of interests (ROIs), containing the voltage 70 Kv and electricity 200 μA. The 3D image reconstruction was performed using N-RECO software. Bone volume (BV) and bone mineral density (BMD) were analyzed using CT-AN software.

Isolation of BMSCs and BMMs of Femur and Tibia from Chicken Embryos In Vitro

The femur and tibia from 18-days-old chicken embryos were separated, and then the muscle tissue surrounding the bones were removed. The bone marrow cavity was flushed with alpha-minimum essential medium (α-MEM; Gibco; Waltham, MA) without heat-inactivated fetal bovine serum (FBS; Nanjing Ozfan Biotechnology Co., Ltd.; Nanjing, Jiangsu, China). Cell clumps were filtered by the 300-mesh strainer to new tube, and centrifuged at 1200 r/min for 5 min. The supernatant was discarded, and then α-MEM (containing 10% FBS) was resuspended. Next, cells were inoculated with the diameter of 100 mm dish at 37°C with 5% CO2. The unattached BMMs were removed (or collected) and/or to restore the new dishes preparing to fuse with BMSCs for osteoclastogenesis. The adherent cells as the BMSCs were growing to 80 to 90% to record as first generation, and until proliferate to third generation for subsequent experiments.

Osteoclastogenesis

For determination of osteoclastogenesis in vitro, BMMs were seeded into cell plates supplementation with α-MEM (containing 10% FBS) fusing with BMSCs at the ratio of BMMs: BMSCs to 100:1. The medium was changed every 2 d. TRAP-positive multinucleated cells (≥ 3 nuclei) were considered as the osteoclasts using a TRAP staining kit according to the corresponding manufacturers’ instructions as previously reported (Tong et al., 2020). Images were captured using a normal inverted microscope (Leica; Wetzlar, Germany).

Detection of Cell Viability of BMSCs

BMSCs were seeded into 96-well plates (the cell density at 5 × 103 per well). BMSCs were incubated with different concentration of OPC (0, 2.5, 5, 10, 20, 40, and 80 µmol/L) for 24h, or were incubated with 10 µmol/L OPC for different times (0, 6, 12, 24, and 48 h). Cell viability of BMSCs was measured using a Cell Counting Kit-8 kit (Nanjing Vazyme Biotech Co., Ltd., Nanjing, Jiangsu, China) according to the correspondingly manufacturers’ instructions.

Immunoblotting

Bone samples were pulverized into pieces in liquid nitrogen, and splitting in a 250 μL centrifuge tube with RIPA lysis buffer (New Cell & Molecular Biotech Co., Ltd.; Suzhou, Jiangsu, China). In addition, cells were crushed and treated with RIPA lysis buffer, to release the cellular protein. Total protein was extracted using a lysis buffer with the inhibitor of protease or phosphatase. The concentration of each group was adjusted using the BCA protein assay kit as previous described (Gu et al., 2015; Tong et al., 2022). Equal amounts of denatured protein were divided into each tube. The protein samples were separated by 10 to 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels. At the end of electrophoresis, the gels were transferred onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% non-fat milk buffer for 2 h at room temperature (25°C). Then, the membranes were incubated with the primary antibodies against collagen type I alpha 1 (COL1A1), Runx2, osteopontin (OPN), OCN, OPG and RANKL (Abclonal Technology Co., Ltd.; Wuhan, Hubei, China) at dilution rate of 1:500; TRAP, CTSK, and c-Fos (Abcam plc.; Cambridge, England) at dilution rate of 1:1,000; p-AMPKα (Thr172), AMPKα, Beclin1, microtubule-associated protein 1A/1B-light chain 3 (LC3), p62, LAMTOR1, Rab7 and β-actin (Cell Signaling Technology, Inc.; Danvers, MA) at a dilution rate of 1:1,000 for 4°C overnight. The membranes were washed with tris-buffered saline solution with Tween-20 (TBST). Next, the membranes were incubated with the secondary antibodies against the HRP-conjugated goat antirabbit IgG and HRP-conjugated goat antimouse IgG at dilution rate of 1:5,000 (Jackson ImmunoResearch Inc.; West Grove, PA) for 2 h at room temperature (25°C). Finally, the membranes were detected with chemiluminescence (ECL) kit using a Tanon-5200 ECL chemiluminescent imaging system (Shanghai, China). Correspondingly, the size of blot band was quantitative analyzed for statistical calculation.

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Total RNA of bone samples and cell samples were extracted using TRIzol reagent for solubilization and purification (Thermo Fisher Scientific Inc.; Waltham, MA) as previously reported (Gu et al., 2015). Pure RNA was reverse transcribed to cDNA using a HiScript Q RT SuperMix for qPCR (+gDNA wiper) kit (Nanjing Vazyme Biotech Co., Ltd.; Nanjing, Jiangsu, China). All primer sequences (Table 2) were used to qRT-PCR. The cDNA templates were amplified using a Hieff qPCR SYBR Green Master Mix kit (Yeasen Biotechnology Co., Ltd.; Shanghai, China). The reaction methods were as follows: 95°C for 30 s; 40 cycles of 95°C for 5 s, 60°C for 34 s; and 60°C for 15 s. The mRNA expression of the target genes (OPG and RANKL) was calculated using the comparative threshold cycle method (2−ΔΔCt) method, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was correspondingly used as the housekeeping gene for normalization.

Table 2.

The primer sequences were used for qRT-PCR.

Gene name Primer sequences (5–3′) Gene number Length (bp)
OPG Forward: CTGCACGCTTGTGCTCTTGG NM_001033641.2 90
Reverse: GATGTCCCCGGGTCGTAATG
RANKL Forward: ACAAACAGGGCAGGGCAGAAAC NM_001083361.2 90
Reverse: TTTGCTGTCTCAGGGTCAGAATGC
GAPDH Forward: ATGGCATCCAAGGAGTGA NM_204305.2 141
Reverse: GGGAGACAGAAGGGAACAG
Open in a new tab

Immunofluorescence

Cells were fixed in 4% paraformaldehyde solution for 15 min at room temperature (25°C). Cells were permeabilized with 0.1% Triton X-100 solution for 10 min. Cells were washed with PBS on 3 times and incubated with 5% BSA blocking buffer for 30 min at room temperature (25°C). Then incubated with primary antibodies against LC3, LAMTOR1 and AMPK at 4°C overnight. Remove the primary antibodies and cells were washed with PBS on 3 times. Next, cells were incubated with secondary antibodies to Alexa Fluor 488-labeled Goat Anti-Rabbit IgG (H+L) and Cy3-labeled Goat Anti-Mouse IgG (H+L) (Beyotime Biotech. Inc.; Shanghai, China) to avoid the light for 2 h at room temperature (25°C). Cells were washed with PBS on 3 times. The nuclei were stained using diamidino-2-phenylindole (DAPI) solution for 10 min at room temperature (25°C). Images were captured using a TCS SP8 STED high-resolution laser confocal microscope (Leica; Wetzlar, Germany).

Statistical Analyses

All of experimental data were analyzed using a method of one-way analysis of variance (ANOVA) by SPSS 25.0 (IBM SPSS Inc., Chicago, IL). All of quantitative data are presented as the means ± SD. P < 0.05 and P < 0.01 indicated a significant and highly significant difference respectively, and ns represent as P > 0.05. All of experiments were performed in triplicate.

RESULTS

Effects of OPC on the Growth Performances and the Microstructure of the Bone of Chickens

The growth performances of bone of chickens are shown in Table 3, including original weight, terminal weight, ADFI, ADG, F/G and the lengths of femur and tibia (Figure 1A). In addition to a decrease of F/G, terminal weight, ADFI, ADG, and the lengths of femur and tibia supplementation with dietary OPC (25, 50, and 100 mg/kg) groups were increased compared with 0 mg/kg OPC group. However, the tibia coefficient and femur coefficient were no significant (P > 0.05) difference (Figure 1B). Next, the content of Ca, P, and trace elements (Fe, Mg, Cu, and Mn) of femur in supplementation with dietary 100 mg/kg OPC group were significant (P < 0.05 or P < 0.01) increased compared with 0 mg/kg OPC group, but 25 and 50 mg/kg OPC groups have no significant (P > 0.05) difference except for the increase of Mg content in 50 mg/kg OPC group (Figures 1C–1E). To analyze the microstructure of femoral distal trabeculae, the three-dimensional (3D) images of the microstructure of bone trabeculae were captured supplementation with/without dietary 50 mg/kg OPC (Figure 1F). Correspondingly, BV and BMD in the 50 mg/kg OPC group were significantly (P < 0.05 or P < 0.01) increased compared with 0 mg/kg OPC group (Figure 1G). Next, the structure of the bone was observed by HE staining, the results showed that in the experimental group with 50/mg OPC, there was no significant thickening of the trabecular thickness, the structure of bone matrix was dense and uniformly colored, and there was no difference compared with the control group, but the number of new trabeculae and cells of the bone marrow were higher than those in the control group (Figure 1H). These results have showed that dietary addition of OPC can improve the growth performance of bone by regulating the microstructure of bone in chickens.

Table 3.

Effects of OPC on the growth performance of bone of chicks.

Items 0 mg/kg 25 mg/kg 50 mg/kg 100 mg/kg
Original weight (g) 47.83 ± 3.31 47.50 ± 3.83 50.67 ± 4.80 52.00 ± 5.29
Terminal weight (g) 310.67 ± 7.74 327.12 ± 8.47 337.50 ± 4.68 334.67 ± 8.89
ADFI (g/chick/d) 19.86 20.02 21.18 21.17
ADG (g/chick/d) 8.76 9.32 9.56 9.42
F/G 1.51 1.43 1.48 1.50
Tibia length (cm) 6.34 ± 0.20 6.39 ± 0.19 6.55 ± 0.16 6.42 ± 0.16
Femur length (cm) 4.54 ± 0.16 4.56 ± 0.21 4.74 ± 0.17 4.66 ± 0.16
Open in a new tab

Figure 1.

Figure 1

Open in a new tab

The effects of OPC on the growth of bone in layer chickens. (A) Comparison of the morphology of the femur and tibia in layer chickens. (B) The bone coefficient of femur and tibia were measured. (C–E) The content of Ca, P, Fe, Mg, Cu, and Mn of femur were determined by atomic absorption spectroscopy. The microstructure and trabecular morphology of femur (F) and the quantitative analysis of BV and BMD (G) were determined by Micro-CT in layer chickens. (H) The structure of bone tissue was observed by HE staining. Scale bar = 1000 μm. *P < 0.05, ⁎⁎P < 0.01 or ns represent P > 0.05.

Effects of OPC on Antioxidant, Activities of TRAP and ALP, and the Levels of OCN, OPG, and RANKL of Serum From Chickens

To explore the effects of OPC on antioxidant enzymes (T-AOC, CAT and GSH-Px) of serum in chickens, found that the activities of T-AOC, CAT, and GSH-Px were significant (P < 0.05 or P < 0.01) increased supplement with dietary OPC (25, 50, and 100 mg/kg) groups compared with 0 mg/kg OPC group (Figure 2A). Correspondingly, the level of OCN and the activities of TRAP and ALP in serum were significant (P < 0.05 or P < 0.01) increased (Figure 2, Figure 2). Next, the levels of OPG and RANKL in serum were significant (P < 0.05 or P < 0.01) increased supplement with dietary OPC (25, 50, and 100 mg/kg) groups compared with 0 mg/kg OPC group (Figure 2D), but the ratio of OPG/RANKL was significantly (P < 0.01) decreased (Figure 2E). In addition, TRAP and ALP staining suggested that the addition of OPC to the diet increased the number of osteoclasts and osteoblasts in the bones of chickens, the brown-yellow color is darkened (Figure 2, Figure 2). Next, the positive expression of OPG and RANKL proteins in supplement with dietary 50 mg/kg OPC group was higher using the immunohistochemical analysis compared with 0 mg/kg OPC group, but the protein expression of OPG was also correspondingly attenuated (Figure 2, Figure 2). These results have showed that dietary supplementation with OPC could improve the antioxidant capacity, bone specific enzymes of serum and regulate the ratio of OPG/RANKL.

Figure 2.

Figure 2

Open in a new tab

The effects of OPC on the biochemical parameter of serum and bone in layer chickens. (A) The activities of T-AOC, CAT and GSH-Px were estimated by ELISA kit. (B) The level of OCN was calculated by ELISA kit. (C) The activities of TRAP and ALP were measured by ELISA kit. (D) The levels of OPG and RANKL were evaluated by ELISA kit. (E) The ratio of OPG/RANKL was calculated. *P < 0.05, ⁎⁎P < 0.01 or ns represent P > 0.05. (F and G) The morphology of osteoclasts and osteoblasts were observed using TRAP and ALP staining, respectively. Scale bar = 50 μm. (H and I) The distribution of OPG and RANKL in bone were observed by immunohistochemistry. Scale bar = 50 μm.

Effects of OPC on Expression of Bone-related Markers in Femur From Chickens

As shown in Figure 3, the expression of COL1A1, Runx2, OPN, OCN, c-Fos, CTSK, TRAP and RANKL were increased supplementation with dietary OPC (25, 50, and 100 mg/kg) groups compared with 0 mg/kg OPC group, but the expression of OPG was decreased (Figure 3, Figure 3). Next, the positive distribution of CTSK and Runx2 in supplement with dietary 50 mg/kg OPC group was higher using the immunohistochemical analysis compared with 0 mg/kg OPC group (Figure 3, Figure 3). These results have showed that OPC could promote the expression of key proteins of osteogenesis as well as RANKL expression, which is a critical regulator for osteoclastogenesis.

Figure 3.

Figure 3

Open in a new tab

The effects of OPC on the expression of bone-related proteins in layer chickens. (A and C) The expression of COL1A1, Runx2, OPN, OCN, c-Fos, CTSK, TRAP, OPG, and RANKL were detected by western blot. (B and D) The distribution of CTSK and Runx2 in bone were observed by immunohistochemistry. Scale bar = 50 μm.

Effects of OPC on Osteogenesis of BMSCs From Chickens In Vitro

The primary BMSCs were isolated from the femur and tibia from chicken embryos, and then were cultured using α-MEM with or without OPC supplements in vitro (Figures 4A and 4B). First, cell viability of BMSCs was significant (P < 0.05) increased treatment with 10 µmoL/L OPC compared with 0 µmoL/L OPC group, but 40 and 80 µmoL/L OPC groups have significant (P < 0.05 or P < 0.01) decreased (Figure 4C). Furthermore, cell viability of BMSCs was no not significant (P > 0.05) treatment with 10 µmoL/L OPC in different time (6, 12, and 24 h) compared with 0 h group, but 48 h OPC group has significant (P < 0.05) decreased (Figure 4D). The morphology of BMSCs was not affected by different concentrations of OPC for 24 h (Figure 4E). Next, the expression of osteogenesis-related markers (COL1A1, Runx2, and OCN) were significant (P < 0.05 or P < 0.01) increased treatment with different concentrations of OPC (2.5, 5, 10, 20, and 40 µmoL/L) compared with 0 µmoL/L OPC group (Figure 4, Figure 4). These data showed that the expression of osteogenesis-related proteins was increased treatment with OPC in vitro.

Figure 4.

Figure 4

Open in a new tab

The effects of OPC on BMSCs’ osteogenesis of chicken embryos in vitro. (A) The brief schematic diagram shows the separation of BMSCs from the embryos of femur and tibia of chickens in vitro. (B) The primary BMSCs were visualized using a microscope. (C and D) The viability of cells was measured treatment with different concentration of OPC and at different time points, respectively. (E) The morphological changes of BMSCs were observed using a microscope. Scale bar = 100 μm. (F and G) The expression of COL1A1, Runx2, and OCN were detected treatment with different concentration of OPC. *P < 0.05, ⁎⁎P < 0.01 or ns represent P > 0.05.

Effects of OPC on Osteoclastognesis of BMSCs Fusing With BMMs From Chickens In Vitro

The primary osteoclast was achieved by fusing BMSCs with BMMs of the femur and tibia of chicken embryos, and then they were incubated with/without OPC in vitro (Figures 5A and 5B). The morphology of positive-TRAP osteoclasts was stained using a TRAP staining kit treatment with different concentration (2.5, 5, 10, 20 µmoL/L) of OPC, and have no significant difference (P > 0.05) compare with 0 µmoL/L OPC group, but 40 µmoL/L OPC group has significant (P < 0.01) decreased (Figure 5, Figure 5). Next, the expression of c-Fos and CTSK were significant (P < 0.05) decreased treatment with 40 µmoL/L OPC compare with 0 µmoL/L OPC group, but the expression of c-Fos in 10 µmoL/L OPC was significant (P < 0.05) increased (Figure 5E). However, the expression of c-Fos and CTSK were significant (P < 0.05 or P < 0.01) increased treatment with 5 and 10 µmoL/L OPC compare with 0 µmoL/L OPC group, but the expression of c-Fos in 2.5 µmoL/L OPC group was significant (P < 0.05) decreased and the expression of CTSK was significant (P < 0.01) increased (Figure 5F). These results have indicated that low concentrations of OPC could promote osteoclastogenesis of chickens in vitro.

Figure 5.

Figure 5

Open in a new tab

The effects of OPC on osteoclastognesis from the fusion BMSCs with BMMs of chicken embryos in vitro. (A) The brief schematic diagram shows the process for the osteoclastognesis from the co-culture of primary BMSCs and BMMs of chicken embryos in vitro. (B) The osteoclasts were captured using a microscope. (C and D) The morphology of osteoclasts was observed by TRAP staining, and the number of TRAP-positive osteoclasts were calculated. Scale bar = 100 μm. (E and F) The expression of c-Fos and CTSK were detected treatment with different concentration of OPC. *P < 0.05, ⁎⁎P < 0.01 or ns represent P > 0.05.

Effects of OPC on BMSCs of Chickens Through the OPG/RANKL Signaling In Vitro

To explore the effects of OPC on the OPG/RANKL signaling in BMSCs of chicken embryos in vitro, the levels of OPG and RANKL in supernatant of culture medium were detected after treatment with different concentrations of OPC for 24 h. The levels of OPG and the ratio of OPG/RANKL were significant (P < 0.01) increased treatment with different concentrations of OPC (10, 20, and 40 µmoL/L) compared with 0 µmoL/L OPC group, but the ratio of OPG/RANKL was significant (P < 0.01) decreased (Figure 6A). However, the level of RANKL was significant (P < 0.01) increased treatment with 5 µmoL/L OPC compared with 0 µmoL/L OPC group, but the ratio of OPG/RANKL was significant (P < 0.05) decreased (Figure 6B). Correspondingly, the mRNA levels of OPG and RANKL were significant (P < 0.05 and P < 0.01) increased treatment with different concentrations of OPC (2.5, 5, 10, 20, and 40 µmoL/L) compared with 0 µmoL/L OPC group. However, the ratio of OPG/RANKL was significant (P < 0.05) decreased treatment with different concentrations of OPC (2.5, 5, and 10 µmol/L) compared with 0 µmoL/L OPC group, but was increased in different concentrations of OPC (10, 20, and 40 µmoL/L) groups (Figure 6, Figure 6). Finally, the protein expression of OPG was significant (P < 0.01) increased treatment with 40 µmoL/L OPC group compared with 0 µmoL/L OPC group, but the expression of OPG was decreased in 10 µmol/L OPC group. The ratio of OPG/RANKL was significant (P < .05) increased treatment with 40 µmoL/L OPC group compared with 0 µmol/L OPC group, but the ratio of OPG/RANKL was significant (P < 0.05) decreased (Figure 6E). The protein expression of OPG was significant (P < 0.01) decreased treatment with different concentrations of OPC (5 and 10 µmoL/L) compared with 0 µmoL/L OPC group, but the protein expression of RANKL was significant (P < 0.05) increased treatment with OPC (2.5 and 5 µmol/L) groups. The ratio of OPG/RANKL was significant (P < 0.05) decreased treatment with OPC (5 and 10 µmoL/L) compared with 0 µmol/L OPC group (Figure 6F). These results have showed that OPC could regulate osteoclastogenesis of chickens by regulating the OPG/RANKL ratio.

Figure 6.

Figure 6

Open in a new tab

The effects of OPC on the OPG/RANKL signaling of BMSCs of chicken embryos in vitro. (A and B) The levels of OPG and RANKL in the supernatant of culture medium and the ratio of OPG/RANKL were measured treatment with different concentration of OPC. (C and D) The mRNA levels of OPG and RANK and the ratio of OPG/RANKL were calculated treatment with different concentration of OPC. (E and F) The expression of OPG and RANKL were detected treatment with different concentration of OPC. *P < 0.05, ⁎⁎P < 0.01 or ns represent P > 0.05.

Effects of OPG on Osteoclastogenesis From Chickens By Promoting Autophagy In Vitro

Next, to investigate the effects of OPG on osteoclastogenesis of chickens in vitro, we found that the number of TRAP-positive osteoclasts was significant (P < 0.05 or P < 0.01) reduced treatment with different concentrations of OPG (20, 40, and 80 ng/mL) compared with 0 ng/mL OPG group (Figure 7A), and the expression of TRAP and CTSK were significant (P < 0.05 or P < 0.01) decreased in a dose-dependent manner (Figure 7B). The co-localization of LAMTOR1 with LC3 or AMPK was observed during OPG-inhibited osteoclastogenesis (Figure 7, Figure 7). Furthermore, the expression of Beclin1, LC3-II, LAMTOR1, and the phosphorylation of AMPKα (Thr172) were significant (P < 0.05 or P < 0.01) increased treatment with different concentrations of OPG (20, 40, and 80 ng/mL) compared with 0 ng/mL OPG group, but the expression of p62 and Rab7 were decreased (Figure 7, Figure 7). These results have suggested that OPG can inhibit osteoclastogenesis of chickens by enhancing autophagy.

Figure 7.

Figure 7

Open in a new tab

The effects of OPG on the activity of osteoclasts of chickens by activating the autophagy in vitro. (A) The morphology and the number of TRAP-positive osteoclasts were measured treatment with different concentration of OPG (0, 20, 40, and 80 ng/mL). Scale bar = 100 μm. (B) The expression of TRAP and CTSK were detected treatment with different concentration of OPG (0, 20, 40, and 80 ng/mL). (C) The immunofluorescence of LC3 and LAMTOR1 were used to observe the co-localization in osteoclasts of chickens. (D) The expression of Beclin-1, LC3Ⅱ, and p62 were detected treatment with different concentration of OPG (0, 20, 40, and 80 ng/mL). (E) The immunofluorescence of AMPK and LAMTOR1 were used to observe the co-localization in osteoclasts of chickens. (F) The phosphorylation of AMPKα (Thr172) and the expression of LAMTOR1 and Rab7 were detected treatment with different concentration of OPG (0, 20, 40, and 80 ng/mL). *P < 0.05, ⁎⁎P < 0.01 or ns represent P > 0.05.

DISCUSSION

High-density feeding can bring higher economic benefits to poultry farming, but there are still generated a series of potential health issues in layer chickens, such as skeletal disorders (Fleming, 2008; Li et al., 2015; Petrik et al., 2015; Zhang et al., 2020). The bone metabolism of female chickens is unique, mainly result of medullary bone is a storage region for Ca production in eggshell (Johnsson et al., 2015). However, skeletal disorders seem inescapable in highly productive caged layer chickens. The loss of bone density and fractures of layer chickens are serious problems affecting their health, and may worsen due to the pressure of high egg production and rapid growth of bone, even increasing the risk of death, disability, and pain caused by bone fractures (Whitehead, 2004a). These indicates that skeletal disorders are an important aspect that cannot be ignored during the production of layer chickens.

Plant extracts as a classification of botanicals derived from raw plant materials, such as essential oils and oleoresins, and also contain another category of nature-identical compounds (NIC) including chemically synthesized counterparts of the pure bioactive compounds of essential oils and oleoresins. Plant extracts can ameliorate the intestinal health and general health conditions to enhance growth performance, and become a promising non-antibiotic tool for productive practice (Rossi et al., 2020). For example, macleaya cordata extract combined with Bacillus could improve the performance and health of layer chickens by increasing the content of follicle-stimulating hormone (FSH) in the serum, the expression of estrogen receptor-β (ERβ), FSHR and luteinizing hormone/choriogonadotropin receptor (LHCGR), the total antioxidant capacity and CAT activity (Wang et al., 2022). Trehalose (Tre) is a naturally disaccharide that can alleviate the inflammatory responses triggered by endotoxic shock of dietary feed and protect against glyphosate-induced hepatic steatosis by inhibiting the inflammatory responses (Lian et al., 2023). Dietary supplementation of GSE can reduce the number of double-yolk eggs, ROS content and steroidogenesis in layer chickens, and improve the size of eggs and the elasticity of the shell, but not affect egg production and fertility parameters (Barbe et al., 2020a). GSE can also be used as a potential dietary additive in broiler chickens, mainly as an effective natural immunostimulant agent and antioxidant by reducing of the total cholesterol and low-density lipoprotein cholesterol, the level of GSH-Px in liver and the content of malondialdehyde (MDA) in meat, and especially elevating the antibody titer of Newcastle disease virus vaccines in 28- and 38-day-old of broiler chickens (Farahat et al., 2017). OPC from Rhodiola rosea can reduce the releases of pro-inflammatory cytokines, lipids and antioxidant capacity to against the atherosclerosis in rats (Zhou et al., 2018). Supplementation with OPC can improve the production performance and the egg quality of layer chickens by promoting the immune responses of the intestinal mucosa (Barbe et al., 2020b; Grandhaye et al., 2020). Furthermore, OPC-derived from GSE has been shown to prevent disequilibrium of bone metabolism in OVX animals by improving the bone healing for maintaining bone health (Tenkumo et al., 2020). However, there are few reports on the effect of OPC on the bone development of layer chickens during the brood stage. Our study found that the ADG and the ADFI of layer chickens were improved by supplementing with OPC in diet, but the ratio of feed/gain were reduced. These results are similar to the report by Cao et al. (Cao et al., 2020).

Bone is an organ with outstanding adaptability, and its development is closely related to physiological stage, including rapid reinforce during the early puberty and the stop or deceleration during late puberty (Li et al., 2017). The bone development rate of chicks reaches 85% at 6-wk-old and more than 95% at 12-wk-old (Whitehead, 2004b). A study suggests that strengthening bone quality before to sexual maturity may be a way to improve the bone integrity and production performance of layer chickens, and the high tibial strength is closely related to egg quality (Wang et al., 2020). Our results have further shown that OPC could promote the bone development during the brooding period of chickens including BV and BMD, but there was no significant difference on organ coefficients. In addition, Ca and phosphorus (P) are the basic mineral elements of bone in animals (Civitelli and Ziambaras, 2011). Bone are also storehouse of Ca and P, and their imbalance in bone metabolism of layer chickens leading to lameness, fractures and OP. (Williams et al., 2000; Confavreux, 2011; Teng et al., 2020). In the present study, 100 mg/kg OPC increased the content of Ca and P of femur and tibia, but the ratio of Ca and P remained unchanged. Furthermore, trace minerals also plays a crucial role in the bone development of poultry (M'Sadeq et al., 2018; Güz et al., 2022). Fe, Mg, Cu, and Mn plays a vital role in the growth and development of poultry, and cannot be underestimated in the formation of bone tissue and maintenance of bone health (Sun et al., 2015; Echeverry et al., 2016; Byrne and Murphy, 2022). Meanwhile, divalent metal ions of trace elements are catalysts or active centers for various redox reactions, such as Mg2+ as a activator of GSH-Px, (Villa-Bellosta, 2020), Cu2+ and Mn2+ activates SOD, and Fe2+ as part of CAT (Ghasemi et al., 2020; Kong et al., 2022). A recent study found that the lack of trace minerals of the diet has a greater inhibitory effect on the growth performance of chicks in the early stages (Ghasemi et al., 2020). The absorption and utilization of trace minerals are different throughout the entire lifecycle of animals, especially the reservation of trace minerals in the early growth stages is crucial for ensuring the performance of layer chickens. Supplementation with dietary OPC can increase the content of Mg and Mn of femur and tibia during the brood stage of chickens, but had no effect on the content of Fe and Cu. In addition, antioxidant capacity is believed to be related to immunity and bone health of layer chickens. Tompkins et al. (Tompkins et al., 2023) found that hydrogen peroxide (H2O2)-induced oxidative stress has an inhibitory effect on the expression of osteogenesis markers, such as COL1A2, collagen type II alpha 1 (COL2A1), bone morphogenetic protein (BMP), OCN and Runx2, and mediates the activity of antioxidant enzymes of chicken embryos. Therefore, dietary supplementation with antioxidants can against the potential oxidative stress, and eventually contribute to the integrity of bone structure and metabolism in chickens. Oršolić et al. (Oršolić et al., 2018) found that OPC has antioxidant and antiosteoporotic effects in retinoic acid-induced bone loss in rats by maintaining the balance of Ca and P, and increasing the osteogenesis markers and BMD. Our data indicates that OPC facilitates the activities of serum antioxidant enzymes, and increased the content of Ca, P, and trace elements of bone and BMD, and promotes biochemical markers of bone turnover of chickens. These results are similar to the report by Oršolić et al. This suggests that OPC can promote bone development of layer chickens by improving growth performance, antioxidant capacity and the content of trace elements of bone.

In addition, bone metabolism is a dynamic procedure that includes various synchronous events and also requires the involvement of multiple types of bone cells, including osteoblast, osteoclast, osteocyte and chondrocyte (Salhotra et al., 2020). Osteoblast is responsible for bone formation by secreting extracellular matrix proteins including COL1A1 and OCN, which can deposit Ca in the formation of hydroxyapatite and provide structural support for bone (Long, 2011). BMSCs are multipotent fibroblasts with self-renewal and multispectral differentiation potential, and can differentiate into osteoblasts and chondrocytes (Macías et al., 2020). Previous studies have shown that loss of BMD can be improved by enhancing the osteogenesis of BMSCs in age-related rat model bone (Yu et al., 2020). Runx2 is a major transcription factor for osteogenesis and plays a key regulatory role during the differentiation of BMSCs into osteoblasts (Fisher and Franz-Odendaal, 2012; Liu et al., 2022). Deletion of Runx2 in BMSCs impairs the prolongation and the thickness of bone (Shu et al., 2021). In addition, a study found that isoquercitrin can promote the expression of Runx2 in BMSCs to accelerate osteogenesis. However, inhibition of Runx2 expression in BMSCs reduced the osteogenesis stimulated by isoquercitrin (Li et al., 2019). In the present study, it was found that OPC can promote the osteogenesis by increasing the proliferation of BMSCs and the expression of COL1A1, Runx2 and OCN.

It is well known that bone is composed of bone formation mediated by osteoblast and bone resorption mediated by osteoclast under the normal physiological conditions, both of which are in a dynamic equilibrium (Karsenty, 2008; Tong et al., 2020). Osteoclastogenesis is derived from BMMs and is induced by macrophage colony-stimulating factor (M-CSF) and RANKL (Søe et al., 2021). c-Fos is an indispensable transcription factor in RANKL-induced osteoclastogenesis (Jiang et al., 2023). In the treatment of different etiology-induced bone loss models, drugs are mainly used by inhibiting the RANKL-induced c-Fos signaling pathway and the attenuation of osteoclast-specific genes, such as TRAP and CTSK (Kwak et al., 2019; Zhao et al., 2020). CTSK is a cysteine protease produced by osteoclast, and is primarily responsible for the directly degradation of bone matrix (Costa et al., 2011; Drake et al., 2017). Interestingly, our data showed that low concentrations of OPC promoted the expression of c-Fos and CTSK, but 40 µmoL/L OPC inhibited the number of TRAP-positive osteoclasts and the expression of c-Fos and CTSK. The “OPG/RANKL/RANK” axis is a crucial signaling pathway for osteoclastogenesis (Xu et al., 2020). OPG is a decoy receptor of RANKL, and can inhibit osteoclastogenesis by preventing RANKL binding to its receptor RANK. In this study, low concentrations of OPC increased the level of RANKL and reduced the ratio of OPG/RANKL in vitro, but high concentrations of OPC had the opposite effect. Therefore, we speculate that OPC may affect the formation and activity of osteoclast by regulating the ratio of OPG/RANKL.

Next, to further investigate the regulatory effect of OPG on osteoclastogenesis of chickens in vitro, the culture medium was supplemented with different concentrations of OPG after the formation of osteoclasts. The osteoclastogenesis and the expression of bone resorption-related markers were reduced treatment with OPG in vitro. Besides, AMPK is a metabolic energy sensor and an essential component for maintaining intracellular energy balance. The phosphorylation of AMPK can prevent osteoclastogenesis and bone resorption, and reduce ATP production, indicating that AMPK is a negative regulatory factor for osteoclast differentiation. (Oh et al., 2016; Choi et al., 2022). Our previous study has demonstrated that the regulatory effect of OPG-inhibited osteoclastogenesis is associated with autophagy mediated by the AMPK signaling pathway and the fusion of the intracellular lysosomes with autophagosomes in mice (Tong et al., 2020). Rab7 regulates both the early and the late stages of autophagy, and is also involved in the formation of ruffled border and sealing zone in osteoclastogenesis (Roy and Roux, 2020). Furthermore, Rab7 is related to SNARE and pleckstrin homology domain containing protein family member 1 (PLEKHM1) for involving in the different steps of the autophagy (Roy and Roux, 2020; Das et al., 2024; Fujiwara et al., 2016). Thus, autophagy plays an important role in maintaining the intracellular balance (Ma et al., 2018). However, excessive autophagy can induce the cell death, thereby causing the physiological damage of cells (Jin et al., 2015). In this study, OPG can attenuate osteoclastogenesis of chickens by promoting the phosphorylation of AMPKα at Thr172 site and the expression of autophagy marker proteins Beclin1 and LC3. These results are consistent with our previous results in mice (Tong et al., 2020). In addition, AMPK has a specific late lysosomal function that interacts with LAMTOR by binding to chaperone protein AXIN, and LAMTOR is a lysosomal localization protein (Filipek et al., 2017; Lin and Hardie, 2018). In this study, the formation and activity of osteoclasts were reduced by enhancing autophagy during OPG-inhibited osteoclastogenesis of chickens, and the co-localization of LAMTOR1 with LC3 and AMPK was also observed. Overall, these findings reveal that the AMPK-LAMTOR pathway is involved in OPG- inhibited osteoclastogenesis of chickens by regulating autophagy.

CONCLUSION

In summary, this work found that dietary supplementation of OPC can meliorate the development of bone by promoting the growth and antioxidant capacity for regulating the osteogenesis and bone metabolism of layer chickens. Correspondingly, OPC regulates osteoclastogenesis by regulating the ratio of OPG/RANKL (Figure 8). These findings contribute to understanding the underlying mechanisms by which OPC may improve the growth performance of bone in layer chickens.

Figure 8.

Figure 8

Open in a new tab

A brief schematic diagram to summarize the effects and mechanism of OPC on the bone growth of layer chickens.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (32102732, 32072933, 32273086, 32072923), the Jiangsu Provincial Natural Science Foundation of China (BK20210806), the National Key R&D Program of China (2023YFD1801100), the Postgraduate Research & Practice Innovation Program of Jiangsu Province (SJCX23_2004), and the project was funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Availability of Data and Materials: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics Approval and Consent to Participate: Every procedure and protocol involving animals were permitted by the Yangzhou University Comparative Medical Center (Jiangsu Province, China). The study was based on the Guide to moral Control and Supervision in Animal Conservation and use.

DISCLOSURES

No conflict of interest exists in the submission of this manuscript, and manuscript is approved by all authors for publication. The author would like to declare on behalf of his co-authors that the work described was original research that has not been published previously, and not under consideration for publication elsewhere, in whole or in part. All the authors listed have approved the manuscript that is enclosed.

REFERENCES

  1. Bai C., Hou L., Ma Y., Chen L., Zhang M., Guan W. Isolation and characterization of mesenchymal stem cells from chicken bone marrow. Cell. Tissue. Bank. 2013;14:437–451. doi: 10.1007/s10561-012-9347-8. [DOI] [PubMed] [Google Scholar]
  2. Barbe A., Mellouk N., Ramé C., Grandhaye J., Anger K., Chahnamian M., Ganier P., Brionne A., Riva A., Froment P., Dupont J. A grape seed extract maternal dietary supplementation improves egg quality and reduces ovarian steroidogenesis without affecting fertility parameters in reproductive hens. PloS One. 2020;15 doi: 10.1371/journal.pone.0233169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Byrne L., Murphy R.A. Relative bioavailability of trace minerals in production animal nutrition: a review. Animals (Basel). 2022;12:1981. doi: 10.3390/ani12151981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Cao G., Zeng X., Liu J., Yan F., Xiang Z., Wang Y., Tao F., Yang C. Change of Serum Metabolome and Cecal Microflora in Broiler Chickens Supplemented With Grape Seed Extracts. Front. Immunol. 2020;11 doi: 10.3389/fimmu.2020.610934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen Y., Wang J., Zou L., Cao H., Ni X., Xiao J. Dietary proanthocyanidins on gastrointestinal health and the interactions with gut microbiota. Crit. Rev. Food. Sci. Nutr. 2023;63:6285–6308. doi: 10.1080/10408398.2022.2030296. [DOI] [PubMed] [Google Scholar]
  6. Choi E.-B., Agidigbi T.S., Kang I.-S., Kim C. ERK inhibition increases RANKL-induced osteoclast differentiation in RAW 264.7 cells by stimulating AMPK activation and RANK expression and inhibiting anti-osteoclastogenic factor expression. Int. J. Mol. Sci. 2022;23:13512. doi: 10.3390/ijms232113512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Civitelli R., Ziambaras K. Calcium and phosphate homeostasis: concerted interplay of new regulators. J. Endocrinol. Invest. 2011;34:3–7. [PubMed] [Google Scholar]
  8. Confavreux C.B. Bone: from a reservoir of minerals to a regulator of energy metabolism. Kidney. Int. 2011;79121:S14–S19. doi: 10.1038/ki.2011.25. [DOI] [PubMed] [Google Scholar]
  9. Costa A.G., Cusano N.E., Silva B.C., Cremers S., Bilezikian J.P. Cathepsin K: its skeletal actions and role as a therapeutic target in osteoporosis. Nat. Rev. Rheumatol. 2011;7:447–456. doi: 10.1038/nrrheum.2011.77. [DOI] [PubMed] [Google Scholar]
  10. Das B.K., Minocha T., Kunika M.D., Kannan A., Gao L., Mohan S., Xing W., Varughese K.I., Zhao H. Molecular and functional mapping of Plekhm1-Rab7 interaction in osteoclasts. JBMR. Plus. 2024;8:ziae034. doi: 10.1093/jbmrpl/ziae034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Drake M.T., Clarke B.L., Oursler M.J., Khosla S. Cathepsin K inhibitors for osteoporosis: biology, potential clinical utility, and lessons learned. Endocr. Rev. 2017;38:325–350. doi: 10.1210/er.2015-1114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Echeverry H., Yitbarek A., Munyaka P., Alizadeh M., Cleaver A., Camelo-Jaimes G., Wang P., O K., Rodriguez-Lecompte J.C. Organic trace mineral supplementation enhances local and systemic innate immune responses and modulates oxidative stress in broiler chickens. Poult. Sci. 2016;95:518–527. doi: 10.3382/ps/pev374. [DOI] [PubMed] [Google Scholar]
  13. Farahat M.H., Abdallah F.M., Ali H.A., Hernandez-Santana A. Effect of dietary supplementation of grape seed extract on the growth performance, lipid profile, antioxidant status and immune response of broiler chickens. Anim. Int. J. Anim. Biosci. 2017;11:771–777. doi: 10.1017/S1751731116002251. [DOI] [PubMed] [Google Scholar]
  14. Feghali K., Feldman M., La V.D., Santos J., Grenier D. Cranberry proanthocyanidins: natural weapons against periodontal diseases. J. Agric. Food. Chem. 2012;60:5728–5735. doi: 10.1021/jf203304v. [DOI] [PubMed] [Google Scholar]
  15. Filipek P.A., de Araujo M.E.G., Vogel G.F., De Smet C.H., Eberharter D., Rebsamen M., Rudashevskaya E.L., Kremser L., Yordanov T., Tschaikner P., Fürnrohr B.G., Lechner S., Dunzendorfer-Matt T., Scheffzek K., Bennett K.L., Superti-Furga G., Lindner H.H., Stasyk T., Huber L.A. LAMTOR/Ragulator is a negative regulator of Arl8b- and BORC-dependent late endosomal positioning. J. Cell Biol. 2017;216:4199–4215. doi: 10.1083/jcb.201703061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fisher S., Franz-Odendaal T. Evolution of the bone gene regulatory network. Curr. Opin. Genet. Dev. 2012;22:390–397. doi: 10.1016/j.gde.2012.04.007. [DOI] [PubMed] [Google Scholar]
  17. Fleming R.H. Nutritional factors affecting poultry bone health: symposium on ‘Diet and bone health. Proc. Nutr. Soc. 2008;67:177–183. doi: 10.1017/S0029665108007015. [DOI] [PubMed] [Google Scholar]
  18. Friedenstein A.J. Precursor cells of mechanocytes. Int. Rev. Cytol. 1976;47:327–359. doi: 10.1016/s0074-7696(08)60092-3. [DOI] [PubMed] [Google Scholar]
  19. Fujiwara T., Ye S., Castro-Gomes T., Winchell C.G., Andrews N.W., Voth D.E., Varughese K.I., Mackintosh S.G., Feng Y., Pavlos N., Nakamura T., Manolagas S.C., Zhao H. PLEKHM1/DEF8/RAB7 complex regulates lysosome positioning and bone homeostasis. JCI. Insight. 2016;1:e86330. doi: 10.1172/jci.insight.86330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Ghasemi H.A., Hajkhodadadi I., Hafizi M., Taherpour K., Nazaran M.H. Effect of advanced chelate technology based trace minerals on growth performance, mineral digestibility, tibia characteristics, and antioxidant status in broiler chickens. Nutr. Metab. 2020;17:94. doi: 10.1186/s12986-020-00520-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Grandhaye J., Douard V., Rodriguez-Mateos A., Xu Y., Cheok A., Riva A., Guabiraba R., Zemb O., Philippe C., Monnoye M., Staub C., Venturi E., Barbe A., Ramé C., Dupont J., Froment P. Microbiota changes due to grape seed extract diet improved intestinal homeostasis and decreased fatness in parental broiler hens. Microorganisms. 2020;8:1141. doi: 10.3390/microorganisms8081141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gu J., Tong X.-S., Chen G.-H., Wang D., Chen Y., Yuan Y., Liu X.-Z., Bian J.-C., Liu Z.-P. Effects of 1α,25-(OH)2D3 on the formation and activity of osteoclasts in RAW264.7 cells. J. Steroid. Biochem. Mol. Biol. 2015;152:25–33. doi: 10.1016/j.jsbmb.2015.04.003. [DOI] [PubMed] [Google Scholar]
  23. Guo S., Lei J., Liu L., Qu X., Li P., Liu X., Guo Y., Gao Q., Lan F., Xiao B., He C., Zou X. Effects of Macleaya cordata extract on laying performance, egg quality, and serum indices in Xuefeng black-bone chicken. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Güz B.C., de Jong I.C., Bol U.E., Kemp B., van Krimpen M., Molenaar R., van den Brand H. Effects of organic macro and trace minerals in fast and slower growing broiler breeders’ diet on offspring growth performance and tibia characteristics. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. He S., Zhuo L., Cao Y., Liu G., Zhao H., Song R., Liu Z. Effect of cadmium on osteoclast differentiation during bone injury in female mice. Environ. Toxicol. 2020;35:487–494. doi: 10.1002/tox.22884. [DOI] [PubMed] [Google Scholar]
  26. Infante M., Fabi A., Cognetti F., Gorini S., Caprio M., Fabbri A. RANKL/RANK/OPG system beyond bone remodeling: involvement in breast cancer and clinical perspectives. J. Exp. Clin. Cancer. Res. 2019;38:12. doi: 10.1186/s13046-018-1001-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jamil M., Aleem M.T., Shaukat A., Khan A., Mohsin M., Rehman T.U., Abbas R.Z., Saleemi M.K., Khatoon A., Babar W., Yan R., Li K. Medicinal plants as an alternative to control poultry parasitic diseases. Life (Basel). 2022;12:449. doi: 10.3390/life12030449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jiang T., Xia T., Qiao F., Wang N., Jiang Y., Xin H. Role and regulation of transcription factors in osteoclastogenesis. Int. J. Mol. Sci. 2023;24:16175. doi: 10.3390/ijms242216175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Jin Y., Lin Y., Feng J., Jia F., Gao G., Jiang J. Attenuation of cell death in injured cortex after post-traumatic brain injury moderate hypothermia: possible involvement of autophagy pathway. World Neurosurg. 2015;84:420–430. doi: 10.1016/j.wneu.2015.03.039. [DOI] [PubMed] [Google Scholar]
  30. Johnsson M., Jonsson K.B., Andersson L., Jensen P., Wright D. Genetic regulation of bone metabolism in the chicken: similarities and differences to mammalian system. PLoS. Genet. 2015;11 doi: 10.1371/journal.pgen.1005250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Karsenty G. Transcriptional control of skeletogenesis. Annu. Rev. Genomics. Hum. Genet. 2008;9:183–196. doi: 10.1146/annurev.genom.9.081307.164437. [DOI] [PubMed] [Google Scholar]
  32. Khatri M., O’Brien T.D., Sharma J.M. Isolation and differentiation of chicken mesenchymal stem cells from bone marrow. Stem. Cells. Dev. 2009;18:1485–1492. doi: 10.1089/scd.2008.0223. [DOI] [PubMed] [Google Scholar]
  33. Kong J., Qiu T., Yan X., Wang L., Chen Z., Xiao G., Feng X., Zhang H. Effect of replacing inorganic minerals with small peptide chelated minerals on production performance, some biochemical parameters and antioxidant status in broiler chickens. Front. Physiol. 2022;13 doi: 10.3389/fphys.2022.1027834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kwak S.C., Baek J.M., Lee C.H., Yoon K.-H., Lee M.S., Kim J.-Y. Umbelliferone prevents lipopolysaccharide-induced bone loss and suppresses RANKL-induced osteoclastogenesis by attenuating Akt-c-Fos-NFATc1 signaling. Int. J. Biol. Sci. 2019;15:2427–2437. doi: 10.7150/ijbs.28609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lacey D.L., Boyle W.J., Simonet W.S., Kostenuik P.J., Dougall W.C., Sullivan J.K., Martin J.S., Dansey R. Bench to bedside: elucidation of the OPG-RANK-RANKL pathway and the development of denosumab. Nat. Rev. Drug. Discov. 2012;11:401–419. doi: 10.1038/nrd3705. [DOI] [PubMed] [Google Scholar]
  36. Lamberti G., De Smet C.H., Angelova M., Kremser L., Taub N., Herrmann C., Hess M.W., Rainer J., Tancevski I., Schweigreiter R., Kofler R., Schmiedinger T., Vietor I., Trajanoski Z., Ejsing C.S., Lindner H.H., Huber L.A., Stasyk T. LAMTOR/Ragulator regulates lipid metabolism in macrophages and foam cell differentiation. FEBS. Lett. 2020;594:31–42. doi: 10.1002/1873-3468.13579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Li C., Chai Y., Wang L., Gao B., Chen H., Gao P., Zhou F.-Q., Luo X., Crane J.L., Yu B., Cao X., Wan M. Programmed cell senescence in skeleton during late puberty. Nat. Commun. 2017;8:1312. doi: 10.1038/s41467-017-01509-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Li M., Zhang C., Li X., Lv Z., Chen Y., Zhao J. Isoquercitrin promotes the osteogenic differentiation of osteoblasts and BMSCs via the RUNX2 or BMP pathway. Connect. Tissue. Res. 2019;60:189–199. doi: 10.1080/03008207.2018.1483358. [DOI] [PubMed] [Google Scholar]
  39. Li P.F., Zhou Z.L., Shi C.Y., Hou J.F. Downregulation of basic fibroblast growth factor is associated with femoral head necrosis in broilers. Poult. Sci. 2015;94:1052–1059. doi: 10.3382/ps/pev071. [DOI] [PubMed] [Google Scholar]
  40. Lian C.-Y., Wang R.-Z., Wang J., Wang Z.-Y., Zhang W., Wang L. Trehalose prevents glyphosate-induced hepatic steatosis in roosters by activating the Nrf2 pathway and inhibiting NLRP3 inflammasome activation. Vet. Res. Commun. 2023;47:651–661. doi: 10.1007/s11259-022-10021-w. [DOI] [PubMed] [Google Scholar]
  41. Liebscher G., Vujic N., Schreiber R., Heine M., Krebiehl C., Duta-Mare M., Lamberti G., de Smet C.H., Hess M.W., Eichmann T.O., Hölzl S., Scheja L., Heeren J., Kratky D., Huber L.A. The lysosomal LAMTOR /Ragulator complex is essential for nutrient homeostasis in brown adipose tissue. Mol. Metab. 2023;71 doi: 10.1016/j.molmet.2023.101705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Lin S.-C., Hardie D.G. AMPK: sensing glucose as well as cellular energy status. Cell. Metab. 2018;27:299–313. doi: 10.1016/j.cmet.2017.10.009. [DOI] [PubMed] [Google Scholar]
  43. Liu D.D., Zhang C.Y., Liu Y., Li J., Wang Y.X., Zheng S.G. RUNX2 regulates osteoblast differentiation via the BMP4 signaling pathway. J. Dent. Res. 2022;101:1227–1237. doi: 10.1177/00220345221093518. [DOI] [PubMed] [Google Scholar]
  44. Liu H.-J., Pan X.-X., Liu B.-Q., Gui X., Hu L., Jiang C.-Y., Han Y., Fan Y.-X., Tang Y.-L., Liu W.-T. Grape seed-derived procyanidins alleviate gout pain via NLRP3 inflammasome suppression. J. Neuroinflammation. 2017;14:74. doi: 10.1186/s12974-017-0849-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Long F. Building strong bones: molecular regulation of the osteoblast lineage. Nat. Rev. Mol. Cell. Biol. 2011;13:27–38. doi: 10.1038/nrm3254. [DOI] [PubMed] [Google Scholar]
  46. Ma Y., Qi M., An Y., Zhang L., Yang R., Doro D.H., Liu W., Jin Y. Autophagy controls mesenchymal stem cell properties and senescence during bone aging. Aging. Cell. 2018;17:e12709. doi: 10.1111/acel.12709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Macías I., Alcorta-Sevillano N., Rodríguez C.I., Infante A. Osteoporosis and the potential of cell-based therapeutic strategies. Int. J. Mol. Sci. 2020;21:1653. doi: 10.3390/ijms21051653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. M'Sadeq S.A., Wu S.-B., Choct M., Swick R.A. Influence of trace mineral sources on broiler performance, lymphoid organ weights, apparent digestibility, and bone mineralization. Poult. Sci. 2018;97:3176–3182. doi: 10.3382/ps/pey197. [DOI] [PubMed] [Google Scholar]
  49. Nada S., Hondo A., Kasai A., Koike M., Saito K., Uchiyama Y., Okada M. The novel lipid raft adaptor p18 controls endosome dynamics by anchoring the MEK-ERK pathway to late endosomes. EMBO J. 2009;28:477–489. doi: 10.1038/emboj.2008.308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Nawrot-Hadzik I., Matkowski A., Hadzik J., Dobrowolska-Czopor B., Olchowy C., Dominiak M., Kubasiewicz-Ross P. Proanthocyanidins and Flavan-3-Ols in the prevention and treatment of periodontitis-antibacterial effects. Nutrients. 2021;13:165. doi: 10.3390/nu13010165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Oh S.J., Gu D.R., Jin S.H., Park K.H., Lee S.H. Cytosolic malate dehydrogenase regulates RANKL-mediated osteoclastogenesis via AMPK/c-Fos/NFATc1 signaling. Biochem. Biophys. Res. Commun. 2016;475:125–132. doi: 10.1016/j.bbrc.2016.05.055. [DOI] [PubMed] [Google Scholar]
  52. Oršolić N., Nemrava J., Jeleč Ž., Kukolj M., Odeh D., Terzić S., Fureš R., Bagatin T., Bagatin D. The beneficial effect of proanthocyanidins and icariin on biochemical markers of bone turnover in rats. Int. J. Mol. Sci. 2018;19:2746. doi: 10.3390/ijms19092746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Park I.-J., Cha S.-Y., Kang M., Jang H.-K. Immunomodulatory effect of a proanthocyanidin-rich extract from Pinus radiata bark by dosing period in chickens. Poult. Sci. 2013;92:352–357. doi: 10.3382/ps.2012-02704. [DOI] [PubMed] [Google Scholar]
  54. Petrik M.T., Guerin M.T., Widowski T.M. On-farm comparison of keel fracture prevalence and other welfare indicators in conventional cage and floor-housed laying hens in Ontario, Canada. Poult. Sci. 2015;94:579–585. doi: 10.3382/ps/pev039. [DOI] [PubMed] [Google Scholar]
  55. Rossi B., Toschi A., Piva A., Grilli E. Single components of botanicals and nature-identical compounds as a non-antibiotic strategy to ameliorate health status and improve performance in poultry and pigs. Nutr. Res. Rev. 2020;33:218–234. doi: 10.1017/S0954422420000013. [DOI] [PubMed] [Google Scholar]
  56. Roy M., Roux S. Rab GTPases in Osteoclastic Bone Resorption and Autophagy. Int. J. Mol. Sci. 2020;21:7655. doi: 10.3390/ijms21207655. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Salhotra A., Shah H.N., Levi B., Longaker M.T. Mechanisms of bone development and repair. Nat. Rev. Mol. Cell. Biol. 2020;21:696–711. doi: 10.1038/s41580-020-00279-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Saunders-Blades J.L., Korver D.R. The effect of maternal vitamin D source on broiler hatching egg quality, hatchability, and progeny bone mineral density and performance. J. Appl. Poult. Res. 2014;23:773–783. [Google Scholar]
  59. Shu H.S., Liu Y.L., Tang X.T., Zhang X.S., Zhou B., Zou W., Zhou B.O. Tracing the skeletal progenitor transition during postnatal bone formation. Cell. Stem. Cell. 2021;28:2122–2136. doi: 10.1016/j.stem.2021.08.010. e3. [DOI] [PubMed] [Google Scholar]
  60. Smeriglio A., Barreca D., Bellocco E., Trombetta D. Proanthocyanidins and hydrolysable tannins: occurrence, dietary intake, and pharmacological effects. Br. J. Pharmacol. 2017;174:1244–1262. doi: 10.1111/bph.13630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Søe K., Delaisse J.-M., Borggaard X.G. Osteoclast formation at the bone marrow/bone surface interface: importance of structural elements, matrix, and intercellular communication. Semin. Cell. Dev. Biol. 2021;112:8–15. doi: 10.1016/j.semcdb.2020.05.016. [DOI] [PubMed] [Google Scholar]
  62. Srivastava R.K., Sapra L., Mishra P.K. Osteometabolism: metabolic alterations in bone pathologies. Cells. 2022;11:3943. doi: 10.3390/cells11233943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Sun J., Liu D., Shi R. Supplemental dietary iron glycine modifies growth, immune function, and antioxidant enzyme activities in broiler chickens. Livest. Sci. 2015;176:129–134. [Google Scholar]
  64. Szafraniec G.M., Szeleszczuk P., Dolka B. Review on skeletal disorders caused by Staphylococcus spp. in poultry. Vet. Q. 2022;42:21–40. doi: 10.1080/01652176.2022.2033880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Takano T., Li Y.-J., Kukita A., Yamaza T., Ayukawa Y., Moriyama K., Uehara N., Nomiyama H., Koyano K., Kukita T. Mesenchymal stem cells markedly suppress inflammatory bone destruction in rats with adjuvant-induced arthritis. Lab. Investig. 2014;94:286–296. doi: 10.1038/labinvest.2013.152. [DOI] [PubMed] [Google Scholar]
  66. Teng X., Zhang W., Xu D., Liu Z., Yang N., Luo D., Wang H., Ge M., Zhang R. Effects of low dietary phosphorus on tibia quality and metabolism in caged laying hens. Prev. Vet. Med. 2020;181 doi: 10.1016/j.prevetmed.2020.105049. [DOI] [PubMed] [Google Scholar]
  67. Tenkumo T., Aobulikasimu A., Asou Y., Shirato M., Shishido S., Kanno T., Niwano Y., Sasaki K., Nakamura K. Proanthocyanidin-rich grape seed extract improves bone loss, bone healing, and implant osseointegration in ovariectomized animals. Sci. Rep. 2020;10:8812. doi: 10.1038/s41598-020-65403-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Tompkins Y., Liu G., Marshall B., Sharma M.K., Kim W.K. Effect of hydrogen oxide-induced oxidative stress on bone formation in the early embryonic development stage of chicken. Biomolecules. 2023;13:154. doi: 10.3390/biom13010154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Tong X., Fu X., Yu G., Qu H., Zou H., Song R., Ma Y., Yuan Y., Bian J., Gu J., Liu Z. Polystyrene exacerbates cadmium-induced mitochondrial damage to lung by blocking autophagy in mice. Environ. Toxicol. 2023;38:1775–1785. doi: 10.1002/tox.23804. [DOI] [PubMed] [Google Scholar]
  70. Tong X., Yu G., Liu Q., Zhang X., Bian J., Liu Z., Gu J. Puerarin alleviates cadmium-induced oxidative damage to bone by reducing autophagy in rats. Environ. Toxicol. 2022;37:720–729. doi: 10.1002/tox.23437. [DOI] [PubMed] [Google Scholar]
  71. Tong X., Zhang C., Wang D., Song R., Ma Y., Cao Y., Zhao H., Bian J., Gu J., Liu Z. Suppression of AMP-activated protein kinase reverses osteoprotegerin-induced inhibition of osteoclast differentiation by reducing autophagy. Cell. Prolif. 2020;53:e12714. doi: 10.1111/cpr.12714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Tsukasaki M., Asano T., Muro R., Huynh N.C.-N., Komatsu N., Okamoto K., Nakano K., Okamura T., Nitta T., Takayanagi H. OPG production matters where it happened. Cell Rep. 2020;32 doi: 10.1016/j.celrep.2020.108124. [DOI] [PubMed] [Google Scholar]
  73. van Gastel N., Carmeliet G. Metabolic regulation of skeletal cell fate and function in physiology and disease. Nat. Metab. 2021;3:11–20. doi: 10.1038/s42255-020-00321-3. [DOI] [PubMed] [Google Scholar]
  74. Varin A., Pontikoglou C., Labat E., Deschaseaux F., Sensebé L. CD200R/CD200 inhibits osteoclastogenesis: new mechanism of osteoclast control by mesenchymal stem cells in human. PloS One. 2013;8:e72831. doi: 10.1371/journal.pone.0072831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Villa-Bellosta R. Dietary magnesium supplementation improves lifespan in a mouse model of progeria. EMBO Mol. Med. 2020;12:e12423. doi: 10.15252/emmm.202012423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Walmsley G.G., Ransom R.C., Zielins E.R., Leavitt T., Flacco J.S., Hu M.S., Lee A.S., Longaker M.T., Wan D.C. Stem cells in bone regeneration. Stem. Cell. Rev. 2016;12:524–529. doi: 10.1007/s12015-016-9665-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Wang J., Qiu L., Gong H., Celi P., Yan L., Ding X., Bai S., Zeng Q., Mao X., Xu S., Wu C., Zhang K. Effect of dietary 25-hydroxycholecalciferol supplementation and high stocking density on performance, egg quality, and tibia quality in laying hens. Poult. Sci. 2020;99:2608–2615. doi: 10.1016/j.psj.2019.12.054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Wang F., Zou P., Xu S., Wang Q., Zhou Y., Li X., Tang L., Wang B., Jin Q., Yu D., Li W. Dietary supplementation of Macleaya cordata extract and Bacillus in combination improve laying performance by regulating reproductive hormones, intestinal microbiota and barrier function of laying hens. J. Anim. Sci. Biotechnol. 2022;13:118. doi: 10.1186/s40104-022-00766-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Whitehead, C. C. 2004a. Skeletal disorders in laying hens: the problem of osteoporosis and bone fractures. Welf. Lay. Hen Pap. 27th Poult. Sci. Symp. Worlds Poult. Sci. Assoc. UK Branch Bristol UK July 2003:259–278.
  80. Whitehead C.C. Overview of bone biology in the egg-laying hen. Poult. Sci. 2004;83:193–199. doi: 10.1093/ps/83.2.193. [DOI] [PubMed] [Google Scholar]
  81. Whitehead C.C., Fleming R.H. Osteoporosis in Cage Layers. Poult. Sci. 2000;79:1033–1041. doi: 10.1093/ps/79.7.1033. [DOI] [PubMed] [Google Scholar]
  82. Williams B., Waddington D., Solomon S., Farquharson C. Dietary effects on bone quality and turnover, and Ca and P metabolism in chickens. Res. Vet. Sci. 2000;69:81–87. doi: 10.1053/rvsc.2000.0392. [DOI] [PubMed] [Google Scholar]
  83. Wu Y., Ma N., Song P., He T., Levesque C., Bai Y., Zhang A., Ma X. Grape seed proanthocyanidin affects lipid metabolism via changing gut microflora and enhancing propionate production in weaned pigs. J. Nutr. 2019;149:1523–1532. doi: 10.1093/jn/nxz102. [DOI] [PubMed] [Google Scholar]
  84. Xu X., Tang Y., Lang Y., Liu Y., Cheng W., Xu H., Liu Y. Oral Exposure to ZnO nanoparticles disrupt the structure of bone in young rats via the OPG/RANK/RANKL/IGF-1 pathway. Int. J. Nanomed. 2020;15:9657–9668. doi: 10.2147/IJN.S275553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Yang J.Y., Zhang H.J., Wang J., Wu S.G., Yue H.Y., Jiang X.R., Qi G.H. Effects of dietary grape proanthocyanidins on the growth performance, jejunum morphology and plasma biochemical indices of broiler chicks. Anim. Int. J. Anim. Biosci. 2017;11:762–770. doi: 10.1017/S1751731116002056. [DOI] [PubMed] [Google Scholar]
  86. Yu X., Zeng Y., Bao M., Wen J., Zhu G., Cao C., He X., Li L. Low-magnitude vibration induces osteogenic differentiation of bone marrow mesenchymal stem cells via miR-378a-3p/Grb2 pathway to promote bone formation in a rat model of age-related bone loss. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2020;34:11754–11771. doi: 10.1096/fj.201902830RRR. [DOI] [PubMed] [Google Scholar]
  87. Zhang C.-S., Jiang B., Li M., Zhu M., Peng Y., Zhang Y.-L., Wu Y.-Q., Li T.Y., Liang Y., Lu Z., Lian G., Liu Q., Guo H., Yin Z., Ye Z., Han J., Wu J.-W., Yin H., Lin S.-Y., Lin S.-C. The lysosomal v-ATPase-Ragulator complex is a common activator for AMPK and mTORC1, acting as a switch between catabolism and anabolism. Cell Metab. 2014;20:526–540. doi: 10.1016/j.cmet.2014.06.014. [DOI] [PubMed] [Google Scholar]
  88. Zhang H., Wang Y., Mehmood K., Chang Y.-F., Tang Z., Li Y. Treatment of tibial dyschondroplasia with traditional Chinese medicines: “Lesson and future directions. Poult. Sci. 2020;99:6422–6433. doi: 10.1016/j.psj.2020.08.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Zhao D., Shu B., Wang C., Zhao Y., Cheng W., Sha N., Li C., Wang Q., Lu S., Wang Y. Oleanolic acid exerts inhibitory effects on the late stage of osteoclastogenesis and prevents bone loss in osteoprotegerin knockout mice. J. Cell. Biochem. 2020;121:152–164. doi: 10.1002/jcb.28994. [DOI] [PubMed] [Google Scholar]
  90. Zhou Q., Han X., Li R., Zhao W., Bai B., Yan C., Dong X. Anti-atherosclerosis of oligomeric proanthocyanidins from Rhodiola rosea on rat model via hypolipemic, antioxidant, anti-inflammatory activities together with regulation of endothelial function. Phytomedicine Int. J. Phytother. Phytopharm. 2018;51:171–180. doi: 10.1016/j.phymed.2018.10.002. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES