Bioactive fiber-reinforced hydrogel to tailor cell microenvironment for structural and functional regeneration of myotendinous junction

Yuzhi Sun; Renwang Sheng; Zhicheng Cao; Chuanquan Liu; Jiaxiang Li; Po Zhang; Yan Du; Qingyun Mo; Qingqiang Yao; Jialin Chen; Wei Zhang

doi:10.1126/sciadv.adm7164

. 2024 Apr 24;10(17):eadm7164. doi: 10.1126/sciadv.adm7164

Bioactive fiber-reinforced hydrogel to tailor cell microenvironment for structural and functional regeneration of myotendinous junction

Yuzhi Sun ^1,^†, Renwang Sheng ^2,^†, Zhicheng Cao ¹, Chuanquan Liu ², Jiaxiang Li ¹, Po Zhang ¹, Yan Du ², Qingyun Mo ², Qingqiang Yao ^1,^3,^*, Jialin Chen ^2,^4,^3,^*, Wei Zhang ^2,^4,^3,^*

PMCID: PMC11042749 PMID: 38657071

Abstract

Myotendinous junction (MTJ) injuries are prevalent in clinical practice, yet the treatment approaches are limited to surgical suturing and conservative therapy, exhibiting a high recurrence rate. Current research on MTJ tissue engineering is scarce and lacks in vivo evaluation of repair efficacy. Here, we developed a three-dimensional–printed bioactive fiber-reinforced hydrogel containing mesenchymal stem cells (MSCs) and Klotho for structural and functional MTJ regeneration. In a rat MTJ defect model, the bioactive fiber-reinforced hydrogel promoted the structural restoration of muscle, tendon, and muscle-tendon interface and enhanced the functional recovery of injured MTJ. In vivo proteomics and in vitro cell cultures elucidated the regenerative mechanisms of the bioactive fiber-reinforced hydrogel by modulating oxidative stress and inflammation, thus engineering an optimized microenvironment to support the survival and differentiation of transplanted MSCs and maintain the functional phenotype of resident cells within MTJ tissues, including tendon/muscle cells and macrophages. This strategy provides a promising treatment for MTJ injuries.

A tissue-engineered scaffold improves MTJ structural and functional regeneration in vivo.

INTRODUCTION

Myotendinous junction (MTJ) is a complex and specialized tissue located at the interface between muscle and tendon, and it is responsible for force transmission from the contracting skeletal muscle, through tendon, to bone. As a junction of muscle and tendon, MTJ sustains concentrated mechanical stress under repetitive loading in daily movement or exercise; thus, injuries to MTJ are prevalent (1). It has been reported that 28% of muscle-tendon-bone complex injuries occur at MTJ, with the second highest risk among muscle, tendon, muscle-tendon interface, and tendon-bone interface injuries (2). Current clinical treatments for MTJ injuries include conservative treatments such as nonsteroidal anti-inflammatory drugs and physical therapy, as well as surgical intervention using various suturing technologies. However, several limitations impede their effectiveness, including the following: (i) the formation of scar tissue leading to insufficient mechanical strength, contributing to a high recurrence rate after treatment (3, 4); (ii) the suture cut-through at or near MTJ injury, often resulting in failed MTJ reconstruction (5, 6); and (iii) challenging repair of large MTJ defects, especially in cases where muscle and tendon retract after injuries (5, 7). Consequently, current interventions are unable to promote both the structural and functional repair of MTJ, necessitating the development of promising strategies for high-quality MTJ regeneration.

In recent decades, tissue engineering has emerged as a promising strategy for the repair and regeneration of musculoskeletal tissues, which involves the integration of cells, scaffolds, and biomolecules to create biological substitutes to restore, replace, or regenerate injured tissues (8). Compared with conservative treatments and surgical suturing, regenerative therapies based on tissue engineering have demonstrated more compelling therapeutic effects for various musculoskeletal tissues, including tendon-bone junction (9, 10), skeletal muscle (11), and meniscus (12). However, repairing the MTJ by tissue engineering strategy is quite challenging because of the complex biological composition and physicochemical properties of this specialized region, including different cell types, extracellular matrix (ECM) composition, and mechanical strength of muscle and tendon tissues. To date, a very limited number of publications related to MTJ tissue engineering have been documented (from the PubMed database), among which some progress has been made in MTJ regeneration by constructing biochemically, structurally, or mechanically biomimetic scaffolds of tendon and muscle, with or without cells seeded (13–18). Several studies have used decellularized ECM from tendon, muscle, MTJ, or small intestinal submucosa to provide myogenic and tenogenic bioactivities for muscle and tendon tissue formation (13, 14, 17). Besides, biomimetic scaffolds with biphasic structures of muscle and tendon have been fabricated using three-dimensional (3D) printing, coelectrospinning, and wet-spinning technologies (13, 15, 16, 18). Owing to the important role of MTJ in force transmission, a strong mechanical property of scaffolds was also pursued to maintain the physiological function of MTJ (15, 16, 18). Although the previously developed scaffolds have shown ingenious material design, their assessments have been largely limited to in vitro evaluation such as mechanical properties or cytocompatibility, while lacking the essential in vivo evaluation of their efficacy in repairing MTJ injuries, especially in terms of functional recovery (13–16). An imminent necessity remains for the advancement of multifunctional engineering scaffolds featuring tendon and muscle regenerative bioactivity, suitable microstructure, and sufficient mechanical strength to enable the in vivo structural and functional regeneration of MTJ.

In addition to considering the scaffold’s properties, great attention should be paid to the modulation of in situ biological microenvironment as a pivotal approach to enhance MTJ regeneration. Given the transitional nature of MTJ that involves two distinct tissue types, cells originating from both tendon and muscle reside within this interface. Furthermore, immune cells, such as macrophages, actively participate in the reparative cascade subsequent to MTJ injury. Engineering an optimal cell microenvironment through tissue engineering strategies becomes imperative for proper biological regulation of these diverse cell populations, aiming to preserve their phenotype and ensure their function, thereby fostering the MTJ repair process. However, tendon, muscle, or MTJ injuries are inevitably accompanied by inflammation, with immune cell infiltration (e.g., macrophages) and increased proinflammatory cytokine secretion [e.g., interleukin-1β (IL-1β)] (19, 20). Simultaneously, the generation of reactive oxygen species (ROS), including hydroxyl radical, superoxide anion, and hydrogen peroxide (H₂O₂), is highly associated with the inflammatory microenvironment after muscle and tendon injuries (21, 22). The excessive production of proinflammatory cytokines and ROS was reported to substantially impede the repair processes of both muscle and tendon by interrupting normal cell cycle and migration, as well as inducing cell death and phenotypic changes (23–25). The hostile cell microenvironment following injuries disrupts cellular functions not only for resident cells within the MTJ tissues (tendon/muscle resident cells and immune cells) but also for transplanted cells, consequently hindering MTJ regeneration. Mesenchymal stem cells (MSCs) are multipotent stem cells capable of differentiating into various cell types including tenocytes and myocytes under specific induction conditions and have been used in tendon and muscle regeneration (26, 27). However, the adverse microenvironment characterized by inflammation and oxidative stress following injury has led to inadequate survival and viability of transplanted MSCs (28, 29). Therefore, the manipulation of cell microenvironment in injured MTJ through tissue engineering scaffolds with immunomodulatory and antioxidant capabilities emerges as a promising strategy for MTJ repair but has been notably absent in previous MTJ tissue engineering studies.

The Klotho is a 130-kDa type I single-pass transmembrane glycoprotein well recognized for its antiaging properties (30, 31). It exists in multiple forms, including a full-length transmembrane variant (mKl), a soluble variant (sKl), and an additional secreted variant generated through alternative splicing (32). Among them, sKl (referred to hereinafter as Klotho), generated from the released mKI into the bloodstream, can function as a circulating hormone to exert antiaging effects via inhibiting the insulin/insulin-like growth factor 1 signaling cascade (33). Several studies have revealed the compelling effects of Klotho on restoring the functions of muscle- and tendon/ligament-lineage stem cells for tissue regeneration (34–37). Specifically, Sahu et al. (34) found that the decline or inhibition of Klotho led to mitochondrial DNA damage, activated oxidative stress, and ROS accumulation in muscle progenitor cells, thereby causing cellular senescence and hindering skeletal muscle regeneration. Systemic supplementation of Klotho effectively reversed these processes and promoted aged skeletal muscle regeneration. In addition, Zhu et al. (36) and Chen et al. (37) reported that Klotho could maintain the viability and stemness of periodontal ligament stem cells by suppressing H₂O₂-induced oxidative stress and restoring mitochondrial function, presenting a potential strategy to treat chronic inflammation. Given the high similarity in composition and structure between tendon and ligament, it is reasonable to hypothesize that Klotho could induce similar biological effects in tendon as well. Furthermore, a prior investigation directly compared the effect of Klotho and N-acetylcysteine, a widely recognized potent antioxidant, and revealed that Klotho exhibited a similar capacity to mitigate DNA damage and cellular senescence by inhibiting oxidative stress, while inducing less cellular apoptosis in comparison to N-acetylcysteine (38). Together, the utilization of recombinant Klotho as an antioxidant and immunomodulatory biomolecule integrated into tissue engineering scaffolds holds promise to improve cell microenvironment of injured tissues, thereby facilitating the MTJ repair processes.

Herein, we developed a 3D-printed fiber-reinforced multifunctional hydrogel to provide sufficient mechanical support and tailor a suitable microenvironment for structural and functional MTJ regeneration (Fig. 1A). In this bioactive fiber-reinforced hydrogel system, 3D-printed poly (lactic-co-glycolic) acid (PLGA) scaffold with well-aligned structure can provide enough mechanical strength for the physiological function of MTJ; MSCs were introduced to enhance the proregenerative bioactivities of both muscle and tendon (13), and Klotho was loaded to improve the pathological environment for exogenous MSCs and endogenous MTJ resident cells after MTJ injuries; in addition, a photocrosslinked silk fibroin methacryloyl (SilMA) hydrogel was fused into PLGA scaffold to serve as a carrier for Klotho delivery and to provide a 3D water-abundant microenvironment for MSC retention and survival. In this study, we first evaluated the physicochemical properties and cytocompatibility of the bioactive fiber-reinforced hydrogel. Subsequently, the hydrogel system was implanted into a rat MTJ defect model to evaluate its in situ efficacy in promoting structural and functional regeneration of MTJ. In vivo proteomics analysis was performed to discern the underlying mechanism of the hydrogel system promoting MTJ regeneration. Following proteomics results, we conducted further investigations to explore whether and how the manipulation of cell microenvironment via the hydrogel system could modulate the behaviors of transplanted MSCs and resident cells, thereby enhancing MTJ regeneration.

Fig. 1. — (A) Schematic illustration of the fabrication of PLGA-reinforced SilMA hydrogel containing MSCs and Klotho (K/M@SM-PA). (B) SEM images of lyophilized PA, SM-PA, and K@SM-PA scaffolds. Low magnification: scale bars, 300 μm; high magnification: scale bars, 100 μm. (C) PLGA fiber diameter of PA, SM-PA, and K@SM-PA scaffolds (n = 3 scaffolds per group). Beeswarm plots (small circular dots) represent individual fibers that are color coded in accordance with their corresponding scaffolds (squares). (D) Pore area of SilMA hydrogels in SM-PA and K@SM-PA scaffolds (n = 3 scaffolds per group). Beeswarm plots (small circular dots) represent individual pores that are color coded in accordance with their corresponding scaffolds (squares). (E and F) Tensile modulus (E) and failure force (F) of PA, SM-PA, and K@SM-PA scaffolds, as well as native rat MTJ (n = 5 MTJ samples or scaffolds per group). (G) Rheological strain sweeps from 0.01 to 100% strain at 10 rad/s. (H) Rheological frequency sweeps from 0.1 to 100 rad/s at 1% strain. (I) Water contact angles of PA, SM-PA, and K@SM-PA scaffolds captured at 1 s after water dropping. (J) Swelling ratio of PA, SM-PA, and K@SM-PA scaffolds at 6, 12, and 24 hours after incubation in PBS at 37°C (n = 5 scaffolds per group). (K) Live/dead staining of MSCs cultured within the SM-PA and K@SM-PA hydrogels. Scale bars, 200 μm. (L) Cell viability of MSCs quantified from live/dead staining images (n = 7 randomly selected microscopic images per group). (M) MSC proliferation measured by CCK-8 assay on days 1, 3, and 5 (n = 6 independent experimental units per group). DMSO, 5% DMSO; Ctrl, normal growth medium. Results are shown as means ± SD, ^nsP ≥ 0.05, *P < 0.05, ****P < 0.0001. Schematic illustrations were created using BioRender (www.biorender.com).

RESULTS

Bioactive fiber-reinforced hydrogel is prepared and characterized

To engineer an ideal tissue engineering scaffold with sufficient mechanical strength and regenerative bioactivities for MTJ regeneration, we developed a PLGA fiber-reinforced SilMA hydrogel loaded with MSCs and Klotho (Fig. 1A). Using fused deposition modeling (FDM) 3D-printing techniques, we fabricated PLGA scaffolds with orthogonally aligned grids and interconnected macropores to provide mechanical and structural support for force transmission and tissue ingrowth in the injured MTJ. Subsequently, we fused a mixture of SilMA precursor, MSCs, and recombinant Klotho into the PLGA scaffold and photocrosslinked it to form fiber-reinforced hydrogels with microporous and interconnected structures. Acting as a versatile carrier for MSCs and bioactive molecules (39), SilMA hydrogel was introduced to enhance MSC retention, establish a conducive 3D microenvironment for cell growth and nutrient exchange, and effectively serve as a release system for Klotho. Scanning electron microscope (SEM) images showed the infiltration of the microporous SilMA hydrogel within the interstices of the macroporous PLGA scaffold, thereby offering an enhanced microenvironment conducive to cell adhesion (Fig. 1B). PLGA (PA), SilMA-PLGA (SM-PA), and Klotho@SilMA-PLGA (K@SM-PA) scaffolds exhibited comparable PLGA fiber diameters of ~340 μm (Fig. 1C). Besides, the pore area of the SM-PA and K@SM-PA scaffolds exhibited no significant difference, indicating that the incorporation of Klotho had no notable effect on the microporous structure of SilMA hydrogel (Fig. 1D). SEM analysis of the fiber-reinforced hydrogel seeded with MSCs revealed that MSCs were embedded in a spherical or spindle-shaped morphology within the SilMA hydrogel matrix (fig. S1).

Subsequently, the mechanical properties of the PA, SM-PA, and K@SM-PA scaffolds, as well as the native rat MTJ samples were evaluated using an electric universal testing machine. As shown in fig. S2, the samples in all groups underwent ductile failure rather than brittle failure under the mechanical tensile test, indicating the toughness of MTJ, PLGA, and PLGA-reinforced hydrogels. The ductile failure mode of PLGA-based materials has been reported previously (40). The PA, SM-PA, and K@SM-PA scaffolds had tensile modulus of 70.12 ± 20.95, 79.16 ± 23.61, and 74.10 ± 22.24 MPa, respectively, which was significantly higher than that of the native rat MTJ tissues (Fig. 1E). Besides, all groups showed a similar failure force of more than 20 N (Fig. 1F). These results suggested that the high mechanical strength of the fiber-reinforced hydrogels was mainly attributed to the PLGA framework, which was able to provide sufficient mechanical support for injured MTJ after in vivo implantation.

The rheological properties of SilMA hydrogel loaded with or without Klotho were also measured. The strain sweeps showed that the incorporation of Klotho did not change the length of linear-viscoelastic region of SilMA hydrogels (Fig. 1G). From the frequency sweeps, the storage modulus (G′) of both hydrogels was higher than the loss modulus (G″) at 0.1 to 100 rad/s, indicating the formation of stable hydrogels (Fig. 1H). It was noted that the incorporation of Klotho into the K@SM hydrogels slightly decreased the storage modulus of SilMA hydrogels in frequency sweeps. Klotho protein could interact with the chains of SilMA and result in potential hindrance, which possibly decreased the breaking and bonding efficiency of double bonds in SilMA. Therefore, the K@SM hydrogel showed a slight but not notable decrease in storage modulus compared to the SilMA hydrogel. This phenomenon has also been observed in a previous study (41).

The degradation and hydrophilicity of PLGA are predominantly determined by the content of lactic acid (LA), with a higher LA proportion corresponding to a slower degradation and reduced hydrophilicity (42). To align with the long-term MTJ-regenerative process, we selected PLGA with an LA/glycolic acid (GA) ratio of 75:25 to achieve a slow degradation rate. The degradation behavior of bioactive fiber-reinforced hydrogel was evaluated in a simulated physiological environment [in phosphate-buffered saline (PBS) at 37°C with gentle shaking]. The K@SM-PA hydrogel exhibited rapid degradation within 1 week, followed by a slower degradation extending over 60 days (fig. S3). This dual-phase degradation of K@SM-PA hydrogel can be attributed to the swift degradation of SilMA hydrogel and the gradual degradation of PLGA fibers, as previously reported (43, 44). Upon in vivo implantation, the accelerated degradation of SilMA hydrogel within the initial week not only facilitates Klotho release but also provides additional space for cell migration and tissue ingrowth in the subsequent phases of tissue repair. In contrast, the gradual degradation of PLGA fiber ensures long-term mechanical support during MTJ repair. In addition, the controlled release property of the SM-PA hydrogel was investigated by loading fluorescein isothiocyanate–labeled bovine serum albumin as a model protein, which shares similar characteristics with Klotho and emits green fluorescence, facilitating easier monitoring. Similar to its degradation profile, the SM-PA hydrogel exhibited a biphasic drug release pattern with a rapid release within the first 3 days, followed by a sustained release profile over 21 days (fig. S4). It is widely recognized that inflammatory responses are triggered promptly following tissue injuries and persist for 1 to 2 weeks (45). The initial burst release of Klotho in the early days serves to counteract the harsh inflammatory and oxidative stress microenvironment immediately following injury. Subsequently, the gradual release of Klotho will play a sustained role in the repair process of the MTJ.

The contact angle test revealed that PA had a water contact angle of 70.8°, while SM-PA and K@SM-PA exhibited substantially lower water contact angles of 37.7° and 38.4° (Fig. 1I), suggesting that the introduction of SilMA hydrogel greatly improved the hydrophilicity of PLGA scaffolds. Similarly, we found that the swelling ratio of both the SM-PA and K@SM-PA hydrogels (~40%) was significantly higher than that of the PA scaffold (<10%) when incubated in PBS (Fig. 1J). The results indicated that the PA scaffold showed minimal swelling, while the observed swelling in the fiber-reinforced hydrogel was attributed to the excellent water absorption capacity of SilMA hydrogel. This property is beneficial for maintaining a water-abundant environment within the scaffold for cell survival and tissue ingrowth after implantation. The incorporation of Klotho had no significant influence on the hydrophilicity of the fiber-reinforced hydrogels (Fig. 1, I and J).

Furthermore, the cytocompatibility of bioactive fiber-reinforced hydrogels was evaluated. MSCs were seeded within the SM-PA and K@SM-PA hydrogels for 3 days, and live/dead staining revealed that most of the encapsulated MSCs were viable in both hydrogels (Fig. 1K). Quantitative results showed that the cell viability of MSCs cultured in both hydrogels exceeded 80%, with no significant difference identified between groups (Fig. 1L). In addition, we performed a Cell Counting Kit-8 (CCK-8) assay to assess the proliferation of MSCs (Fig. 1M). Except for the dimethyl sulfoxide (DMSO) group (negative control), the MSCs in the Ctrl (normal growth medium), SM-PA, and K@SM-PA groups exhibited normal proliferation from days 1 to 5. No significant difference was observed between the hydrogel group and the Ctrl group, indicating the good cytocompatibility of the developed hydrogel system. In summary, the bioactive fiber-reinforced hydrogel exhibits outstanding physicochemical properties, mechanical strength, and cytocompatibility in vitro, making it a promising candidate for further evaluation in vivo.

Bioactive fiber-reinforced hydrogel effectively enhances the structural and functional regeneration of MTJ in rats

Subsequently, we assessed the efficacy of the developed bioactive fiber-reinforced hydrogels on MTJ regeneration using a rat MTJ defect model (Fig. 2A). The untreated MTJ defect was set as the Ctrl group. After 4 weeks of implantation, histological examinations were performed to evaluate the regenerated tissues in MTJ defects. It was noted that the presence of residual scaffolds at 4 weeks postoperatively occupied a certain space within the regenerated tissue, impeding the clear presentation of the typical MTJ structure (fig. S5). Therefore, the repaired tissue located at the defects and adjacent to the scaffolds were used to assess MTJ repair. Hematoxylin and eosin (H&E) and Masson trichrome staining showed that the regenerated MTJ tissues in the M@SM-PA and K/M@SM-PA groups showed broad insertion of muscle and tendon fibers with notable interdigitations, while those in the Ctrl and SM-PA groups exhibited rare, irregular, and short interdigitations (Fig. 2, B and C). It was also observed that the M@SM-PA and K/M@SM-PA hydrogels induced the formation of more organized tendon fibers than the Ctrl and SM-PA scaffold, with a native wavy pattern of tendon collagen fibers found in the K/M@SM-PA group (Fig. 2, B and C). Quantitative analysis revealed that the K/M@SM-PA group had a notably lower tendon histology score, suggesting a more tendon-like tissue formation, in comparison to those of the other three groups (Fig. 2G). In terms of regenerated muscle tissues, the K/M@SM-PA group exhibited a significantly increased muscle fiber diameter compared to the Ctrl, SM-PA, and M@SM-PA groups, indicating improved muscle regeneration facilitated by the K/M@SM-PA hydrogel (Fig. 2, B, C, and H). Collectively, these findings imply the high efficacy of the bioactive fiber-reinforced hydrogel in promoting tissue formation and remodeling at the MTJ.

Fig. 2. — (A) Schematic illustration of in situ implantation of the K/M@SM-PA hydrogel into the MTJ defect in rats. The PLGA scaffold was preimplanted into the defect area, and the SilMA hydrogel containing Klotho and MSCs was subsequently photocrosslinked in situ. (B) H&E staining of regenerated tissues in MTJ defects at 4 weeks after surgery. Black, blue, and red boxes indicate the repaired MTJ, tendon (T), and skeletal muscle (M), respectively. The black dashed lines show the interface of the muscle and tendon. Low magnification: scale bars, 100 μm; high magnification: scale bars, 25 μm. (C) Masson trichrome staining of regenerated tissues in MTJ defects at 4 weeks after surgery. Low magnification: scale bars, 100 μm; high magnification: scale bars, 25 μm. (D to F) IHC staining for Paxillin (MTJ marker), TNMD (tendon marker), and MYH4 (muscle marker) of regenerated tissues in MTJ defects at 4 weeks after surgery. Low magnification: scale bars, 200 μm; high magnification: scale bars, 40 μm. (G) Histology scores of regenerated tendon tissues evaluated from H&E staining images (n = 3 rats per group). (H) Quantitative analysis of regenerated myofiber diameter from H&E staining images (n = 3 rats per group). (I to K) Quantitative analysis of IHC staining for Paxillin, TNMD, and MYH4 of regenerated tissues at 4 weeks after surgery (n = 4 randomly selected microscopic images per group). Results are shown as means ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Schematic illustrations were created using BioRender (www.biorender.com).

Immunohistochemical (IHC) staining was conducted to identify the expression of tissue-specific proteins in the newly generated MTJ tissues. Paxillin is a multidomain protein predominantly localized to focal adhesions and serves as a component of the integrin-mediated complex, which facilitates the anchoring of muscle cells to the tendon matrix at the MTJ (46). Thus, previous studies have used Paxillin as a representative marker to characterize MTJ (14). IHC staining and quantitative analysis for Paxillin revealed that the K/M@SM-PA hydrogel had a remarkable capacity to promote MTJ formation, as demonstrated by the highest staining intensity of Paxillin among the four groups (3.40-fold for K/M@SM-PA versus Ctrl, P < 0.001; 2.54-fold for K/M@SM-PA versus SM-PA, P < 0.01; 1.64-fold for K/M@SM-PA versus M@SM-PA, P < 0.05) (Fig. 2, D and I). In addition, the expression levels of tenomodulin (TNMD) and myosin heavy chain 4 (MYH4), representative markers for tendon and muscle tissues, respectively, were also evaluated in the newly formed tissues. It was found that the K/M@SM-PA group notably enhanced TNMD expression as compared to the Ctrl, SM-PA, and M@SM-PA groups (2.93-fold for K/M@SM-PA versus Ctrl, P < 0.01; 2.31-fold for K/M@SM-PA versus SM-PA, P < 0.05; 1.62-fold for K/M@SM-PA versus M@SM-PA, P > 0.05) (Fig. 2, E and J). TNMD has been recognized as a late marker associated with tendon morphogenesis, suggesting that the K/M@SM-PA hydrogel promotes the formation of mature tendon tissues (47). Besides, we also observed that the muscle fibers in K/M@SM-PA group showed stronger staining for MYH4 than those of the other three groups (Fig. 2F). Quantitative analysis of MYH4 staining confirmed the highest intensity in the K/M@SM-PA group, further highlighting its effectiveness in promoting muscle regeneration (1.52-fold for K/M@SM-PA versus Ctrl, P < 0.01; 1.46-fold for K/M@SM-PA versus SM-PA, P < 0.05; 1.10-fold for K/M@SM-PA versus M@SM-PA, P > 0.05) (Fig. 2K). Together, the above results highly demonstrated that the K/M@SM-PA hydrogel effectively promoted the structural regeneration of injured MTJ.

The functional recovery of repaired MTJ was further evaluated by gait analysis and mechanical test. Gait analysis is a feasible and noninvasive approach to assess MTJ functions through the evaluation of behavioral phenotypes. The paw prints of rats were captured using real-time fluorescence imaging system during walking, as depicted in Fig. 3 (A to C). A visual demonstration of a rat’s walking motion through the fluorescence walkway was shown in movie S2. At the designated time points (1, 2, and 4 weeks after surgery), rat paw prints were collected and subjected to a comprehensive analysis of gait parameters, including spatiotemporal parameters (stride length, swing time, and swing speed) and intensity parameters (mean intensity, max contact mean intensity, and max contact max intensity) (Fig. 3, D and E). As pain levels increased, the walking motion of rats was adversely affected, leading to a decrease in all mentioned parameters, except for swing time. The results showed gait abnormalities for all groups at 1 week after surgery, as evidenced by obviously reduced stride length and intensity compared to those of normal rats (Fig. 3, F and I to K). From weeks 1 to 4, these parameters progressively approached and even exceeded those of the normal rats, with the K/M@SM-PA group exhibiting the most noticeable recovery (Fig. 3, F to K). Specifically, on week 2 postoperatively, the stride length and swing speed values in the K/M@SM-PA group was significantly higher than those of the Ctrl group (P < 0.05) (Fig. 3, F and H). In addition, the swing speed value of rats in the K/M@SM-PA group had exceeded that of the normal rats at 2 weeks after surgery (Fig. 3H). In terms of swing time, the K/M@SM-PA group showed the lowest values at 1 and 2 weeks after surgery, indicating an improved walking motion after K/M@SM-PA hydrogel treatment, although there were no significant differences between groups (Fig. 3G). Besides, the intensity parameters of the K/M@SM-PA group exhibited the highest levels across all groups, including mean intensity, max contact mean intensity, and max contact max intensity at 4 weeks after surgery (Fig. 3, I to K, and fig. S6). This suggests a more stable standing posture with reduced pain in rats following K/M@SM-PA treatment. Collectively, the presented gait analysis suggests a notable improvement in MTJ functional recovery following the implantation of the bioactive fiber-reinforced hydrogel.

Fig. 3. — (A and B) Schematic illustration of the gait analysis in sagittal (A) and coronal planes (B). (C) Representative gait patterns. (D) Illustration of stride length. LF, left front paw; LH, left hind paw; RF, right front paw; RH, right hind paw. (E) Illustration of standing time, swing time, and gait intensity. Swing speed is calculated as the ratio of stride length to swing time. (F to H) Quantitative analysis of spatiotemporal parameters (n = 3 normal rats or 6 experimental rats per group), including stride length (F), swing time (G), and swing speed (H). The dashed lines represent the values obtained from normal rats. Beeswarm plots (small circular dots) represent technical replicates (each walking cycle) that are color coded in accordance with their corresponding rats (squares). (I to K) Quantitative analysis of intensity parameters (n = 3 normal rats or 6 experimental rats per group), including mean intensity (I), max contact mean intensity (J), and max contact max intensity (K). The dashed lines represent the values obtained from normal rats. Beeswarm plots (small circular dots) represent technical replicates (each walking cycle) that are color coded in accordance with their corresponding rats (squares). (L) Schematic illustration of the mechanical tensile test for repaired MTJ samples at 4 weeks after surgery. (M) Representative tensile stress–strain curves of repaired MTJ samples in different groups. (N) The tensile modulus of repaired MTJ samples in different groups (n = 5 to 6 rats per group). The dashed line represents the values obtained from normal rats. (O) Table showing the tensile modulus values of repaired MTJ samples in different groups (n = 5 to 6 rats per group). Results are shown as means ± SD. *P < 0.05. AU, arbitrary units. Schematic illustrations were created using BioRender (www.biorender.com) and Servier Medical Art (https://smart.servier.com).

In addition, considering MTJ’s role as a load-bearing tissue, the mechanical properties of repaired MTJ hold great importance for its functionality. A mechanical test was performed to determine the mechanical properties of repaired MTJ following different treatments at 4 weeks after surgery (Fig. 3L). The strain-stress curve was recorded, and the slope of the liner region on the curve was used for calculating the tensile modulus (Fig. 3M). We found that the repaired MTJ in the K/M@SM-PA group (20.64 ± 6.22 MPa) had a markedly increased tensile modulus compared to the Ctrl (11.87 ± 5.96 MPa, P < 0.05), SM-PA (10.37 ± 3.12 MPa, P < 0.05), and M@SM-PA (13.76 ± 5.01 MPa, P > 0.05) groups (Fig. 3, N and O), which could contribute to the improved walking motion of rats treated with the K/M@SM-PA hydrogel as evidenced by gait analysis (Fig. 3, F to K). While the K/M@SM-PA group exhibited the highest mechanical strength in the repaired MTJ tissues among all four groups, it remained weaker than that of the native MTJ. This difference could be attributed to the incomplete repair of the MTJ within the limited 4-week duration, emphasizing the need for long-term evaluations in future studies. Rats in the K/M@SM-PA group demonstrated a similar or even better walking motion compared to normal rats, suggesting that the implantation of the bioactive fiber-reinforced hydrogel effectively supported the physiological function of the MTJ in force transmission. Together, these results demonstrated that the bioactive fiber-reinforced hydrogel substantially enhanced the functional recovery of repaired MTJ by improving walking motion and mechanical properties.

While there have been limited studies on tissue engineering approaches for MTJ regeneration, their investigations have primarily focused on in vitro experiments, lacking essential in vivo evaluations to assess their efficacy in repairing MTJ injuries, particularly in terms of functional recovery. Our study provides a comprehensive in vivo efficacy assessment of the tissue engineering scaffold in promoting structural restoration and functional recovery of MTJ injuries. In this developed fiber-reinforced hydrogel system, MSC incorporation promoted the repair of both tendon and muscle tissues as well as improved the integration of muscle-tendon interface (Fig. 2, B and C). This positive effect could be attributed to the regenerative capabilities of MSCs, driven by their myogenic or tenogenic differentiation abilities and their paracrine functions (48, 49). In addition, the introduction of Klotho further induced tissue maturation and remodeling, as evidenced by the significantly increased Paxillin expression at the muscle-tendon interface and more tendon-like tissue formation, in the K/M@SM-PA group as compared to the M@SM-PA group (Fig. 2, B to D, G, and I). The process of MTJ remodeling toward its original structure assumes pivotal importance, as it ensures its inherent mechanical properties for functional maintenance, particularly in a stress-transfer region like the MTJ. However, the precise mechanisms underlying the enhanced regeneration of MTJ by the K/M@SM-PA hydrogel remained elusive and need to be further explored.

In vivo proteomics reveals the underlying mechanism of bioactive fiber-reinforced hydrogel promoting MTJ regeneration

To elucidate the mechanisms underlying the improved MTJ regeneration induced by K/M@SM-PA, we performed in vivo label-free proteomics analysis for the regenerated MTJ tissues at 2 weeks after surgery. Three independent replicates from the M@SM-PA and K/M@SM-PA groups were sequenced, and the heatmap of differentially expressed proteins (DEPs) after clustering analysis showed a notable difference in protein expressions between these two groups (Fig. 4A). Principal components analysis (PCA) revealed clear clustering of the three replicates from each group (Fig. 4B). As shown by the volcano plot, a total of 937 proteins were identified, with 193 up-regulated DEPs and 553 down-regulated DEPs (K/M@SM-PA versus M@SM-PA) (Fig. 4C). To obtain functional insights into these DEPs, Gene Ontology (GO) enrichment analysis was performed to uncover the changed biological processes (BPs), cellular components (CCs), and molecular function (MF). As shown in Fig. 4D, several GO terms highly associated with MTJ regeneration were enriched from the up-regulated DEPs (K/M@SM-PA versus M@SM-PA), including “muscle system process,” “striated muscle contraction,” “skeletal muscle contraction,” “muscle structure development,” and “skeletal muscle tissue development” in BP; “myosin complex,” “anchoring junction,” “focal adhesion,” and “muscle-tendon junction” in CC, and “muscle alpha-actin binding” in MF. Most of these terms were related to the development and functional maintenance of skeletal muscle, indicating that the incorporation of Klotho into the fiber-reinforced hydrogel system could effectively promote the regeneration of skeletal muscle in MTJ defect, which was consistent with the histological results (Fig. 2, B, C, F, H, and K). The BinGO analysis for up-regulated DEPs also showed consistent results (fig. S7). Several CC terms associated with muscle-tendon interface were also identified, including “anchoring junction,” “focal adhesion,” and “muscle-tendon junction” (Fig. 4D), which could be attributed to the up-regulated MTJ marker expression and improved muscle-tendon integration (Fig. 2, D and I). Among these terms, “focal adhesion” and “anchor junction” were pivotal components of MTJ. They link to the actin filaments of sarcolemma that attaches to the extracellular laminin, facilitating the anchoring of the muscle fibers to the tendon ECM (50). However, there was no tendon-specific terms were enriched, probably owing to the lack of enough characteristic markers of tendon. To overcome the limitations of DEP enrichment analysis, we also conducted gene set enrichment analysis (GSEA) based on all identified proteins. The results revealed that multiple muscle-related BP, CC, and MF terms were significantly altered when comparing K/M@SM-PA with M@SM-PA (Fig. 4E and fig. S8), confirming the notable effect of Klotho in promoting muscle regeneration, which was consistent with the previous report (34).

Fig. 4. — (A) Heatmap of DEPs between K/M@SM-PA and M@SM-PA after hierarchical cluster analysis (n = 3 rats per group). (B) PCA plot of proteomics data in these two groups (n = 3 rats per group). (C) Volcano plot of protein expression in K/M@SM-PA versus M@SM-PA. (D) GO terms enriched from up-regulated DEPs associated with MTJ regeneration (K/M@SM-PA versus M@SM-PA). (E) GSEA plots associated with muscle regeneration (K/M@SM-PA versus M@SM-PA). (F) GO terms enriched from down-regulated DEPs associated with oxidative stress (K/M@SM-PA versus M@SM-PA). (G) GO terms enriched from down-regulated DEPs associated with inflammation (K/M@SM-PA versus M@SM-PA). (H) GO terms enriched from down-regulated DEPs associated with cell death (K/M@SM-PA versus M@SM-PA). (I) GO terms enriched from up-regulated DEPs associated with cell differentiation (K/M@SM-PA versus M@SM-PA). (J) GSEA plots associated with cell differentiation/phenotype maintenance (K/M@SM-PA versus M@SM-PA). (K) Network of the MTJ regeneration-related BP enriched from all DEPs with fold change >1.5. The DEPs used to enrich specific BPs are also shown. The similar terms were categorized into one specific BP and marked in the same color.

Subsequently, the enrichment analysis for down-regulated DEPs (K/M@SM-PA versus M@SM-PA) was performed. It was found that multiple cellular processes associated with oxidative stress such as “H₂O₂ metabolic process,” “cellular response to H₂O₂/superoxide/oxygen radical,” and “regulation of response to ROS” were significantly suppressed (Fig. 4F). In addition, several inflammation-related terms such as “acute inflammatory response,” “cellular response to IL-7,” “inflammatory response,” and “positive regulation of acute inflammatory response” were also enriched from the down-regulated DEPs (Fig. 4G). It indicated that the K/M@SM-PA hydrogel held the potential to alleviate oxidative stress and inflammatory responses within the cell microenvironment following MTJ injury, consistent with the previous reports highlighting Klotho’s anti-inflammatory and antioxidant effects (51). Notably, we observed that the down-regulated DEPs were enriched to “regulation of NIK/NF-κB signaling” (Fig. 4G), which has been reported as the pathway inhibited by Klotho protein to exert its anti-inflammatory properties (52).

It was also observed that the down-regulated DEPs (K/M@SM-PA versus M@SM-PA) were enriched to several BPs associated with cell death including “cell death,” “apoptotic process,” “programmed cell death,” “muscle cell apoptotic process,” “regulation of striated muscle cell apoptotic process,” “cell death in response to H₂O₂,” and “cell death in response to oxidative stress” (Fig. 4H). It indicated the enhanced survival of cells in the K/M@SM-PA hydrogel–treated group and the potential protective effect of Klotho against oxidative stress–induced cell death, which is also supported by the BinGO analysis for the down-regulated DEPs (fig. S9). In the injured microenvironment, ROS are recognized as one of the primary factors to induce cell death (53). Therefore, we reasoned that the K/M@SM-PA hydrogel potentially protected the exogenous MSCs and the endogenous MTJ resident cells from oxidative stress–induced cell death, thereby promoting MTJ regeneration.

The induction of directed differentiation and the maintenance of functional phenotypes of stem cells are crucial for tissue regeneration. However, under conditions of oxidative stress, cell differentiation and phenotype maintenance may become compromised, potentially resulting in abnormal differentiation and phenotypic alterations (54). The K/M@SM-PA hydrogel showed a positive regulation of muscle cell development and differentiation, as evidenced by the BP terms enriched from the up-regulated DEPs (K/M@SM-PA versus M@SM-PA) (Fig. 4I). Consistently, GSEA revealed that several cellular processes involving cell differentiation/phenotype maintenance, including “regulation of cell morphogenesis” and “regulation of cell shape,” was significantly promoted in the K/M@SM-PA group compared to the M@SM-PA group (Fig. 4J). Figure 4K and fig. S10 presented the network of MTJ regeneration-related BP including “response to reactive oxygen species,” “striated muscle cell differentiation,” “myofibril assembly,” “acute-phase response,” “regulation of extrinsic apoptotic signaling pathway via death domain receptors,” and “cellular response to toxic substance,” as well as the DEPs to enrich these BPs. It was observed that “response to reactive oxygen species” is a key cellular process in this network, as the DEPs enriching this BP were also involved in other five processes, which should be further validated in the following experiments. The above results partially suggested that the K/M@SM-PA hydrogel could potentially facilitate the differentiation of transplanted MSCs or maintain the phenotype of resident cells in MTJ, thereby contributing to the enhanced MTJ regeneration.

Collectively, the proteomics analysis revealed that the manipulation of cell microenvironment within injured MTJ using the immunomodulatory and antioxidant fiber-reinforced hydrogel could potentially influence the behaviors of both transplanted MSCs and resident cell populations within the MTJ tissue, ultimately promoting MTJ regeneration. However, the intricate biological regulation of the functions of these diverse cell populations warrants further exploration.

Bioactive fiber-reinforced hydrogel promotes cell survival and supports tenogenic/myogenic differentiation of transplanted MSCs

MSCs have been regarded as an optimal cell source for stem cell therapies and tissue engineering because of their broad availability, multilineage differentiation potential, and paracrine functions (55). However, the unfavorable microenvironment, marked by inflammation and oxidative stress that often accompanies tissue injuries, usually triggers cell death and leads to insufficient survival of transplanted MSCs (28, 29). Previous clinical trials have reported that the survival rate of MSCs within the first day following transplantation is typically less than 1%, which considerably restricts their therapeutic efficacy (28). Our in vivo proteomics data indicated that, in comparison with the M@SM-PA group, the K/M@SM-PA group notably mitigated oxidative stress–induced cell death (Fig. 4, F and H). This regulation may play a crucial role in enhancing MTJ regeneration. Therefore, we performed in vitro experiments to confirm the effect of bioactive fiber-reinforced hydrogel on the regulation of ROS and cell survival.

To confirm the protective effects of Klotho-incorporated bioactive fiber-reinforced hydrogel on the survival of MSCs, we applied H₂O₂ and IL-1β stimulation in vitro to induce cellular oxidative stress and simulate the pathological environments of injured MTJ (56). 2′, 7′-Dichlorofluorescein-diacetate (DCFH-DA) assay and quantitative polymerase chain reaction (qPCR) were performed to evaluate the antioxidant activity of the hydrogel system. After MSCs were treated with H₂O₂ or IL-1β, the ROS-positive cells were significantly increased in the H₂O₂- or IL-1β–treated group compared to the Ctrl group (without H₂O₂ or IL-1β treatment), confirming that H₂O₂ and IL-1β treatment effectively promoted ROS generation and induced cellular oxidative stress of MSCs (Fig. 5, A and B, and fig. S11). Representative images and quantitative analysis revealed that the MSCs treated with H₂O₂/IL-1β + K@SM-PA hydrogel had a ROS-positive cell rate of 11.71 ± 0.77% and 23.02 ± 7.63% in H₂O₂- and IL-1β–induced ROS model, respectively, which were significantly lower than those treated with H₂O₂/IL-1β (94.15 ± 1.56% for H₂O₂, P < 0.0001 and 96.67 ± 0.68% for IL-1β, P < 0.0001) and H₂O₂/IL-1β + SM-PA hydrogel (86.05 ± 5.86% for H₂O₂, P < 0.0001 and 96.91 ± 1.93% for IL-1β, P < 0.0001) (Fig. 5, A and B, and fig. S11). qPCR results showed that following H₂O₂ stimulation, the expression levels of superoxide dismutase-1 (SOD-1), manganese-dependent superoxide dismutase (MnSOD, also known as SOD-2), and catalase (CAT) were markedly elevated in the H₂O₂ and H₂O₂ + SM-PA groups (Fig. 5, C to E), suggesting that MSCs were under increased oxidative stress and activated their intrinsic antioxidant defensive system. This is consistent with a previous study that treated C2C12 muscle cell line with various pro-oxidants, including H₂O₂, paraquat, and menadione, and found that C2C12 cells activate antioxidant defenses in response to oxidative stress, exhibiting a significant increase in the expression of several antioxidant enzymes, including MnSOD, CAT, Cu/Zn-superoxide dismutase, and glutathione peroxidase (57). In contrast, the MSCs in the H₂O₂ + K@SM-PA group were exposed to a lower oxidative stress level after Klotho treatment as evidenced by the markedly reduced expression of SOD-1, SOD-2, and CAT compared to the H₂O₂ and H₂O₂ + SM-PA groups (Fig. 5, C to E). Together, these results demonstrated that the fiber-reinforced hydrogel loaded with Klotho exhibited remarkable antioxidative bioactivity and could effectively scavenge ROS in the pathological microenvironment.

Fig. 5. — (A) Representative fluorescent images of intracellular ROS in MSCs under H₂O₂ stimulation for 24 hours. Green fluorescence indicates DCF. The nuclei were stained by Hoechst 33342. Scale bars, 200 μm. (B) Quantitative analysis of the percentage of ROS-positive cells from DCFH-DA assay (n = 4 randomly selected microscopic images per group). (C to E) Gene expression levels of *SOD-1*, *SOD-2*, and *CAT* in MSCs under H₂O₂ treatment for 24 hours (n = 3 independent experimental units per group). (F) Live/dead staining of MSCs under H₂O₂ treatment for 24 hours. (G) Quantitative analysis of cell viability of MSCs from live/dead staining images (n = 4 randomly selected microscopic images per group). (H) Schematic illustration of in vivo experiments evaluating the effect of bioactive fiber-reinforced hydrogel on survival of transplanted MSCs. (I) Representative fluorescent images showing the transplanted MSCs at 7 days after transplantation. MSCs were prestained with Dil (red) before transplantation. The nuclei were stained by 4′,6-diamidino-2-phenylindole (DAPI) (blue). Scale bars, 50 μm. (J) Quantitative analysis of the number of Dil⁺ MSCs per high-power field (HPF) from fluorescent images at 7 days after transplantation (n = 3 randomly selected microscopic images per group). (K and L) Quantitative analysis of IF staining for SCX and Myogenin in MSCs encapsulated within the fiber-reinforced hydrogel in growth medium or differentiation medium for 14 days (n = 4 randomly selected microscopic images per group). (M and N) Representative images of IF staining for SCX and Myogenin in MSCs within the fiber-reinforced hydrogel cultured in growth medium or differentiation medium for 14 days. Low magnification: scale bars, 100 μm; high magnification: scale bars, 25 μm. Results are shown as means ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Considering the excellent antioxidant bioactivity exhibited by the fiber-reinforced hydrogel, we sought to determine whether it can protect MSCs from oxidative stress–induced cell death. As shown in Fig. 5 (F and G), the MSCs in the H₂O₂ (79.46 ± 5.07%) and H₂O₂ + SM-PA (79.93 ± 3.35%) group had a notably decreased cell viability compared to the Ctrl group (94.18 ± 1.06%), while the H₂O₂ + K@SM-PA group could significantly rescue cell death induced by oxidative stress (89.34 ± 1.88%, P < 0.01 to H₂O₂ and H₂O₂ + SM-PA). Furthermore, we evaluated the survival of Dil prestained MSCs in the fiber-reinforced hydrogel 7 days after in vivo implantation into MTJ defects (Fig. 5H). More fluorescent signals were detected in the K/M@SM-PA group [107 ± 15 Dil⁺ cells per high-power field (HPF)] as compared to the M@SM-PA group (27 ± 13 Dil⁺ cells per HPF, P < 0.01) (Fig. 5, I and J). Therefore, the incorporated Klotho in the fiber-reinforced hydrogel could promote cell survival of transplanted MSCs by reducing oxidative stress, consistent with the results from proteomics (Fig. 4, F and H). We further assessed the potential of encapsulated MSCs to differentiate into muscle and tendon cells within our developed hydrogel system in vitro. The representative immunofluorescent (IF) staining images and quantitative analysis indicated that the bioactive fiber-reinforced hydrogel supported tenogenic and myogenic differentiation of MSCs, as evidenced by the increased expression of SCX and Myogenin, representative markers for tendon and muscle cells, respectively, in the differentiation medium as compared to those in the growth medium (Fig. 5, K to N). Furthermore, its role in regulating tenogenic and myogenic differentiation of MSCs within pathological microenvironment was assessed. MSC differentiation toward tenogenic and myogenic lineages was slightly impeded upon IL-1β stimulation, as evidenced by the reduced expression of both SCX and Myogenin in the IL-1β + M@SM-PA group compared to those without IL-1β treatment (fig. S12). However, the compromised differentiation capacity of MSCs was partially rescued by the K/M@SM-PA hydrogel, as demonstrated by the increased expression of SCX and Myogenin (P < 0.05) compared with the M@SM-PA hydrogel under IL-1β–stimulated condition (fig. S12). This indicated that the bioactive fiber-reinforced hydrogel could potentially protect the tenogenic and myogenic differentiation capacity of transplanted MSCs in pathological microenvironment.

Collectively, these results suggested that the Klotho-loaded fiber-reinforced hydrogel can effectively inhibit cellular oxidative stress, leading to improved survival of transplanted MSCs. Furthermore, within the specific microenvironment conducive to muscle and tendon development, and even under pathological conditions, these surviving MSCs exhibit the capacity to differentiate into tendon and muscle lineages within the fiber-reinforced hydrogel system, potentially facilitating the repair and regeneration of MTJ.

Bioactive fiber-reinforced hydrogel maintains the phenotype of myoblasts and tendon stem cells by inhibiting oxidative stress

As mentioned above, our in vivo proteomics data showed that the K/M@SM-PA hydrogel could inhibit oxidative stress and inflammatory responses and thereby maintain the phenotype and functions of endogenous and exogenous cells to initiate the regenerative processes of MTJ (Fig. 4). In addition to the transplanted MSCs, the resident cell populations within MTJ could also respond to the improved microenvironment modulated by the bioactive fiber-reinforced hydrogel, thereby initiating the cellular processes for MTJ regeneration. Given the proven antioxidant effect of the bioactive fiber-reinforced hydrogel on transplanted MSCs, we extended our evaluation to C2C12 cells and tendon stem/progenitor cells (TSPCs), representative for cells within the muscle and tendon tissue, respectively (Fig. 6A). Similarly, C2C12 and TSPCs were stimulated by H₂O₂ and IL-1β, and DCFH-DA assay was performed to evaluate the intracellular ROS. When treated with H₂O₂/IL-1β and H₂O₂/IL-1β + SM-PA, both C2C12 and TSPCs exhibited a notably higher number of ROS-positive cells than the Ctrl group, confirming the successful induction of oxidative stress in these two cell types (Fig. 6, B to E). It was also found that both types of cells in H₂O₂ + K@SM-PA group exhibited a substantially lower ROS production compared to the H₂O₂ + SM-PA groups (Fig. 6, B and C), exhibiting a decreased ROS-positive cell rate in both C2C12 (1.77 ± 1.26% versus 17.44 ± 2.78%, P < 0.05) and TSPCs (4.66 ± 2.11% versus 55.27 ± 9.93%, P < 0.0001) (Fig. 6, F and G). Besides, a similar but more significant effect was observed in C2C12 and TSPCs in the IL-1β stimulation model, with a significantly lower ROS-positive cell rate of C2C12 (1.42 ± 0.61% versus 22.33 ± 3.76%, P < 0.001) and TSPCs (3.80 ± 2.01% versus 67.28 ± 7.53%, P < 0.0001) in the K@SM-PA hydrogel compared to the SM-PA hydrogel (Fig. 6, D, E, H, and I). These results collectively confirmed that the developed fiber-reinforced hydrogel had a strong antioxidative capacity for muscle and tendon lineage cells.

Fig. 6. — (A) Schematic illustration of in vitro cell experiments to assess the impact of bioactive fiber-reinforced hydrogel on muscle and tendon cell behaviors. (B and C) Representative fluorescent images of intracellular ROS in C2C12 (B) and TSPCs (C) upon H₂O₂ stimulation for 24 hours. Scale bars, 200 μm. (D and E) Representative fluorescent images of intracellular ROS in C2C12 (D) and TSPCs (E) upon IL-1β stimulation for 20 min. Scale bars, 200 μm. (F and G) The percentage of ROS-positive cells in C2C12 (F) and TSPCs (G) stimulated by H₂O₂ for 24 hours (n = 4 randomly selected microscopic images per group). (H and I) The percentage of ROS-positive cells in C2C12 (H) and TSPCs (I) stimulated by IL-1β for 20 min (n = 4 randomly selected microscopic images per group). (J and K) Gene expression levels of *PAX-7* and *TNNT1* in C2C12 on day 7 (n = 3 independent experimental units per group). (L) Gene expression levels of *TNMD* in TSPCs on day 7 (n = 3 independent experimental units per group). (M and N) Quantitative analysis of IF staining for TNMD (n = 4 randomly selected microscopic images per group) and SCX (n = 4 randomly selected microscopic images per group) in TSPCs on day 7. (O and P) Representative images of IF staining for TNMD and SCX in TSPCs on day 7. Scale bars, 50 μm. Results are shown as means ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Schematic illustrations were created using Servier Medical Art (https://smart.servier.com).

The elevated oxidative stress in the harsh postinjury microenvironment often triggers changes in cell phenotype, potentially impairing the behaviors and functions of resident cell populations in muscle and tendon, thereby hindering MTJ regeneration (58, 59). Therefore, the effect of Klotho-loaded fiber-reinforced hydrogel on phenotype maintenance of C2C12 and TSPCs was evaluated. IL-1β, known to increase cellular ROS levels and induce irreversible phenotype changes in different cell types such as tendon and muscle cells (23, 60), was used in subsequent experiments to mimic pathological phenotype changes in C2C12 and TSPCs. The gene expression of myoblasts’ phenotypic markers (PAX-7 and TNNT1) was evaluated by qPCR. Compared to the Ctrl group, both the C2C12 cells in the IL-1β group and the IL-1β + SM-PA group exhibited markedly reduced expression levels of PAX-7 and TNNT1 (Fig. 6, J and K). However, the Klotho-loaded fiber-reinforced hydrogel effectively rescued their expression levels (Fig. 6, J and K). Consistently, IF staining for phenotypic markers of myoblasts (MYH4, MYOD1, and Myogenin) revealed a significant suppression of these proteins upon IL-1β stimulation in C2C12 cells, with partial restoration observed with the K@SM-PA hydrogel (fig. S13). These findings demonstrated that the Klotho-loaded fiber-reinforced hydrogel could preserve the phenotype of C2C12 cells in the IL-1β–stimulated pathological microenvironment. Similarly, we found that IL-1β treatment suppressed the gene expression of TNMD, a representative marker of TSPCs, which was partially reversed by the K@SM-PA hydrogel (Fig. 6L). IF staining was further performed to evaluate the protein expressions of TNMD and SCX. The representative images and quantitative analysis confirmed that IL-1β down-regulated the protein expressions of TNMD and SCX in TSPCs, indicative of phenotype inhibition, but the Klotho-loaded fiber-reinforced hydrogel could alleviate this inhibitory effect (Fig. 6, M to P). Collectively, these results demonstrated that the bioactive fiber-reinforced hydrogel could maintain the functional phenotype of myoblasts and tendon stem cells by reducing oxidative stress, thereby potentially promoting the regeneration of muscle, tendon, and the muscle-tendon interface in vivo.

Bioactive fiber-reinforced hydrogel guides macrophage polarization from proinflammatory to anti-inflammatory phenotype

Injuries to tendon and muscle are inevitably accompanied by inflammatory responses, which influence the healing processes (61, 62). Following tissue injuries, macrophages rapidly and extensively infiltrate the injury site and play a pivotal role in tissue repair (63). During the early phase of inflammatory responses, macrophages are activated and polarized into a proinflammatory (M1) phenotype and are responsible for the removal of dead cells and tissue debris; in the later phase of inflammatory responses, macrophages are prone to switch to the anti-inflammatory (M2) phenotype, which facilitates tissue remodeling by stimulating resident cell proliferation and ECM synthesis (64). The prolonged presence of proinflammatory macrophages has been reported to cause chronic inflammation and tissue injuries; thus, polarization shifting from M1 to M2 macrophages is indispensable for regeneration of injured tissues (65). Our in vivo proteomics data suggested that the inflammatory responses in the K/M@SM-PA group were down-regulated compared to the M@SM-PA group (Fig. 4G), suggesting the MTJ regeneration induced by the K/M@SM-PA hydrogel could partially be ascribed to the immunomodulatory function of Klotho. Previous studies have highlighted the anti-inflammatory properties of Klotho protein by inhibiting the nuclear factor κB (NF-κB) pathway in kidney cells and myocardial cells, which was correlated with the promoted M2 polarization of macrophages (66, 67). Thus, it is reasonable to speculate that the developed hydrogel system could potentially modulate macrophage polarization and consequently enhance MTJ regeneration.

In this study, lipopolysaccharide (LPS), a commonly used inducer of M1 macrophage polarization, was used (Fig. 7A). IF staining revealed that LPS stimulation significantly up-regulated the expression level of inducible nitric oxide synthase (iNOS) (M1 marker) in macrophages compared to the Ctrl group (P < 0.01), whereas both CD206 and arginase-1 (ARG-1) (M2 markers) expressions exhibited a notable decrease, confirming the M1 polarization of macrophages after LPS induction (Fig. 7, B to E). The K@SM-PA group had a substantially decreased protein expression level of iNOS compared to the LPS group (P < 0.05) and the SM-PA group (P < 0.05) (Fig. 7, B and E). In contrast, the protein expression of M2 markers (CD206 and ARG-1) was significantly higher in the K@SM-PA group compared to the LPS group and the SM-PA group, as shown in Fig. 7 (C to E). Consistently, we found that the increased CCR-7 expression following LPS stimulation was partially attenuated by the K@SM-PA hydrogel but not by the SM-PA hydrogel (Fig. 7F). Meanwhile, the K@SM-PA hydrogel induced a significantly higher expression of CD206 compared to both the LPS group (P < 0.05) and the SM-PA group (P < 0.05) (Fig. 7F). A similar trend was found in IL-10 expression, although there was no significant difference (Fig. 7F). Together, these findings highly suggested that the Klotho-loaded fiber-reinforced hydrogel exerted anti-inflammatory effects by guiding macrophage polarization from M1 to M2 phenotype.

To further confirm the regulatory effects of the developed hydrogel system on macrophage polarization in vivo, we conducted IHC for iNOS, CD206, and ARG-1 in repaired MTJ samples after 7 days of implantation with M@SM-PA and K/M@SM-PA hydrogels (Fig. 7G). The positive staining area for iNOS in the K/M@SM-PA group was significantly reduced compared to that in the M@SM-PA group (6.65 ± 0.61% versus 17.08 ± 3.79%, P < 0.01) (Fig. 7, H and I). Conversely, the K/M@SM-PA group showed a significantly higher positive staining area for both CD206 (13.67 ± 2.36% versus 5.95 ± 1.20%, P < 0.01) and ARG-1 (21.36 ± 2.55% versus 6.21 ± 1.24%, P < 0.0001) than the M@SM-PA group (Fig. 7, H and I). These results indicated that incorporating Klotho into the fiber-reinforced hydrogel could promote the phenotypic switch of macrophages from M1 to M2. This shift potentially contributes to the reduced inflammatory responses observed in the K/M@SM-PA group compared to the M@SM-PA group during MTJ regeneration, as revealed by in vivo proteomics analysis (Fig. 4G).

Previous studies have indicated that M1 macrophages and their secreted proinflammatory cytokines, such as IL-1β, tumor necrosis factor–α, and IL-6, hinder the growth and viability of MSCs, while the anti-inflammatory M2 macrophages support MSC growth by secreting several growth factors and cytokines including transforming growth factor–β (TGF-β), IL-10, and vascular endothelial growth factor (68–70). Excessive inflammation, mediated by M1 macrophages, can impede the effectiveness of MSCs therapy and MSCs-based tissue engineering, highlighting the potential to enhance the survival of transplanted cells by modulating the inflammatory microenvironment. This perspective provides additional insights into the improved cell survival observed with transplanted MSCs within the Klotho-loaded fiber-reinforced hydrogel after in vivo implantation (Figs. 4H and 5I), in addition to its antioxidative effects. Furthermore, previous research has indicated that an elevated ratio of M1 to M2 macrophages is associated with pathological fibrosis and scar formation during tendon healing (71). Postoperative tendon adhesion has also been correlated with the infiltration of M1 macrophages (72). Given that the K/M@SM-PA hydrogel exhibited immunomodulatory functions that guided macrophage polarization from M1 to M2 phenotype, it could consequently mitigate pathological fibrosis and promote the formation of native tendon-like fibers, as evident in the results of histological staining in vivo (Fig. 2, B, C, and G).

DISCUSSION

To date, surgical suturing and conventional therapy are the mainstream clinical treatment approaches for MTJ injuries. However, these treatments often induce scar tissue formation and suture cut-through, lacking the native structure and enough mechanical properties required for functional maintenance, consequently leading to retear and failed MTJ reconstruction (3–5). A few previous studies have attempted to construct mechanically, structurally, and biochemically biomimetic scaffolds for MTJ repair and regeneration. For instance, Ladd et al. (16) fabricated a poly(ε-caprolactone)/collagen and poly(l-lactide)/collagen coelectrospun dual scaffolding system with regional mechanical property differences that mimic native MTJ. In vitro cell culture study showed that the developed dual scaffold was cytocompatible and facilitated cell attachment and myotube formation. In addition, Koeck et al. (18) developed self-assembled hierarchical collagen fibers with good mechanical stability and biomimetic ultrastructure. After coculture of NIH/3 T3 fibroblasts and C2C12 myoblasts on the collagen fiber assemblies, an in vitro MTJ model with the feature of interdigitation at muscle-tendon interface was preliminarily established. These two studies focused on modifying the mechanics and structure of engineered scaffolds to mimic the native MTJ, while the bioactivities for MTJ regeneration were ignored. In contrast, Gaffney et al. (14) revealed that the decellularized matrix from muscle and tendon that contained promyogenic and protenogenic bioactivities could promote the expression of MTJ makers in both C2C12 myoblasts and tendon fibroblasts. Furthermore, Kim and Kim (13) developed a bioprinted MTJ model using the bioinks of muscle- and tendon-derived decellularized ECM and human adipose-derived stem cells. The bioprinted MTJ constructs showed well-aligned structures and biochemical characteristics of MTJ, promoting the expression of MTJ-associated genes in vitro. While these in vitro MTJ constructs could potentially serve as a platform to reveal the interaction between muscle and tendon cells, their in vivo therapeutic effects for MTJ injuries have not been explored. Turner et al. (17) made an initial attempt at in vivo MTJ regeneration by applying decellularized ECM from small intestinal submucosa, providing biochemical factors and a suitable microenvironment for MTJ repair. The ECM scaffold induced the formation of vascularized and innervated skeletal muscle, generating 48% of the contractile force of the contralateral MTJ. However, comprehensive investigations on tendon and muscle-tendon interface regeneration, as well as functional recovery evaluations for pain and movement were lacking. Together, over the past decades, some progress has been made in the development of MTJ tissue engineering strategies. However, most of the developed MTJ scaffolds have been assessed in vitro, lacking crucial in vivo functional evaluations for MTJ repair efficacy. Notably, prior studies have overlooked the impact of the excessive oxidative stress and inflammatory responses in the pathological environment of injured MTJ, potentially disrupting the functions of endogenous and exogenous cells, as well as the regenerative processes.

To address these issues, our study developed a fiber-reinforced hydrogel that provides sufficient mechanical support for force transmission, along with immunomodulatory and antioxidant bioactivities to improve the challenging postinjury microenvironment, ultimately regulating the behaviors of both exogenous and endogenous cells and promoting the structural and functional regeneration of MTJ in vivo (Fig. 8). The aligned structure of 3D-printed PLGA scaffold endows the hydrogel system with robust mechanical properties close to the native MTJ, which could effectively support the force transmission in muscle-tendon interface and thereby maintain the physiological functions during the regenerative processes of MTJ. The incorporation of Klotho into the hydrogel system can alleviate oxidative stress and inflammation, thus creating a conducive regenerative microenvironment that preserves the function and phenotype of various cell populations within MTJ injuries. It enhances the survival of transplanted MSCs and supports their multidirectional differentiation capacity, possibly contributing to the enhanced myogenic/tenogenic differentiation in the subsequent regeneration of muscle and tendon. In addition, the improved microenvironment maintains the functional phenotype of the resident tendon/muscle cells within MTJ, as well as regulates macrophage polarization toward an anti-inflammatory phenotype.

Fig. 8. — It not only engineers an optimal cell microenvironment to facilitate tissue regeneration but also provides sufficient mechanical strength for functional maintenance. Schematic illustrations were created using BioRender (www.biorender.com).

During tissue damage, the progress of inflammation and oxidative stress are closely linked. Proinflammatory cytokines can induce the generation of ROS, and elevated levels of ROS can further exacerbate inflammatory responses by promoting macrophage polarization to the M1 phenotype (73, 74). Therefore, it is highly desirable to simultaneously modulate the inflammatory and oxidative microenvironment for tissue regeneration, as demonstrated in this study. NF-κB–inducing kinase (NIK) is involved in the activation of the noncanonical NF-κB pathway, playing a crucial role in the inflammatory and oxidative stress responses. Previous studies have revealed that the anti-inflammatory effects of Klotho are attributed to its ability to inhibit NF-κB pathway activation by suppressing phosphatidylinositol 3-kinase/Akt, IκB kinase α, or NIK (52, 75). Notably, our proteomics data revealed that the K/M@SM-PA hydrogel significantly down-regulated the “regulation of NIK/NF-κB signaling” compared to the M@SM-PA hydrogel (Fig. 4G). These findings suggested that the immunomodulatory and antioxidant bioactivities exerted by the Klotho-loaded fiber-reinforced hydrogel may be related to the inhibition of the NIK/NF-κB pathway. However, further research is required to confirm these findings conclusively.

During the tissue regeneration process, actively functioning cells serve as the essential building blocks that are indispensable for tissue repair. Considering the complex biological composition of MTJ at the muscle-tendon interface, multiple types of cells originating from both tendon and muscle reside within this interface region. The developed fiber-reinforced hydrogel in this study can promote MTJ regeneration largely due to the establishment of a suitable microenvironment for optimal biological regulation of these diverse cell populations. However, our developed scaffold has not been designed to closely mimic the highly structured organization of muscle and tendon tissues, which could potentially affect its regenerative capacity. Our in vivo results indeed demonstrate that the SM-PA group did not exhibit substantial improvement in MTJ regeneration compared to the control group (Fig. 2). Therefore, for future scaffold design, we will consider a more biomimetic material system based on the current bioactive fiber-reinforced hydrogel, such as mimicking the highly parallel fiber structures of muscle and tendon, to achieve more effective MTJ regeneration performance.

In this study, a bioactive fiber-reinforced hydrogel with sufficient mechanical strength, antioxidant and immunomodulatory bioactivities, stem cell–deliverable properties and endogenous cell-regulatory functions was developed to simultaneously promote the structural and functional regeneration of MTJ. In this hydrogel system, the 3D-printed PLGA scaffolds with aligned fibers endowed the hydrogel with enough mechanical strength to maintain the physiological functions of MTJ. Owing to the suppression of oxidative stress by the incorporation of Klotho, the scaffold provided a conducive microenvironment for the survival and differentiation of transplanted MSCs, while maintaining the functional phenotypic characteristics of TSPCs and myoblasts, thus initiating the regenerative processes of MTJ. Furthermore, it exhibited immunomodulatory functions by repolarizing macrophages from proinflammatory M1 to anti-inflammatory M2 phenotype. Distinct from previous MTJ tissue engineering studies primarily conducted in vitro, this study tailored an optimized cell microenvironment to regulate diverse cell populations in vivo for enhanced structural restoration and functional recovery of MTJ. The insights gained from this study hold great promise for the future treatment of MTJ injuries.

MATERIALS AND METHODS

Fabrication of 3D-printed PLGA scaffolds

3D-printed PLGA scaffolds were fabricated by FDM rapid prototyping machine (FoChif Tech, China). Specifically, PLGA powder (molecular weight, 66,000 to 107,000; LA/GA 75:25; P1941, Sigma-Aldrich, USA) was added to the extrusion chamber and heated to 100°C. After PLGA powder was fully molten, the temperature was set at 90°C, and the molten PLGA was extruded with a printing nozzle at a speed of 85 mm/min, forming a cylinder shape in a layer-down model of −45°/45° vertical to the z axis. The obtained 3D-printed PLGA scaffold was precisely cut into dimensions of 6 mm by 2 mm for subsequent experiments.

Preparation of bioactive fiber-reinforced hydrogel

Lyophilized SilMA foams (EFL-SilMA-001, Engineering For Life, Suzhou, China) were fully dissolved in 0.25% (w/v) lithium phenyl (2,4,6-trimethyl benzoyl) phosphinate (LAP) solution (EFL-LAP, Engineering For Life, Suzhou, China) with constant stirring at room temperature to a final concentration of 12% (w/v). Recombinant Klotho protein (0.05 μg; 100-53, PeproTech, USA) and/or 2 × 10⁶ primary rat bone marrow–derived MSCs were added to 50 μl of SilMA solution. The mixture was pipetted to achieve uniform dispersion of Klotho and MSCs in SilMA solution. Subsequently, the mixture was dropped onto the PLGA scaffolds (6 mm by 2 mm), followed by photocrosslinking using an ultraviolet (UV) irradiation (wavelength: 365 to 370 nm; light strength: 50 mW cm⁻²) for 40 s to obtain the bioactive fiber-reinforced hydrogel. The PLGA, SilMA, SilMA-PLGA, Klotho@SilMA, MSC@SilMA-PLGA, Klotho@SilMA-PLGA, and Klotho/MSC@SilMA-PLGA scaffolds were denoted as PA, SM, SM-PA, K@SM, M@SM-PA, K@SM-PA, and K/M@SM-PA, respectively.

SEM imaging

Samples were fixed using 2.5% (w/v) glutaraldehyde at 4°C overnight and rinsed with PBS and deionized water three times, respectively. The rinsed scaffolds were then lyophilized for 24 hours. The samples were coated with gold and imaged using a SEM (Zeiss supra55, Germany) to view the surface morphology and microstructure of the scaffolds. The fiber diameter of the PLGA scaffold and the pore size of the SilMA hydrogel were determined from the SEM images using the ImageJ software [National Institutes of Health (NIH), Bethesda, MD].

Swelling ratio

To evaluate the swelling ratio of the developed scaffolds, the PA, SM-PA and K@SM-PA scaffolds (n = 5 scaffolds per group) were lyophilized for 24 hours, followed by weighting the initial weight (Wi). Subsequently, the lyophilized scaffolds were immersed in PBS at 37°C. At the designated time points (6, 12, and 24 hours), the wet weight (Ww) of the swollen scaffolds was determined, and the swelling ratio was calculated using the equation

Swelling ratio (%) = (Ww - Wi) / Wi \times 100

Water contact angle

The water contact angle of the scaffolds was measured using a surface analyzer (OSA100, Lauda Scientific, Lauda-Königshofen, Germany) at room temperature and 50% humidity. Deionized water (5 μl) was dropped on the sample surface, and the resulting image of the air-liquid-solid interface at 1 s was taken to calculate the contact angle.

Mechanical test

The tensile mechanical properties of the PA, SM-PA and K@SM-PA scaffolds (2 cm by 2 mm, n = 5 scaffolds per group) were evaluated under uniaxial tensile loading using an electric universal testing machine (UTM2502, Sunstest, Shenzhen, China) equipped with a 50-N sensor at an elongation rate of 5 mm/min. Repaired MTJ tissues (3 cm by 3 mm, n = 6 rats per group) collected at 4 weeks after surgery and native MTJ tissues (3 cm by 3 mm, n = 5 rats) were subjected to mechanical test using the same parameters. To precisely measure the tensile properties of the MTJ tissue, the ends of the clamps were positioned as centrally as possible on the MTJ tissue samples to ensure that the force was applied to the muscle-tendon interface. The tensile modulus (MPa) of scaffolds and tissues was determined by calculating the slope of the linear region of strain-stress curves, and the failure force (N) of scaffolds and tissues was recorded at the point of rupture.

Rheological measurements

The rheological properties of the SM and K@SM hydrogels were evaluated using a rheometer (MCR 302, Anton Paar, Graz, Austria). The dynamic frequency sweep was conducted from 0.1 to 100 rad/s at 1% strain, and the dynamic strain sweep was performed from 0.1 to 100% strain at the speed of 10 rad/s. The storage modulus (G′) and the loss modulus (G″) were plotted against strain or angular frequency.

Cell culture

TSPCs were isolated from the tendon of 8-week-old Sprague-Dawley rats (~200 g) as described previously (76). Briefly, the Achilles tendon of rats, carefully separated from muscle and other soft tissues, was sectioned into tissue blocks of 1 mm by 1 mm by 1 mm. Then, the tissue blocks were digested with collagenase type I (2.5 mg/ml; 1904MG100, BioFroxx, Einhausen, Germany) at 37°C for 8 hours. After centrifuging at 1200 rpm for 5 min, the obtained cells were resuspended on cell culture dishes with low-glucose Dulbecco’s modified Eagle’s medium (DMEM; C11885500BT, Gibco, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS; 086–550, Wisent, Canada) and 1% penicillin-streptomycin (P/S; 15070063, Gibco, Carlsbad, CA).

Primary rat bone marrow–derived MSCs were purchased from Cyagen Biosciences (RASMX-01001, Suzhou, China) and cultured in low-glucose DMEM supplemented with 10% FBS and 1% P/S. To assess the myogenic potential of MSCs, cells were cultured with a myogenic induction medium consisting of high-glucose DMEM (C11995500BT, Gibco, Carlsbad, CA), 10% FBS, 1% P/S, and 5 μM 5-azacytidine (HY-10586, MCE, Shanghai, China) as described previously (77). After 24 hours, the myogenic induction medium was replaced with normal culture medium and cultured for 14 days. To assess the tenogenic potential of MSCs, cells were cultured with tenogenic induction medium for 14 days consisting of high-glucose DMEM, 10% FBS, 1% P/S, ascorbic acid (50 μg/ml; ST1434, Beyotime, Shanghai, China), BMP-12 (50 ng/ml; HY-P700021AF, MCE, Shanghai, China), CTGF (100 ng/ml; HY-P78104, MCE, Shanghai, China), and TGF-β3 (10 ng/ml; HY-P700152AF, MCE, Shanghai, China) (78).

RAW 264.7 macrophages (murine mononuclear macrophage leukemia cells) and C2C12 cell lines (myoblasts) used in this study were provided by L. Wang (School of Medicine, Southeast University, China) and Y. Zhou (School of Medicine, Zhejiang University, China), respectively. RAW 264.7 and C2C12 cells were cultured with high-glucose DMEM supplemented with 10% FBS and 1% P/S. All types of cells were cultured within a humidified atmosphere with 5% CO₂ at 37°C. The medium was changed every 2 to 3 days before reaching 80 to 90% confluence.

Cell proliferation

MSCs were seeded in a 96-well plate at a density of 1 × 10³ cells per well and treated with scaffold-conditioned medium for 1, 3, and 5 days. At the designated time points, the culture medium was replaced by a 10% CCK-8 working solution (C6005, New Cell & Molecular Biotech, Suzhou, China) and incubated at 37°C with 5% CO₂ for 1 hour. The absorbance was measured at 450 nm with a microplate reader (BioTek, Winooski, USA). Scaffold-conditioned medium was prepared according to the ISO standard “ISO 10993-12: Biological evaluation of medical devices, Part 12: Sample preparation and reference materials.”

Cell viability

To evaluate the cytocompatibility of the bioactive fiber-reinforced hydrogel, 2 × 10⁵ MSCs were resuspended in 50 μl of SM or K@SM solution, and the mixture was dropped onto the PLGA scaffolds (6 mm by 2 mm), followed by photocrosslinking using a UV irradiation (wavelength: 365 to 370 nm; light strength: 50 mW cm⁻²) for 40 s. The MSCs-seeded hydrogels were placed in a low-adherent 24-well plate and cultured in growth medium for 3 days. Subsequently, the MSCs-seeded hydrogels were incubated in the Calcein-AM/PI Staining Kit (C542, Dojindo, Kumamoto, Japan) working solution at 37°C with 5% CO₂ for 20 min. To evaluate the viability of MSCs in a harsh microenvironment, cells were cultured in growth medium containing 400 μM H₂O₂ (ZY-N191222, Zeye, Shanghai, China) for 24 hours to simulate the oxidative stress status. Calcein acetoxymethyl ester (Calcein-AM)–stained live cells and propidium iodide (PI)–stained dead cells were examined, and images were taken using a fluorescence microscope (Carl Zeiss, Oberkochen, Germany) within the same field of view. Quantitative analysis was performed on randomly selected microscopic images from independent experimental units (scaffolds or culture wells) of each group. The number of live and dead cells in the corresponding images was counted blindly. Cell viability was then determined by calculating the ratio of the number of live cells to the total number of cells (live + dead cells).

Intracellular ROS measurement

Cells were cultured in a 96-well plate at a density of 2 × 10³ cells per well and treated with scaffold-conditioned medium for 24 hours. To induce the generation of ROS, 200 μM H₂O₂ (ZY-N191222, Zeye, Shanghai, China) or IL-1β (2 ng/ml; Z03014, Genscript, Nanjing, China) was added into the medium to stimulate cells for 24 hours or 20 min, respectively. Intracellular ROS was measured using the Reactive Oxygen Species Assay Kit (S0033S, Beyotime, Shanghai, China) according to the manufacturer’s protocol. Briefly, the cells were incubated in a working solution containing DCFH-DA probe at 37°C for 20 min. Cellular esterase deacetylates the probe, which then reacts with ROS to generate a fluorescent compound (DCF). DCF fluorescence in cells was observed and imaged using an inverted fluorescence microscope (Carl Zeiss, Oberkochen, Germany) to measure the ROS. Hoechst (C1027, Beyotime, Shanghai, China) was used to reveal the nuclei of the cells. The groups without H₂O₂ or IL-1β stimulation were defined as the control group (Ctrl). Quantitative analysis was performed on randomly selected microscopic images from independent experimental units (culture wells) of each group. The number of DCF⁺ cells and nuclei in the corresponding images was blindly counted. The percentage of ROS-positive cells was determined by calculating the ratio of the number of DCF⁺ cells to the total number of cells.

RNA isolation and qPCR

RAW 264.7 was seeded in a 24-well plate at 2 × 10⁵ cells per well and cultured with scaffold-conditioned medium for 24 hours. Then, LPS (100 ng/ml; BS904, Biosharp, Anhui, China) was added to the medium for 24 hours to induce M1 macrophage polarization. MSCs were seeded in a 12-well plate at 5 × 10⁴ cells per well and cultured with scaffold-conditioned medium for 24 hours. Then, 200 μM H₂O₂ was added to the medium for 24 hours to mimic the pathological microenvironment. TSPCs and C2C12 were seeded in a 12-well plate at 1 × 10⁴ cells per well and cultured with scaffold-conditioned medium for 24 hours. Then, IL-1β (10 ng/ml) was added to the medium for 7 days to mimic the pathological microenvironment. The groups without LPS/H₂O₂/IL-1β stimulation were defined as the control group (Ctrl). The total RNA was extracted, and the gene expression was analyzed using a real-time qPCR assay. The reagents used were listed as follows: total RNA extraction kit (DP424, Tiangen, Beijing, China), cDNA reverse transcription kit (FSQ-201, Toyobo, Japan), and qPCR kit [SYBR Green Premix Pro Taq HS qPCR Kit, AG11718, Accurate Biotechnology (Hunan) Co., Ltd., China]. All of the procedures were performed following the manufacturer’s protocol. Primer (Genscript, Nanjing, China) sequences used in this study are summarized in Table 1.

Table 1. Primers used for qPCR.

Target gene	Species	Forward	Reverse
GAPDH	Rat/Mouse	GCAAGTTCAACGGCACAG	CGCCAGTAGACTCCACGAC
IL-10	Mouse	CCAAGCCTTATCGGAAATGA	TTTTCACAGGGGAGAAATCG
CD206	Mouse	AGCTTCATCTTCGGGCCTTTG	GGTGACCACTCCTGCTGCTTTAG
CCR-7	Mouse	ATGGACCCAGGTGTGCTTCT	TCAGTATCACCAGCCCGTTG
TNNT1	Mouse	TCAATGTGCTCTACAACCGCA	ACCCTTCCCAGCCCCC
PAX-7	Mouse	CTGGATGAGGGCTCAGATGT	GGTTAGCTCCTGCCTGCTTA
TNMD	Rat	GGGTGGTCCCGCAAGTGAAGGTG	GCCTCGACGACAGTAAATACAACAGT
SOD-1	Rat	TGGGGACAATACACAAGGCT	GGTCTCCAACATGCCTCTCTCAT
SOD-2	Rat	CGTCACCGAGGAGAAGTACCA	GGCTCAGGTTTGTCCA
CAT	Rat	CCAGTACAACTCCCAGAAGCCTAA	TCCCTTGGCAGCTATGTGAGA

Open in a new tab

IF staining

RAW 264.7 was seeded in a 96-well plate at 5 × 10⁴ cells per well and cultured with scaffold-conditioned medium for 24 hours followed by LPS (100 ng/ml) stimulation for 24 hours. TSPCs were seeded in a 96-well plate at 1 × 10³ cells per well and cultured with scaffold-conditioned medium for 24 hours followed by IL-1β (10 ng/ml) treatment for 7 days. C2C12 were seeded in a 48-well plate at 1 × 10³ cells per well and cultured with scaffold-conditioned medium for 24 hours followed by IL-1β (10 ng/ml) treatment for 7 days. MSCs were seeded in the SM-PA and K@SM-PA scaffold at 1 × 10⁵ cells per scaffold, placed in a low-adherent 96-well plate, and cultured in growth medium or myogenic/tenogenic induction medium for 14 days. Following three washes in PBS, cells were then fixed in 4% paraformaldehyde (PFA) for 20 min, permeabilized with 1% (v/v) Triton X-100 (P0096, Beyotime, Shanghai, China) for 10 min, and subsequently blocked with QuickBlock Blocking Buffer for Immunol Staining (P0260, Beyotime, Shanghai, China) for 20 min. Subsequently, cells were incubated overnight at 4°C with primary antibodies. Following three washes in PBS, they were stained with 488-conjugated goat anti-rabbit immunoglobulin G (IgG) (SA00013-2, Proteintech, Wuhan, China) at room temperature for 1 hour. 4′,6-Diamidino-2-phenylindole (C1002, Beyotime, Shanghai, China) was used for nuclear staining at room temperature for 5 min. All antibodies used for IF staining are listed in Table 2. The observation and imaging of IF staining were conducted using a fluorescence microscope (Carl Zeiss, Oberkochen, Germany). Quantitative analysis was performed on randomly selected microscopic images from independent experimental units (scaffolds or culture wells) of each group. The mean gray value (IntDen/Area) of IF staining was quantified using ImageJ software (NIH, Bethesda, MD). The staining intensity relative to the Ctrl group or the M@SM-PA group (cultured in growth medium) was calculated.

Table 2. Antibodies used for IF and IHC staining.

Antibody	Company	Code	Applications
iNOS	Affinity	AF0199	IF, IHC
ARG-1	Proteintech	16001-1-AP	IF, IHC
CD206	Proteintech	18704-1-AP	IF, IHC
Paxillin	Proteintech	10029-1-Ig	IHC
MYH4	Proteintech	20140-1-AP	IF, IHC
TNMD	Abcam	ab203676	IF, IHC
SCX	Abcam	ab58655	IF
MYOD1	Proteintech	18943-1-AP	IF
Myogenin	Abclonal	A17427	IF
CoraLite488-conjugated Goat Anti-Rabbit IgG(H + L)	Proteintech	SA00013-2	IF
HRP-labeled Goat Anti-Rabbit IgG(H + L)	Beyotime	A0208	IHC

Open in a new tab

Animal model

The animal experiment protocol was approved by the Animal Experimental Ethical Inspection Committee of Southeast University (approval number: 20220401060). Sprague-Dawley rats (~200 g) were anesthetized with sodium pentobarbital by intraperitoneal injection at a dosage of 50 mg/kg. After induction of anesthesia, the middle of the gastrocnemius muscle and Achilles tendon was partly removed and an MTJ window defect (6 mm by 2 mm) was created. The SM-PA (n = 9 rats), M@SM-PA (n = 15 rats), and K/M@SM-PA (n = 15 rats) scaffolds were implanted into the MTJ defects, respectively. The 3D-printed PLGA scaffold (6 mm by 2 mm) was preimplanted into the defect area. A total of 2 × 10⁶ MSCs with/without 0.05 μg of Klotho protein were encapsulated in 50 μl of SilMA precursor solution and the mixture was dropped onto the 3D-printed PLGA scaffold, followed by in situ photocrosslinking of SilMA using a UV irradiation (wavelength: 365 to 370 nm; light strength: 50 mW cm⁻²) for 40 s (movie S1). The defect without any treatment was set as a control group (Ctrl, n = 9 rats). After in vivo implantation, the scaffolds (SM-PA, M@SM-PA, K/M@SM-PA) were fixed with sutures. At 1, 2, or 4 weeks after surgery, rats were euthanized for the collection of MTJ samples for various evaluations. Normal MTJ samples were obtained from the same site of healthy rats.

In addition, to evaluate the survival of the encapsulated MSCs in the M@SM-PA and K/M@SM-PA scaffolds after in vivo implantation, 2 × 10⁶ MSCs (per scaffold) were prestained with Dil (10 μg/ml) staining (C1036, Beyotime, Shanghai, China) as described previously (79). Then, M@SM-PA and K/M@SM-PA scaffolds were implanted into the MTJ defects of rats, and the samples were collected at 1 week after surgery. A fluorescence microscope (Carl Zeiss, Oberkochen, Germany) was used to observe and image the Dil fluorescence at an excitation wavelength of 543 nm. Quantitative analysis was performed on randomly selected microscopic images from biologically independent rats of each group. The number of Dil⁺ cells per HPF was counted blindly.

Histological and IHC staining

The repaired MTJ samples were fixed in 4% PFA, embedded in paraffin, and subsequently cut into 7-μm sections. Following deparaffinization and rehydration, the sections were stained with H&E (G1005, Servicebio, Wuhan, China) and Masson trichrome dye (KGE1112-8, Keygen, Nanjing, China) to analyze the structure and composition of neotissue. For IHC staining, the sections were deparaffinized, rehydrated, and followed by antigen retrieval in citrate antigen retrieval solution (P0081, Beyotime, Shanghai, China) at 98°C for 20 min. After being treated with QuickBlock Blocking Buffer for Immunol Staining (P0260, Beyotime, Shanghai, China), the sections were incubated in the primary antibodies at 4°C overnight. Subsequently, the sections were stained with horseradish peroxidase (HRP)–labeled Goat Anti-Rabbit IgG (A0208, Beyotime, Shanghai, China) at room temperature for 2 hours. 3,3-Diaminobenzidine (DAB) solution (DA1010, Solarbio, Bejing, China) was used for color development. Nuclear staining was performed using hematoxylin. The antibodies used for IHC staining are listed in Table 2. The mean gray value (IntDen/Area) of IHC staining was quantified using ImageJ software (NIH, Bethesda, MD). Staining intensity relative to the Ctrl group was calculated. The positive area (%) of indicated proteins at the repaired tissue was quantified by using the plugin IHC Toolbox in ImageJ software (NIH, Bethesda, MD). The muscle fiber diameter was measured from the H&E staining images of MTJ samples using ImageJ (NIH, Bethesda, MD). Tendon histological scores were performed to evaluate tendon tissue formation after surgery by evaluating six parameters, including fiber arrangement, fiber structure, vascularity, inflammation, nuclear roundness, and cell quantity (80). Quantitative analysis was performed on randomly selected microscopic images from biologically independent rats of each group.

Gait analysis

Gait analysis was conducted using the CatWalk XT system (Noldus, Netherlands) with the standard rat calibration (green light intensity, camera gain, run duration, and run maximum variation) to evaluate the gait patterns and motor functionality of the rat, as previously described (53). Before the test, the rats were trained to adjust to the environment and were subjected to at least five consecutive and compliant runs at each designated time point (weeks 1, 2, and 4). The CatWalk XT system’s core component is an enclosed walkway with a glass plate, over which rats traverse from one side to the other. Green light, entering from the plate’s long edge, is internally reflected, escaping only where the animal’s paws touch the glass, causing light scattering. High-speed video cameras located beneath the walkway capture these paw prints reflected by green light signals, transforming them into digital images by detecting intensity differences in the light received, allowing for detailed analysis of walking motion patterns. Stride length, swing time, swing speed, mean intensity, max contact mean intensity, and max contact max intensity were analyzed. The stride length is the distance between consecutive steps of the same foot. Swing time is the time when the paw is off the ground. Swing speed is calculated as the ratio of stride length to swing time. Mean intensity represents the average pressure across the entire paw at the moment of ground contact, whereas max contact max intensity and max contact mean intensity are specifically measured within the maximal contact area of a paw. SuperPlots were used to visualize both the biological replicates (rats) and the technical replicates (each walking cycle).

Proteomics analysis

To elucidate the mechanism of the bioactive fiber-reinforced hydrogel promoting MTJ regeneration, the MTJ samples at 2 weeks after surgery in the M@SM-PA and K/M@SM-PA groups were collected for in vivo proteomics analysis. The total proteins of each sample were extracted. Subsequently, the label-free quantitation–based proteomics analysis was performed to evaluate the protein expressions of the regenerated tissues in MTJ defects after M@SM-PA or K/M@SM-PA hydrogel treatment. DEPs were defined as proteins with P values lower than 0.05 through the pairwise comparisons. The DEPs were further used for GO analysis on the DAVID website (https://david.ncifcrf.gov). Protein expression values were subjected to z-score normalization across samples for heatmap generation. The network of DEPs and BP was graphically represented via the ClueGO and BinGO plugin in Cytoscape software. Further proteomics data analysis was conducted on OmicStudio tools (www.omicstudio.cn/tool). In Fig. 4K and figs. S9B and S10, the DEPs with a fold change >1.5 were used for the enrichment analysis by using the GlueGO and BinGO plugins. The other DEP analyses, including GO enrichment analysis (Fig. 4, D and F to I) and BinGO analysis (figs. S8 and S9A) were based on DEPs (P < 0.05) without fold change cutoff.

Statistical analysis

All statistical analysis was conducted using GraphPad Prism Software (GraphPad Software Inc., San Diego, CA). Data were shown as means ± SD. The unpaired two-tailed t test was used for the comparison between two groups, and one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons was applied to the comparison of more than two groups. It was considered statistically significant when the P value was below 0.05. In vitro experiments were performed in a minimum of three independent experimental units (scaffolds or culture wells) for each experimental group, and results were representative of at least two independently repeated experiments. In vivo animal experiments were performed with a sample size of 9 to 15 for each experimental group. Schematic illustrations were created using BioRender (www.biorender.com) and Servier Medical Art (https://smart.servier.com).

Acknowledgments

We thank L. Wang (School of Medicine, Southeast University, China) and Y. Zhou (School of Medicine, Zhejiang University, China) for providing the cell lines.

Funding: This work was financially supported by the National Natural Science Foundation of China 82372139 (W.Z.), 81901903 (W.Z.), 31900962 (J.C.), and 82072400 (Q.Y.); the Fundamental Research Funds for the Central Universities 2242023 K40034 (W.Z.); Shandong Provincial Key Research and Development Program 2021ZDSYS14 (W.Z.); Nanjing International Joint Research and Development Project 202201028 (Q.Y.); the Science and Technology Project of Jiangsu Province BK20200001 (Q.Y.) and BE2022718 (Q.Y.); and the Zhishan Scholars Programs of Southeast University (W.Z.).

Author contributions: Conceptualization: Y.S., W.Z., J.C., and Q.Y. Methodology: Y.S., W.Z., and R.S. Investigation: Y.S., J.C., and R.S. Funding acquisition: W.Z., J.C., and Q.Y. Writing—original draft: Y.S. and R.S. Writing—review and editing: R.S., W.Z., Z.C., and Q.Y. Formal analysis: Y.S., Z.C., C.L., and J.L. Data curation: J.L., P.Z., Y.D., and Q.M. Visualization: C.L., P.Z., and Y.D. Supervision: W.Z., J.C., and Q.Y.

Competing interests: The authors declare that they have no competing interests.

Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. The mass spectrometry proteomics data have been archived within the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the iProX partner repository (dataset identifier: PXD049378).

Supplementary Materials

This PDF file includes:

Supplementary Text

Figs. S1 to S13

Legends for movies S1 and S2

sciadv.adm7164_sm.pdf^{(6.4MB, pdf)}

Other Supplementary Material for this manuscript includes the following:

Movies S1 and S2

sciadv.adm7164_movies_s1_and_s2.zip^{(44.6MB, zip)}

REFERENCES AND NOTES

1.K. VanDusen, L. Larkin, “Muscle–tendon interface” in Regenerative Engineering of Musculoskeletal Tissues and Interfaces, S. Nukavarapu, J. Freeman, C. Laurencin, Eds. (Woodhead, 2015), part 3, chap. 17, pp. 409–429. [Google Scholar]
2.Vila Pouca M. C. P., Parente M. P. L., Jorge R. M. N., Ashton-Miller J. A., Injuries in muscle-tendon-bone units: A systematic review considering the role of passive tissue fatigue. Orthop. J. Sports Med. 9, 23259671211020731 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Yoshida K., Itoigawa Y., Maruyama Y., Kaneko K., Healing process of gastrocnemius muscle injury on ultrasonography using B-Mode imaging, power doppler imaging, and shear wave elastography. J. Ultrasound Med. 38, 3239–3246 (2019). [DOI] [PubMed] [Google Scholar]
4.Entwisle T., Ling Y., Splatt A., Brukner P., Connell D., Distal musculotendinous t junction injuries of the biceps femoris: An MRI case review. Orthop. J. Sports Med. 5, 2325967117714998 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Gatot C., Lie H. M. E., Tijauw Tjoen D. L., Arthroscopy technique: Repair of musculotendinous junction rotator cuff tears in the shoulder using a dynamic convergence suture bridge technique. Arthrosc. Tech. 12, e2117–e2126 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Millett P. J., Hussain Z. B., Fritz E. M., Warth R. J., Katthagen J. C., Pogorzelski J., Rotator cuff tears at the musculotendinous junction: Classification and surgical options for repair and reconstruction. Arthrosc. Tech. 6, e1075–e1085 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Wang D., Zhang X., Huang S., Liu Y., Fu B. S., Mak K. K., Blocki A. M., Yung P. S., Tuan R. S., Ker D. F. E., Engineering multi-tissue units for regenerative Medicine: Bone-tendon-muscle units of the rotator cuff. Biomaterials 272, 120789 (2021). [DOI] [PubMed] [Google Scholar]
8.Langer R., Vacanti J. P., Tissue engineering. Science 260, 920–926 (1993). [DOI] [PubMed] [Google Scholar]
9.Ma J., Yu H., Zhang X., Xu Z., Hu H., Liu J., Ren P., Kong X., Chen J., Yang K., Wang X., He X., Luo H., Chen G., Dual-targeted metal ion network hydrogel scaffold for promoting the integrated repair of Tendon–bone interfaces. ACS Appl. Mater. Interfaces 16, 5582–5597 (2024). [DOI] [PubMed] [Google Scholar]
10.Centeno C., Fausel Z., Stemper I., Azuike U., Dodson E., A randomized controlled trial of the treatment of rotator cuff tears with bone marrow concentrate and platelet products compared to exercise therapy: A midterm analysis. Stem Cells Int. 2020, e5962354 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Crow B. D., Haltom J. D., Carson W. L., Greene W. B., Cook J. L., Evaluation of a novel biomaterial for intrasubstance muscle laceration repair. J. Orthop. Res. 25, 396–403 (2007). [DOI] [PubMed] [Google Scholar]
12.Rothrauff B. B., Sasaki H., Kihara S., Overholt K. J., Gottardi R., Lin H., Fu F. H., Tuan R. S., Alexander P. G., Point-of-Care procedure for enhancement of meniscal healing in a goat model utilizing infrapatellar fat Pad-derived stromal vascular fraction cells seeded in photocrosslinkable hydrogel. Am. J. Sports Med. 47, 3396–3405 (2019). [DOI] [PubMed] [Google Scholar]
13.Kim W. J., Kim G. H., A bioprinted complex tissue model for myotendinous junction with biochemical and biophysical cues. Bioeng. Transl. Med. 7, e10321 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Gaffney L. S., Davis Z. G., Mora-Navarro C., Fisher M. B., Freytes D. O., extracellular matrix hydrogels promote expression of Muscle-tendon junction proteins. Tissue Eng. Part A 28, 270–282 (2022). [DOI] [PubMed] [Google Scholar]
15.Merceron T. K., Burt M., Seol Y.-J., Kang H.-W., Lee S. J., Yoo J. J., Atala A., A 3D bioprinted complex structure for engineering the muscle-tendon unit. Biofabrication 7, 035003 (2015). [DOI] [PubMed] [Google Scholar]
16.Ladd M. R., Lee S. J., Stitzel J. D., Atala A., Yoo J. J., Co-electrospun dual scaffolding system with potential for muscle-tendon junction tissue engineering. Biomaterials 32, 1549–1559 (2011). [DOI] [PubMed] [Google Scholar]
17.Turner N. J., Yates A. J., Weber D. J., Qureshi I. R., Stolz D. B., Gilbert T. W., Badylak S. F., Xenogeneic extracellular matrix as an inductive scaffold for regeneration of a functioning musculotendinous junction. Tissue Eng. Part A 16, 3309–3317 (2010). [DOI] [PubMed] [Google Scholar]
18.Koeck K. S., Salehi S., Humenik M., Scheibel T., Processing of continuous Non-crosslinked collagen fibers for microtissue formation at the Muscle-tendon interface. Adv. Funct. Mater. 32, 2112238 (2022). [Google Scholar]
19.Millar N. L., Murrell G. A. C., McInnes I. B., Inflammatory mechanisms in tendinopathy – towards translation. Nat. Rev. Rheumatol. 13, 110–122 (2017). [DOI] [PubMed] [Google Scholar]
20.Ye J., Xie C., Wang C., Huang J., Yin Z., Heng B. C., Chen X., Shen W., Promoting musculoskeletal system soft tissue regeneration by biomaterial-mediated modulation of macrophage polarization. Bioact. Mater. 6, 4096–4109 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Ackerman J. E., Best K. T., Muscat S. N., Loiselle A. E., Metabolic regulation of tendon inflammation and healing following injury. Curr. Rheumatol. Rep. 23, 15 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Mittal M., Siddiqui M. R., Tran K., Reddy S. P., Malik A. B., Reactive oxygen species in inflammation and tissue injury. Antioxid. Redox Signal. 20, 1126–1167 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Liu R., Zhou B., Zhang H., Chen Y., Fan C., Zhang T., Qin T., Han J., Zhang S., Chen X., Shen W., Chang J., Yin Z., Inhibition of ROS activity by controlled release of proanthocyanidins from mesoporous silica nanocomposites effectively ameliorates heterotopic ossification in tendon. Chem. Eng. J. 420, 129415 (2021). [Google Scholar]
24.Bosutti A., Degens H., The impact of resveratrol and hydrogen peroxide on muscle cell plasticity shows a dose-dependent interaction. Sci. Rep. 5, 8093 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Itoigawa Y., Yoshida K., Nojiri H., Morikawa D., Kawasaki T., Wada T., Koga A., Maruyama Y., Ishijima M., Association of recurrent tear after arthroscopic rotator cuff repair and superoxide-induced oxidative stress. Am. J. Sports Med. 49, 2048–2055 (2021). [DOI] [PubMed] [Google Scholar]
26.Leong D. J., Sun H. B., Mesenchymal stem cells in tendon repair and regeneration: Basic understanding and translational challenges. Ann. N. Y. Acad. Sci. 1383, 88–96 (2016). [DOI] [PubMed] [Google Scholar]
27.Zhang Q., Wang T., Wu X., Wang Y., Wu X., Zhou M., Li Z., Liu B., Zheng F., Sun X., Liu T., Thrombospondin-4 (TSP4) gene-modified bone marrow stromal cells (BMSCs) promote the effect of therapeutic angiogenesis in critical limb ischemia (CLI) of diabetic rats. Biochem. Biophys. Res. Commun. 532, 231–238 (2020). [DOI] [PubMed] [Google Scholar]
28.Li L., Chen X., Wang W. E., Zeng C., How to improve the survival of transplanted mesenchymal stem cell in ischemic heart? Stem Cells Int. 2016, 9682757 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Choumerianou D. M., Dimitriou H., Kalmanti M., Stem cells: Promises versus limitations. Tissue Eng. Part B Rev. 14, 53–60 (2008). [DOI] [PubMed] [Google Scholar]
30.Kuro-o M., Matsumura Y., Aizawa H., Kawaguchi H., Suga T., Utsugi T., Ohyama Y., Kurabayashi M., Kaname T., Kume E., Iwasaki H., Iida A., Shiraki-Iida T., Nishikawa S., Nagai R., Nabeshima Y. I., Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 390, 45–51 (1997). [DOI] [PubMed] [Google Scholar]
31.Kuro-o M., The Klotho proteins in health and disease. Nat. Rev. Nephrol. 15, 27–44 (2019). [DOI] [PubMed] [Google Scholar]
32.Matsumura Y., Aizawa H., Shiraki-Iida T., Nagai R., Kuro-o M., Nabeshima Y., Identification of the human klothogene and its two transcripts encoding membrane and secreted klotho protein. Biochem. Biophys. Res. Commun. 242, 626–630 (1998). [DOI] [PubMed] [Google Scholar]
33.Kurosu H., Yamamoto M., Clark J. D., Pastor J. V., Nandi A., Gurnani P., McGuinness O. P., Chikuda H., Yamaguchi M., Kawaguchi H., Shimomura I., Takayama Y., Herz J., Kahn C. R., Rosenblatt K. P., Kuro-o M., Suppression of aging in mice by the hormone Klotho. Science 309, 1829–1833 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Sahu A., Mamiya H., Shinde S. N., Cheikhi A., Winter L. L., Vo N. V., Stolz D., Roginskaya V., Tang W. Y., St Croix C., Sanders L. H., Franti M., Van Houten B., Rando T. A., Barchowsky A., Ambrosio F., Age-related declines in α-Klotho drive progenitor cell mitochondrial dysfunction and impaired muscle regeneration. Nat. Commun. 9, 4859 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Ahrens H. E., Huettemeister J., Schmidt M., Kaether C., von Maltzahn J., Klotho expression is a prerequisite for proper muscle stem cell function and regeneration of skeletal muscle. Skelet. Muscle 8, 20 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Zhu L., Xie H., Liu Q., Ma F., Wu H., Klotho inhibits H2O2-induced oxidative stress and apoptosis in periodontal ligament stem cells by regulating UCP2 expression. Clin. Exp. Pharmacol. Physiol. 48, 1412–1420 (2021). [DOI] [PubMed] [Google Scholar]
37.Chen H., Huang X., Fu C., Wu X., Peng Y., Lin X., Wang Y., Recombinant Klotho protects human periodontal ligament stem cells by regulating mitochondrial function and the antioxidant system during H₂O₂-induced oxidative stress. Oxid. Med. Cell. Longev. 2019, 9261565 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Kim B., Lee S.-M., Park S.-J., Lee S., Kim T., Role of Klotho and N-acetylcysteine in Oxidative Stress Associated with the Vitrification of Ovarian Tissue Cytoprotective Function of Klotho in Cryopreservation. Tissue Eng. Regen. Med. 20, 637–646 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Jiang W., Xiang X., Song M., Shen J., Shi Z., Huang W., Liu H., An all-silk-derived bilayer hydrogel for osteochondral tissue engineering. Mater. Today Bio 17, 100485 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Kobielarz M., Tomanik M., Mroczkowska K., Szustakiewicz K., Oryszczak M., Mazur A., Antończak A., Filipiak J., Laser-modified PLGA for implants: In vitro degradation and mechanical properties. Acta Bioeng. Biomech. 22, 179–197 (2020). [PubMed] [Google Scholar]
41.Shen B., Wang J., He T., Chen S., Wang X., Chen J., Shi R., Wang J., Wang H., Huang W., Cao C., Tan X., Nam J., Lin L., Ultrasoft bioadhesive hydrogel as a versatile platform for the delivery of basic fibroblast growth factor to repair traumatic brain injury. Chem. Eng. J. 483, 149017 (2024). [Google Scholar]
42.Gentile P., Chiono V., Carmagnola I., Hatton P. V., An overview of poly(lactic-co-glycolic) acid (PLGA)-based biomaterials for bone tissue engineering. Int. J. Mol. Sci. 15, 3640–3659 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Ghosh Dastidar A., Clarke S. A., Larrañeta E., Buchanan F., Manda K., In vitro degradation of 3D-printed poly(L-lactide-Co-Glycolic Acid) scaffolds for tissue engineering applications. Polymers 15, 3714 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Zhou L., Wang Z., Chen D., Lin J., Li W., Guo S., Wu R., Zhao X., Lin T., Chen G., Liu W., An injectable and photocurable methacrylate-silk fibroin hydrogel loaded with bFGF for spinal cord regeneration. Mater. Des. 217, 110670 (2022). [Google Scholar]
45.Hou J., Yang R., Vuong I., Li F., Kong J., Mao H.-Q., Biomaterials strategies to balance inflammation and tenogenesis for tendon repair. Acta Biomater. 130, 1–16 (2021). [DOI] [PubMed] [Google Scholar]
46.Turner C. E., Paxillin interactions. J. Cell Sci. 113, 4139–4140 (2000). [DOI] [PubMed] [Google Scholar]
47.Aslan H., Kimelman-Bleich N., Pelled G., Gazit D., Molecular targets for tendon neoformation. J. Clin. Invest. 118, 439–444 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Fan X.-L., Zhang Y., Li X., Fu Q.-L., Mechanisms underlying the protective effects of mesenchymal stem cell-based therapy. Cell. Mol. Life Sci. 77, 2771–2794 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Zhang Y., Sheng R., Chen J., Wang H., Zhu Y., Cao Z., Zhao X., Wang Z., Liu C., Chen Z., Zhang P., Kuang B., Zheng H., Shen C., Yao Q., Zhang W., Silk fibroin and sericin differentially potentiate the paracrine and regenerative functions of stem cells through multiomics analysis. Adv. Mater. 35, e2210517 (2023). [DOI] [PubMed] [Google Scholar]
50.Sensini A., Massafra G., Gotti C., Zucchelli A., Cristofolini L., Tissue engineering for the insertions of tendons and ligaments: an overview of electrospun biomaterials and structures. Front. Bioeng. Biotechnol. 9, 645544 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Yamamoto M., Clark J. D., Pastor J. V., Gurnani P., Nandi A., Kurosu H., Miyoshi M., Ogawa Y., Castrillon D. H., Rosenblatt K. P., Kuro-o M., Regulation of oxidative stress by the anti-aging hormone klotho. J. Biol. Chem. 280, 38029–38034 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Zhao Y., Banerjee S., Dey N., LeJeune W. S., Sarkar P. S., Brobey R., Rosenblatt K. P., Tilton R. G., Choudhary S., Klotho depletion contributes to increased inflammation in kidney of the db/db mouse model of diabetes via RelA (serine)⁵³⁶ phosphorylation. Diabetes 60, 1907–1916 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Riegger J., Brenner R. E., Evidence of necroptosis in osteoarthritic disease: Investigation of blunt mechanical impact as possible trigger in regulated necrosis. Cell Death Dis. 10, 683 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Sui B. D., Hu C. H., Zheng C. X., Jin Y., Microenvironmental Views on Mesenchymal Stem Cell Differentiation in Aging. J. Dent. Res. 95, 1333–1340 (2016). [DOI] [PubMed] [Google Scholar]
55.Pittenger M. F., Martin B. J., Mesenchymal stem cells and their potential as cardiac therapeutics. Circ. Res. 95, 9–20 (2004). [DOI] [PubMed] [Google Scholar]
56.Zhang W., Zhang Y., Li X., Cao Z., Mo Q., Sheng R., Ling C., Chi J., Yao Q., Chen J., Wang H., Multifunctional polyphenol-based silk hydrogel alleviates oxidative stress and enhances endogenous regeneration of osteochondral defects. Mater. Today Bio 14, 100251 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Franco A. A., Odom R. S., Rando T. A., Regulation of antioxidant enzyme gene expression in response to oxidative stress and during differentiation of mouse skeletal muscle. Free Radic. Biol. Med. 27, 1122–1132 (1999). [DOI] [PubMed] [Google Scholar]
58.Messer J. G., La S., Hopkins R. G., Kipp D. E., Quercetin Partially Preserves Development of Osteoblast Phenotype in Fetal Rat Calvaria Cells in an Oxidative Stress Environment. J. Cell. Physiol. 231, 2779–2788 (2016). [DOI] [PubMed] [Google Scholar]
59.Shin E. S., Huang Q., Gurel Z., Sorenson C. M., Sheibani N., High Glucose Alters Retinal Astrocytes Phenotype through Increased Production of Inflammatory Cytokines and Oxidative Stress. PLOS ONE 9, e103148 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Huang N., Kny M., Riediger F., Busch K., Schmidt S., Luft F. C., Slevogt H., Fielitz J., Deletion of Nlrp3 protects from inflammation-induced skeletal muscle atrophy. Intensive Care Med. Exp. 5, 3 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
61.Wang Y., He G., Tang H., Shi Y., Kang X., Lyu J., Zhu M., Zhou M., Yang M., Mu M., Chen W., Zhou B., Zhang J., Tang K., Aspirin inhibits inflammation and scar formation in the injury tendon healing through regulating JNK/STAT-3 signalling pathway. Cell Prolif. 52, e12650 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
62.Tidball J. G., Mechanisms of muscle injury, repair, and regeneration. Compr. Physiol. 1, 2029–2062 (2011). [DOI] [PubMed] [Google Scholar]
63.Butterfield T. A., Best T. M., Merrick M. A., The dual roles of neutrophils and macrophages in inflammation: A critical balance between tissue damage and repair. J. Athl. Train. 41, 457–465 (2006). [PMC free article] [PubMed] [Google Scholar]
64.Sugg K. B., Lubardic J., Gumucio J. P., Mendias C. L., Changes in macrophage phenotype and induction of epithelial-to-mesenchymal transition genes following acute Achilles tenotomy and repair. J. Orthop. Res. 32, 944–951 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
65.Pajarinen J., Lin T., Gibon E., Kohno Y., Maruyama M., Nathan K., Lu L., Yao Z., Goodman S. B., Mesenchymal stem cell-macrophage crosstalk and bone healing. Biomaterials 196, 80–89 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
66.Hui H., Zhai Y., Ao L., Cleveland J. C., Liu H., Fullerton D. A., Meng X., Klotho suppresses the inflammatory responses and ameliorates cardiac dysfunction in aging endotoxemic mice. Oncotarget 8, 15663–15676 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
67.Lv J., Chen J., Wang M., Yan F., Klotho alleviates indoxyl sulfate-induced heart failure and kidney damage by promoting M2 macrophage polarization. Aging 12, 9139–9150 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
68.Freytes D. O., Kang J. W., Marcos-Campos I., Vunjak-Novakovic G., Macrophages modulate the viability and growth of human mesenchymal stem cells. J. Cell. Biochem. 114, 220–229 (2013). [DOI] [PubMed] [Google Scholar]
69.Cao X., Duan L., Hou H., Liu Y., Chen S., Zhang S., Liu Y., Wang C., Qi X., Liu N., Han Z., Zhang D., Han Z.-C., Guo Z., Zhao Q., Li Z., IGF-1C hydrogel improves the therapeutic effects of MSCs on colitis in mice through PGE₂-mediated M2 macrophage polarization. Theranostics 10, 7697–7709 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
70.Li Y., Zhang J., Wang C., Jiang Z., Lai K., Wang Y., Yang G., Porous composite hydrogels with improved MSC survival for robust epithelial sealing around implants and M2 macrophage polarization. Acta Biomater. 157, 108–123 (2023). [DOI] [PubMed] [Google Scholar]
71.Lin D., Alberton P., Caceres M. D., Volkmer E., Schieker M., Docheva D., Tenomodulin is essential for prevention of adipocyte accumulation and fibrovascular scar formation during early tendon healing. Cell Death Dis. 8, e3116 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
72.Hong G.-S., Schwandt T., Stein K., Schneiker B., Kummer M. P., Heneka M. T., Kitamura K., Kalff J. C., Wehner S., Effects of macrophage-dependent peroxisome proliferator-activated receptor γ signalling on adhesion formation after abdominal surgery in an experimental model. Br. J. Surg. 102, 1506–1516 (2015). [DOI] [PubMed] [Google Scholar]
73.Li D., Chen K., Tang H., Hu S., Xin L., Jing X., He Q., Wang S., Song J., Mei L., Cannon R. D., Ji P., Wang H., Chen T., A logic-based diagnostic and therapeutic hydrogel with multistimuli responsiveness to orchestrate diabetic bone regeneration. Adv. Mater. 34, e2108430 (2022). [DOI] [PubMed] [Google Scholar]
74.Zhang B., Yang Y., Yi J., Zhao Z., Ye R., Hyperglycemia modulates M1/M2 macrophage polarization via reactive oxygen species overproduction in ligature-induced periodontitis. J. Periodontal Res. 56, 991–1005 (2021). [DOI] [PubMed] [Google Scholar]
75.Buendía P., Carracedo J., Soriano S., Madueño J. A., Ortiz A., Martín-Malo A., Aljama P., Ramírez R., Klotho Prevents NFκB Translocation and Protects Endothelial Cell From Senescence Induced by Uremia. J. Gerontol. A Biol. Sci. Med. Sci. 70, 1198–1209 (2015). [DOI] [PubMed] [Google Scholar]
76.Bi Y., Ehirchiou D., Kilts T. M., Inkson C. A., Embree M. C., Sonoyama W., Li L., Leet A. I., Seo B.-M., Zhang L., Shi S., Young M. F., Identification of tendon stem/progenitor cells and the role of the extracellular matrix in their niche. Nat. Med. 13, 1219–1227 (2007). [DOI] [PubMed] [Google Scholar]
77.Burlacu A., Rosca A.-M., Maniu H., Titorencu I., Dragan E., Jinga V., Simionescu M., Promoting effect of 5-azacytidine on the myogenic differentiation of bone marrow stromal cells. Eur. J. Cell Biol. 87, 173–184 (2008). [DOI] [PubMed] [Google Scholar]
78.Wu S.-H., Yu J.-H., Liao Y.-T., Liu K.-H., Chiang E.-R., Chang M.-C., Wang J.-P., Comparison of the Infant and Adult Adipose-Derived Mesenchymal Stem Cells in Proliferation, Senescence, Anti-oxidative Ability and Differentiation Potential. Tissue Eng. Regen. Med. 19, 589–601 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
79.Yin Z., Chen X., Chen J. L., Shen W. L., Hieu Nguyen T. M., Gao L., Ouyang H. W., The regulation of tendon stem cell differentiation by the alignment of nanofibers. Biomaterials 31, 2163–2175 (2010). [DOI] [PubMed] [Google Scholar]
80.Chen J. M., Willers C., Xu J., Wang A., Zheng M.-H., Autologous tenocyte therapy using porcine-derived bioscaffolds for massive rotator cuff defect in rabbits. Tissue Eng. 13, 1479–1491 (2007). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Text

Figs. S1 to S13

Legends for movies S1 and S2

sciadv.adm7164_sm.pdf^{(6.4MB, pdf)}

Movies S1 and S2

sciadv.adm7164_movies_s1_and_s2.zip^{(44.6MB, zip)}

[R1] 1.K. VanDusen, L. Larkin, “Muscle–tendon interface” in Regenerative Engineering of Musculoskeletal Tissues and Interfaces, S. Nukavarapu, J. Freeman, C. Laurencin, Eds. (Woodhead, 2015), part 3, chap. 17, pp. 409–429. [Google Scholar]

[R2] 2.Vila Pouca M. C. P., Parente M. P. L., Jorge R. M. N., Ashton-Miller J. A., Injuries in muscle-tendon-bone units: A systematic review considering the role of passive tissue fatigue. Orthop. J. Sports Med. 9, 23259671211020731 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R3] 3.Yoshida K., Itoigawa Y., Maruyama Y., Kaneko K., Healing process of gastrocnemius muscle injury on ultrasonography using B-Mode imaging, power doppler imaging, and shear wave elastography. J. Ultrasound Med. 38, 3239–3246 (2019). [DOI] [PubMed] [Google Scholar]

[R4] 4.Entwisle T., Ling Y., Splatt A., Brukner P., Connell D., Distal musculotendinous t junction injuries of the biceps femoris: An MRI case review. Orthop. J. Sports Med. 5, 2325967117714998 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R5] 5.Gatot C., Lie H. M. E., Tijauw Tjoen D. L., Arthroscopy technique: Repair of musculotendinous junction rotator cuff tears in the shoulder using a dynamic convergence suture bridge technique. Arthrosc. Tech. 12, e2117–e2126 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R6] 6.Millett P. J., Hussain Z. B., Fritz E. M., Warth R. J., Katthagen J. C., Pogorzelski J., Rotator cuff tears at the musculotendinous junction: Classification and surgical options for repair and reconstruction. Arthrosc. Tech. 6, e1075–e1085 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R7] 7.Wang D., Zhang X., Huang S., Liu Y., Fu B. S., Mak K. K., Blocki A. M., Yung P. S., Tuan R. S., Ker D. F. E., Engineering multi-tissue units for regenerative Medicine: Bone-tendon-muscle units of the rotator cuff. Biomaterials 272, 120789 (2021). [DOI] [PubMed] [Google Scholar]

[R8] 8.Langer R., Vacanti J. P., Tissue engineering. Science 260, 920–926 (1993). [DOI] [PubMed] [Google Scholar]

[R9] 9.Ma J., Yu H., Zhang X., Xu Z., Hu H., Liu J., Ren P., Kong X., Chen J., Yang K., Wang X., He X., Luo H., Chen G., Dual-targeted metal ion network hydrogel scaffold for promoting the integrated repair of Tendon–bone interfaces. ACS Appl. Mater. Interfaces 16, 5582–5597 (2024). [DOI] [PubMed] [Google Scholar]

[R10] 10.Centeno C., Fausel Z., Stemper I., Azuike U., Dodson E., A randomized controlled trial of the treatment of rotator cuff tears with bone marrow concentrate and platelet products compared to exercise therapy: A midterm analysis. Stem Cells Int. 2020, e5962354 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R11] 11.Crow B. D., Haltom J. D., Carson W. L., Greene W. B., Cook J. L., Evaluation of a novel biomaterial for intrasubstance muscle laceration repair. J. Orthop. Res. 25, 396–403 (2007). [DOI] [PubMed] [Google Scholar]

[R12] 12.Rothrauff B. B., Sasaki H., Kihara S., Overholt K. J., Gottardi R., Lin H., Fu F. H., Tuan R. S., Alexander P. G., Point-of-Care procedure for enhancement of meniscal healing in a goat model utilizing infrapatellar fat Pad-derived stromal vascular fraction cells seeded in photocrosslinkable hydrogel. Am. J. Sports Med. 47, 3396–3405 (2019). [DOI] [PubMed] [Google Scholar]

[R13] 13.Kim W. J., Kim G. H., A bioprinted complex tissue model for myotendinous junction with biochemical and biophysical cues. Bioeng. Transl. Med. 7, e10321 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R14] 14.Gaffney L. S., Davis Z. G., Mora-Navarro C., Fisher M. B., Freytes D. O., extracellular matrix hydrogels promote expression of Muscle-tendon junction proteins. Tissue Eng. Part A 28, 270–282 (2022). [DOI] [PubMed] [Google Scholar]

[R15] 15.Merceron T. K., Burt M., Seol Y.-J., Kang H.-W., Lee S. J., Yoo J. J., Atala A., A 3D bioprinted complex structure for engineering the muscle-tendon unit. Biofabrication 7, 035003 (2015). [DOI] [PubMed] [Google Scholar]

[R16] 16.Ladd M. R., Lee S. J., Stitzel J. D., Atala A., Yoo J. J., Co-electrospun dual scaffolding system with potential for muscle-tendon junction tissue engineering. Biomaterials 32, 1549–1559 (2011). [DOI] [PubMed] [Google Scholar]

[R17] 17.Turner N. J., Yates A. J., Weber D. J., Qureshi I. R., Stolz D. B., Gilbert T. W., Badylak S. F., Xenogeneic extracellular matrix as an inductive scaffold for regeneration of a functioning musculotendinous junction. Tissue Eng. Part A 16, 3309–3317 (2010). [DOI] [PubMed] [Google Scholar]

[R18] 18.Koeck K. S., Salehi S., Humenik M., Scheibel T., Processing of continuous Non-crosslinked collagen fibers for microtissue formation at the Muscle-tendon interface. Adv. Funct. Mater. 32, 2112238 (2022). [Google Scholar]

[R19] 19.Millar N. L., Murrell G. A. C., McInnes I. B., Inflammatory mechanisms in tendinopathy – towards translation. Nat. Rev. Rheumatol. 13, 110–122 (2017). [DOI] [PubMed] [Google Scholar]

[R20] 20.Ye J., Xie C., Wang C., Huang J., Yin Z., Heng B. C., Chen X., Shen W., Promoting musculoskeletal system soft tissue regeneration by biomaterial-mediated modulation of macrophage polarization. Bioact. Mater. 6, 4096–4109 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R21] 21.Ackerman J. E., Best K. T., Muscat S. N., Loiselle A. E., Metabolic regulation of tendon inflammation and healing following injury. Curr. Rheumatol. Rep. 23, 15 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R22] 22.Mittal M., Siddiqui M. R., Tran K., Reddy S. P., Malik A. B., Reactive oxygen species in inflammation and tissue injury. Antioxid. Redox Signal. 20, 1126–1167 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R23] 23.Liu R., Zhou B., Zhang H., Chen Y., Fan C., Zhang T., Qin T., Han J., Zhang S., Chen X., Shen W., Chang J., Yin Z., Inhibition of ROS activity by controlled release of proanthocyanidins from mesoporous silica nanocomposites effectively ameliorates heterotopic ossification in tendon. Chem. Eng. J. 420, 129415 (2021). [Google Scholar]

[R24] 24.Bosutti A., Degens H., The impact of resveratrol and hydrogen peroxide on muscle cell plasticity shows a dose-dependent interaction. Sci. Rep. 5, 8093 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] 25.Itoigawa Y., Yoshida K., Nojiri H., Morikawa D., Kawasaki T., Wada T., Koga A., Maruyama Y., Ishijima M., Association of recurrent tear after arthroscopic rotator cuff repair and superoxide-induced oxidative stress. Am. J. Sports Med. 49, 2048–2055 (2021). [DOI] [PubMed] [Google Scholar]

[R26] 26.Leong D. J., Sun H. B., Mesenchymal stem cells in tendon repair and regeneration: Basic understanding and translational challenges. Ann. N. Y. Acad. Sci. 1383, 88–96 (2016). [DOI] [PubMed] [Google Scholar]

[R27] 27.Zhang Q., Wang T., Wu X., Wang Y., Wu X., Zhou M., Li Z., Liu B., Zheng F., Sun X., Liu T., Thrombospondin-4 (TSP4) gene-modified bone marrow stromal cells (BMSCs) promote the effect of therapeutic angiogenesis in critical limb ischemia (CLI) of diabetic rats. Biochem. Biophys. Res. Commun. 532, 231–238 (2020). [DOI] [PubMed] [Google Scholar]

[R28] 28.Li L., Chen X., Wang W. E., Zeng C., How to improve the survival of transplanted mesenchymal stem cell in ischemic heart? Stem Cells Int. 2016, 9682757 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R29] 29.Choumerianou D. M., Dimitriou H., Kalmanti M., Stem cells: Promises versus limitations. Tissue Eng. Part B Rev. 14, 53–60 (2008). [DOI] [PubMed] [Google Scholar]

[R30] 30.Kuro-o M., Matsumura Y., Aizawa H., Kawaguchi H., Suga T., Utsugi T., Ohyama Y., Kurabayashi M., Kaname T., Kume E., Iwasaki H., Iida A., Shiraki-Iida T., Nishikawa S., Nagai R., Nabeshima Y. I., Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 390, 45–51 (1997). [DOI] [PubMed] [Google Scholar]

[R31] 31.Kuro-o M., The Klotho proteins in health and disease. Nat. Rev. Nephrol. 15, 27–44 (2019). [DOI] [PubMed] [Google Scholar]

[R32] 32.Matsumura Y., Aizawa H., Shiraki-Iida T., Nagai R., Kuro-o M., Nabeshima Y., Identification of the human klothogene and its two transcripts encoding membrane and secreted klotho protein. Biochem. Biophys. Res. Commun. 242, 626–630 (1998). [DOI] [PubMed] [Google Scholar]

[R33] 33.Kurosu H., Yamamoto M., Clark J. D., Pastor J. V., Nandi A., Gurnani P., McGuinness O. P., Chikuda H., Yamaguchi M., Kawaguchi H., Shimomura I., Takayama Y., Herz J., Kahn C. R., Rosenblatt K. P., Kuro-o M., Suppression of aging in mice by the hormone Klotho. Science 309, 1829–1833 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R34] 34.Sahu A., Mamiya H., Shinde S. N., Cheikhi A., Winter L. L., Vo N. V., Stolz D., Roginskaya V., Tang W. Y., St Croix C., Sanders L. H., Franti M., Van Houten B., Rando T. A., Barchowsky A., Ambrosio F., Age-related declines in α-Klotho drive progenitor cell mitochondrial dysfunction and impaired muscle regeneration. Nat. Commun. 9, 4859 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R35] 35.Ahrens H. E., Huettemeister J., Schmidt M., Kaether C., von Maltzahn J., Klotho expression is a prerequisite for proper muscle stem cell function and regeneration of skeletal muscle. Skelet. Muscle 8, 20 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R36] 36.Zhu L., Xie H., Liu Q., Ma F., Wu H., Klotho inhibits H2O2-induced oxidative stress and apoptosis in periodontal ligament stem cells by regulating UCP2 expression. Clin. Exp. Pharmacol. Physiol. 48, 1412–1420 (2021). [DOI] [PubMed] [Google Scholar]

[R37] 37.Chen H., Huang X., Fu C., Wu X., Peng Y., Lin X., Wang Y., Recombinant Klotho protects human periodontal ligament stem cells by regulating mitochondrial function and the antioxidant system during H₂O₂-induced oxidative stress. Oxid. Med. Cell. Longev. 2019, 9261565 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] 38.Kim B., Lee S.-M., Park S.-J., Lee S., Kim T., Role of Klotho and N-acetylcysteine in Oxidative Stress Associated with the Vitrification of Ovarian Tissue Cytoprotective Function of Klotho in Cryopreservation. Tissue Eng. Regen. Med. 20, 637–646 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R39] 39.Jiang W., Xiang X., Song M., Shen J., Shi Z., Huang W., Liu H., An all-silk-derived bilayer hydrogel for osteochondral tissue engineering. Mater. Today Bio 17, 100485 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R40] 40.Kobielarz M., Tomanik M., Mroczkowska K., Szustakiewicz K., Oryszczak M., Mazur A., Antończak A., Filipiak J., Laser-modified PLGA for implants: In vitro degradation and mechanical properties. Acta Bioeng. Biomech. 22, 179–197 (2020). [PubMed] [Google Scholar]

[R41] 41.Shen B., Wang J., He T., Chen S., Wang X., Chen J., Shi R., Wang J., Wang H., Huang W., Cao C., Tan X., Nam J., Lin L., Ultrasoft bioadhesive hydrogel as a versatile platform for the delivery of basic fibroblast growth factor to repair traumatic brain injury. Chem. Eng. J. 483, 149017 (2024). [Google Scholar]

[R42] 42.Gentile P., Chiono V., Carmagnola I., Hatton P. V., An overview of poly(lactic-co-glycolic) acid (PLGA)-based biomaterials for bone tissue engineering. Int. J. Mol. Sci. 15, 3640–3659 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] 43.Ghosh Dastidar A., Clarke S. A., Larrañeta E., Buchanan F., Manda K., In vitro degradation of 3D-printed poly(L-lactide-Co-Glycolic Acid) scaffolds for tissue engineering applications. Polymers 15, 3714 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R44] 44.Zhou L., Wang Z., Chen D., Lin J., Li W., Guo S., Wu R., Zhao X., Lin T., Chen G., Liu W., An injectable and photocurable methacrylate-silk fibroin hydrogel loaded with bFGF for spinal cord regeneration. Mater. Des. 217, 110670 (2022). [Google Scholar]

[R45] 45.Hou J., Yang R., Vuong I., Li F., Kong J., Mao H.-Q., Biomaterials strategies to balance inflammation and tenogenesis for tendon repair. Acta Biomater. 130, 1–16 (2021). [DOI] [PubMed] [Google Scholar]

[R46] 46.Turner C. E., Paxillin interactions. J. Cell Sci. 113, 4139–4140 (2000). [DOI] [PubMed] [Google Scholar]

[R47] 47.Aslan H., Kimelman-Bleich N., Pelled G., Gazit D., Molecular targets for tendon neoformation. J. Clin. Invest. 118, 439–444 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] 48.Fan X.-L., Zhang Y., Li X., Fu Q.-L., Mechanisms underlying the protective effects of mesenchymal stem cell-based therapy. Cell. Mol. Life Sci. 77, 2771–2794 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R49] 49.Zhang Y., Sheng R., Chen J., Wang H., Zhu Y., Cao Z., Zhao X., Wang Z., Liu C., Chen Z., Zhang P., Kuang B., Zheng H., Shen C., Yao Q., Zhang W., Silk fibroin and sericin differentially potentiate the paracrine and regenerative functions of stem cells through multiomics analysis. Adv. Mater. 35, e2210517 (2023). [DOI] [PubMed] [Google Scholar]

[R50] 50.Sensini A., Massafra G., Gotti C., Zucchelli A., Cristofolini L., Tissue engineering for the insertions of tendons and ligaments: an overview of electrospun biomaterials and structures. Front. Bioeng. Biotechnol. 9, 645544 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R51] 51.Yamamoto M., Clark J. D., Pastor J. V., Gurnani P., Nandi A., Kurosu H., Miyoshi M., Ogawa Y., Castrillon D. H., Rosenblatt K. P., Kuro-o M., Regulation of oxidative stress by the anti-aging hormone klotho. J. Biol. Chem. 280, 38029–38034 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R52] 52.Zhao Y., Banerjee S., Dey N., LeJeune W. S., Sarkar P. S., Brobey R., Rosenblatt K. P., Tilton R. G., Choudhary S., Klotho depletion contributes to increased inflammation in kidney of the db/db mouse model of diabetes via RelA (serine)⁵³⁶ phosphorylation. Diabetes 60, 1907–1916 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R53] 53.Riegger J., Brenner R. E., Evidence of necroptosis in osteoarthritic disease: Investigation of blunt mechanical impact as possible trigger in regulated necrosis. Cell Death Dis. 10, 683 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] 54.Sui B. D., Hu C. H., Zheng C. X., Jin Y., Microenvironmental Views on Mesenchymal Stem Cell Differentiation in Aging. J. Dent. Res. 95, 1333–1340 (2016). [DOI] [PubMed] [Google Scholar]

[R55] 55.Pittenger M. F., Martin B. J., Mesenchymal stem cells and their potential as cardiac therapeutics. Circ. Res. 95, 9–20 (2004). [DOI] [PubMed] [Google Scholar]

[R56] 56.Zhang W., Zhang Y., Li X., Cao Z., Mo Q., Sheng R., Ling C., Chi J., Yao Q., Chen J., Wang H., Multifunctional polyphenol-based silk hydrogel alleviates oxidative stress and enhances endogenous regeneration of osteochondral defects. Mater. Today Bio 14, 100251 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R57] 57.Franco A. A., Odom R. S., Rando T. A., Regulation of antioxidant enzyme gene expression in response to oxidative stress and during differentiation of mouse skeletal muscle. Free Radic. Biol. Med. 27, 1122–1132 (1999). [DOI] [PubMed] [Google Scholar]

[R58] 58.Messer J. G., La S., Hopkins R. G., Kipp D. E., Quercetin Partially Preserves Development of Osteoblast Phenotype in Fetal Rat Calvaria Cells in an Oxidative Stress Environment. J. Cell. Physiol. 231, 2779–2788 (2016). [DOI] [PubMed] [Google Scholar]

[R59] 59.Shin E. S., Huang Q., Gurel Z., Sorenson C. M., Sheibani N., High Glucose Alters Retinal Astrocytes Phenotype through Increased Production of Inflammatory Cytokines and Oxidative Stress. PLOS ONE 9, e103148 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R60] 60.Huang N., Kny M., Riediger F., Busch K., Schmidt S., Luft F. C., Slevogt H., Fielitz J., Deletion of Nlrp3 protects from inflammation-induced skeletal muscle atrophy. Intensive Care Med. Exp. 5, 3 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R61] 61.Wang Y., He G., Tang H., Shi Y., Kang X., Lyu J., Zhu M., Zhou M., Yang M., Mu M., Chen W., Zhou B., Zhang J., Tang K., Aspirin inhibits inflammation and scar formation in the injury tendon healing through regulating JNK/STAT-3 signalling pathway. Cell Prolif. 52, e12650 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R62] 62.Tidball J. G., Mechanisms of muscle injury, repair, and regeneration. Compr. Physiol. 1, 2029–2062 (2011). [DOI] [PubMed] [Google Scholar]

[R63] 63.Butterfield T. A., Best T. M., Merrick M. A., The dual roles of neutrophils and macrophages in inflammation: A critical balance between tissue damage and repair. J. Athl. Train. 41, 457–465 (2006). [PMC free article] [PubMed] [Google Scholar]

[R64] 64.Sugg K. B., Lubardic J., Gumucio J. P., Mendias C. L., Changes in macrophage phenotype and induction of epithelial-to-mesenchymal transition genes following acute Achilles tenotomy and repair. J. Orthop. Res. 32, 944–951 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R65] 65.Pajarinen J., Lin T., Gibon E., Kohno Y., Maruyama M., Nathan K., Lu L., Yao Z., Goodman S. B., Mesenchymal stem cell-macrophage crosstalk and bone healing. Biomaterials 196, 80–89 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R66] 66.Hui H., Zhai Y., Ao L., Cleveland J. C., Liu H., Fullerton D. A., Meng X., Klotho suppresses the inflammatory responses and ameliorates cardiac dysfunction in aging endotoxemic mice. Oncotarget 8, 15663–15676 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R67] 67.Lv J., Chen J., Wang M., Yan F., Klotho alleviates indoxyl sulfate-induced heart failure and kidney damage by promoting M2 macrophage polarization. Aging 12, 9139–9150 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R68] 68.Freytes D. O., Kang J. W., Marcos-Campos I., Vunjak-Novakovic G., Macrophages modulate the viability and growth of human mesenchymal stem cells. J. Cell. Biochem. 114, 220–229 (2013). [DOI] [PubMed] [Google Scholar]

[R69] 69.Cao X., Duan L., Hou H., Liu Y., Chen S., Zhang S., Liu Y., Wang C., Qi X., Liu N., Han Z., Zhang D., Han Z.-C., Guo Z., Zhao Q., Li Z., IGF-1C hydrogel improves the therapeutic effects of MSCs on colitis in mice through PGE₂-mediated M2 macrophage polarization. Theranostics 10, 7697–7709 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R70] 70.Li Y., Zhang J., Wang C., Jiang Z., Lai K., Wang Y., Yang G., Porous composite hydrogels with improved MSC survival for robust epithelial sealing around implants and M2 macrophage polarization. Acta Biomater. 157, 108–123 (2023). [DOI] [PubMed] [Google Scholar]

[R71] 71.Lin D., Alberton P., Caceres M. D., Volkmer E., Schieker M., Docheva D., Tenomodulin is essential for prevention of adipocyte accumulation and fibrovascular scar formation during early tendon healing. Cell Death Dis. 8, e3116 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R72] 72.Hong G.-S., Schwandt T., Stein K., Schneiker B., Kummer M. P., Heneka M. T., Kitamura K., Kalff J. C., Wehner S., Effects of macrophage-dependent peroxisome proliferator-activated receptor γ signalling on adhesion formation after abdominal surgery in an experimental model. Br. J. Surg. 102, 1506–1516 (2015). [DOI] [PubMed] [Google Scholar]

[R73] 73.Li D., Chen K., Tang H., Hu S., Xin L., Jing X., He Q., Wang S., Song J., Mei L., Cannon R. D., Ji P., Wang H., Chen T., A logic-based diagnostic and therapeutic hydrogel with multistimuli responsiveness to orchestrate diabetic bone regeneration. Adv. Mater. 34, e2108430 (2022). [DOI] [PubMed] [Google Scholar]

[R74] 74.Zhang B., Yang Y., Yi J., Zhao Z., Ye R., Hyperglycemia modulates M1/M2 macrophage polarization via reactive oxygen species overproduction in ligature-induced periodontitis. J. Periodontal Res. 56, 991–1005 (2021). [DOI] [PubMed] [Google Scholar]

[R75] 75.Buendía P., Carracedo J., Soriano S., Madueño J. A., Ortiz A., Martín-Malo A., Aljama P., Ramírez R., Klotho Prevents NFκB Translocation and Protects Endothelial Cell From Senescence Induced by Uremia. J. Gerontol. A Biol. Sci. Med. Sci. 70, 1198–1209 (2015). [DOI] [PubMed] [Google Scholar]

[R76] 76.Bi Y., Ehirchiou D., Kilts T. M., Inkson C. A., Embree M. C., Sonoyama W., Li L., Leet A. I., Seo B.-M., Zhang L., Shi S., Young M. F., Identification of tendon stem/progenitor cells and the role of the extracellular matrix in their niche. Nat. Med. 13, 1219–1227 (2007). [DOI] [PubMed] [Google Scholar]

[R77] 77.Burlacu A., Rosca A.-M., Maniu H., Titorencu I., Dragan E., Jinga V., Simionescu M., Promoting effect of 5-azacytidine on the myogenic differentiation of bone marrow stromal cells. Eur. J. Cell Biol. 87, 173–184 (2008). [DOI] [PubMed] [Google Scholar]

[R78] 78.Wu S.-H., Yu J.-H., Liao Y.-T., Liu K.-H., Chiang E.-R., Chang M.-C., Wang J.-P., Comparison of the Infant and Adult Adipose-Derived Mesenchymal Stem Cells in Proliferation, Senescence, Anti-oxidative Ability and Differentiation Potential. Tissue Eng. Regen. Med. 19, 589–601 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]

[R79] 79.Yin Z., Chen X., Chen J. L., Shen W. L., Hieu Nguyen T. M., Gao L., Ouyang H. W., The regulation of tendon stem cell differentiation by the alignment of nanofibers. Biomaterials 31, 2163–2175 (2010). [DOI] [PubMed] [Google Scholar]

[R80] 80.Chen J. M., Willers C., Xu J., Wang A., Zheng M.-H., Autologous tenocyte therapy using porcine-derived bioscaffolds for massive rotator cuff defect in rabbits. Tissue Eng. 13, 1479–1491 (2007). [DOI] [PubMed] [Google Scholar]

PERMALINK

Bioactive fiber-reinforced hydrogel to tailor cell microenvironment for structural and functional regeneration of myotendinous junction

Yuzhi Sun

Renwang Sheng

Zhicheng Cao

Chuanquan Liu

Jiaxiang Li

Po Zhang

Yan Du

Qingyun Mo

Qingqiang Yao

Jialin Chen

Wei Zhang

Roles

Abstract

INTRODUCTION

Fig. 1. Fabrication and characterization of bioactive fiber-reinforced hydrogel.

RESULTS

Bioactive fiber-reinforced hydrogel is prepared and characterized

Bioactive fiber-reinforced hydrogel effectively enhances the structural and functional regeneration of MTJ in rats

Fig. 2. Bioactive fiber-reinforced hydrogel enhances structural regeneration of MTJ in rats.

Fig. 3. Bioactive fiber-reinforced hydrogel promotes functional recovery of MTJ in rats.

In vivo proteomics reveals the underlying mechanism of bioactive fiber-reinforced hydrogel promoting MTJ regeneration

Fig. 4. In vivo global proteomics reveals the underlying mechanisms of bioactive fiber-reinforced hydrogel promoting MTJ regeneration.

Bioactive fiber-reinforced hydrogel promotes cell survival and supports tenogenic/myogenic differentiation of transplanted MSCs

Fig. 5. Bioactive fiber-reinforced hydrogel improves cell survival and supports differentiation of MSCs by inhibiting oxidative stress.

Bioactive fiber-reinforced hydrogel maintains the phenotype of myoblasts and tendon stem cells by inhibiting oxidative stress

Fig. 6. Bioactive fiber-reinforced hydrogel maintains the functional phenotype of C2C12 and TSPCs by inhibiting oxidative stress.

Bioactive fiber-reinforced hydrogel guides macrophage polarization from proinflammatory to anti-inflammatory phenotype

Fig. 7. Bioactive fiber-reinforced hydrogel guides macrophage polarization from M1 to M2 phenotype.

DISCUSSION

Fig. 8. Schematic illustration of the bioactive fiber-reinforced hydrogel promoting MTJ regeneration.

MATERIALS AND METHODS

Fabrication of 3D-printed PLGA scaffolds

Preparation of bioactive fiber-reinforced hydrogel

SEM imaging

Swelling ratio

Water contact angle

Mechanical test

Rheological measurements

Cell culture

Cell proliferation

Cell viability

Intracellular ROS measurement

RNA isolation and qPCR

Table 1. Primers used for qPCR.

IF staining

Table 2. Antibodies used for IF and IHC staining.

Animal model

Histological and IHC staining

Gait analysis

Proteomics analysis

Statistical analysis

Acknowledgments

Supplementary Materials

This PDF file includes:

Other Supplementary Material for this manuscript includes the following:

REFERENCES AND NOTES

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases