Abstract
Background
Klebsiella pneumoniae infections have become a major cause of hospital acquired infection worldwide with the increased rate of acquisition of resistance to antibiotics. Carbapenem resistance mainly among Gram negative is an ongoing problem which causes serious outbreaks dramatically limiting treatment options. This prospective cross-sectional study was designed to detect blaKPC gene from carbapenem resistant K. pneumoniae.
Materials and Methods
A totally of 1118 different clinical specimens were screened and confirmed for KPC producing K. pneumoniae phenotypically using Meropenem (10 μg) disc. The blaKPC gene was amplified from the isolates of K. pneumoniae to detect the presence of this gene.
Result
Of the total samples processed, 18.6% (n = 36) were K. pneumoniae and among 36 K. pneumoniae, 61.1% (n = 22/36) were meropenem resistant. This study demonstrated the higher level of MDR 91.7% (n = 33) and KPC production 47.2% (n = 17) among K. pneumoniae isolates. The blaKPC gene was detected in 8.3% (n = 3) of meropenem resistant isolates.
Conclusion
Since the study demonstrates the higher level of MDR and KPC producing K. pneumoniae isolates that has challenged the use of antimicrobial agents, continuous microbiology, and molecular surveillance to assist early detection and minimize the further dissemination of blaKPC should be initiated. We anticipate that the findings of this study will be useful in understanding the prevalence of KPC-producing K. pneumoniae in Nepal.
Keywords: Klebsiella pneumoniae, Antibiotic resistant, Carbapenemase, blaKPC
Background
Klebsiella pneumoniae carbapenemase (KPC) is the β-lactamases enzyme of the Ambler class A encoded in blaKPC gene predominantly found in Klebsiella pneumoniae and other genera of Enterobacteriaceae family [1, 2]. The first KPC producing K. pneumoniae was reported in 2001 from a hospital in North Carolina and subsequently witnessed its rise [3, 4]. The KPC encoded gene is present in the transferrable plasmid and synthesize enzyme that hydrolyze wide range of β-lactam antibiotics including penicillin, monobactams, cephalosporin and carbapenems [5]. Different variants of the blaKPC gene (KPC-2 to KPC-17) have been detected occasionally in various taxa, such as non-fermenting bacteria. KPC-2 and KPC-3 are the most widely reported and studied variants among KPC-2 to KPC-17 blaKPC [6, 7].
The circulation of blaKPC gene harboring bacteria in clinical setting is of concern since it is likely to incite imipenem and meropenem resistant strains of bacteria augmenting global antibiotic resistance problem [8]. Among the current risk identified with the spread of carbapenemase enzyme, KPC seems to be pertinent on the ground of misuse and maltreatment of carbapenem antibiotics. This increase in the strains harboring KPC gene can lead to increment in the KPC and OXA-48 strains [9]. At the point when a KPC producer variant becomes a multidrug resistance (MDR), treatment failure of infection due to this strain is likely to increase mortality rates. MDR is a specific type of antimicrobial resistance where a microorganism becomes resistant to at least one antibiotic in three or more antimicrobial categories [10].
The type of antibiotic resistance due to KPC is fast spreading, especially when it is transmitted by transferable carbapenemase-encoding genes, resulting in significant epidemics and severely limiting treatment options. Carbapenemase genes, which can be shared between humans, are most involved. Inadequate empirical antibiotic therapy for severe KPC-KP infections has been linked to higher morbidity and mortality [11]. In Nepal, many studies on phenotypic detection of KPC producing isolates has been carried out, but genotypic studies are minimal. As a result, there is an urgent need to investigate the incidence of major types of genes that cause KPC to spread widely and that clarify the presence of blaKPC producing K. pneumoniae, in both phenotypically positive and negative isolates. This study is carried out to detect the blaKPC gene among the K. pneumoniae isolated from different clinical samples at a tertiary care hospital in Kathmandu, Nepal. Production of carbapenemases (KPC) has been the global cause of Carbapenem (Meropenem and Imipenem) resistance among K. pneumoniae which is a great therapeutic challenge. The increasing and rapid spread of blaKPC gene has not been yet accessed fully in Nepal, so this study was undertaken to ascertain the present scenario of blaKPC in gene K. pneumoniae isolates obtained through clinical samples in a tertiary hospital in Kathmandu Nepal.
Materials And Methods
Study design and bacterial isolation
A prospective study was conducted at Shahid Gangalal National Heart Center (SGNHC) and Central Department of Microbiology, Kathmandu, Nepal from Nov 2018 to Jul 2019. Ethical approval was obtained from the institution of Science and Technology (IOST) by Institutional Review Committee (IRC). A total of 1118 non-duplicate clinical specimens received at Microbiology laboratory of SGNHC were processed. The types of samples collected were urine, pus, sputum, blood, and ET secretion.
K. pneumoniae were identified using standard microbiological techniques which included growth on MacConkey Agar, Gram staining and various biochemical tests [12].
Antimicrobial Susceptibility Test (AST)
Antibiotic susceptibility pattern of isolates was assessed by Modified Kirby-Bauer disk diffusion test on Mueller Hinton agar (MHA) using antibiotics discs; Ampicillin (10 μg), Nitrofurantoin (300 μg), Ciprofloxacin (5 μg), Cotrimoxazole (25 μg), Amoxicillin/Clavulanate (20/10 μg), Ampicillin/Sulbactam (10/10 μg), Cefexime (5 μg), Ceftriaxone (30 μg), Ceftazidime (30 μg), Cefepime (5 μg), Cefotaxime (30 μg), Amikacin (30 μg), Gentamicin (10 μg), Piperacillin/Tazobactam (100/10 μg), Imipenem (10 μg), Meropenem (10 μg), Polymyxin B (10 μg) [13].. Isolates resistant to meropenem disc (zone of dimeter >5 mm) were considered carbapenemase positive and organisms were selected for further testing by using phenyl boronic acid (PBA) for the phenotypic detection of KPC producers and blaKPC gene detection [14].
Phenotypic confirmatory test for KPC producers
The K. pneumoniae isolates resistant to Meropenem were subjected combined disc test using carbapenem with and without phenyl boronic acid (PBA) for the phenotypic detection of KPC producers [14]. Briefly, 0.5 McFarland standard suspension of isolate was spread on MHA plates. Meropenem disc was loaded with 20 μl of 20 mg/ml PBA prepared in dimethyl sulphoxide (DMSO) and allowed to dry. Two Meropenem discs, one with PBA and other without PBA was placed on the MHA plates seeded with test organism at the distance of 30 mm and incubated overnight at 37 °C. Isolates with increase of ≥5 mm inhibitory zone around the disc with PBA compared to the disc around Meropenem without PBA was considered KPC producers [15].
Detection of blaKPC gene
The blaKPC gene was amplified from the plasmid DNA extracted from all the 36 isolates of K. pneumonia by Alkaline hydrolysis method [16]. PCR amplification was performed using the primers for blaKPC i.e., forward primer: 5’ACGACGGCATAGTCATTTGC 3′ and reverse primer: 5′ CATTCAAGGGCTTTCTTGCTGC 3′ with amplicon of 538 base pairs [17]. PCR mixture of total volume 25 μl was prepared which consisted of 3 μl of template DNA, 0.5 μl each of forward and reverse primer and 21 μl of PCR master mix. The thermal cycling conditions for amplification was initial denaturation at 95 °C for 15 minutes followed by 32 cycles of denaturation at 94 °C for 30 seconds, annealing at 58 °C for 90 seconds and extension at 72 °C, followed by final extension at 72 °C for 10 minutes. The amplified PCR products were analyzed in 1.2% agarose gel stained with ethidium bromide.
Data analysis
All the data were entered and analyzed statistically using statistical package for social science (SPSS) software (version 25). Binary variables were compared using chi-square test. A probability (p) value of <0.05 was considered significant.
Results
Distribution of Carbapenemase producing K. pneumoniae with respect to different variables
Among 1118 different clinical specimens investigated, growth was observed in 17.2% (n = 193) specimens where 18.7% (n = 36) isolates were identified as K. pneumoniae.
Distribution of K. pneumoniae in Clinical Specimens.
| Total Specimens | Specimens with growth | Growth percentage | K. pneumoniae isolates | Percentage of K. pneumoniae isolates |
| 1118 | 193 | 17.2 | 36 | 18.65% |
Out of 36 K. pneumoniae, 47.2% (n = 17) were isolated from urine sample followed by 22.2% (n = 17) from sputum sample. Similarly, the highest numbers of isolate were recovered from inpatient (Table 1).
Table 1.
Distribution of Carbapenemase producing K. pneumoniae (with respect to different variables)
| Variables | K. pneumoniae (N, %) | KPC K. pneumoniae (N, %) |
|---|---|---|
| Patient status | ||
| Inpatients | 19 (52.8) | 14 (82.4) |
| Outpatients | 17 (47.2) | 3 (17.6) |
| Total | 36 | 17 |
| Sample type | ||
| Urine | 17 (47.2) | 9 (53.0) |
| Pus | 7 (19.4) | 3 (17.6) |
| Sputum | 8 (22.2) | 4 (23.5) |
| Blood | 2 (5.6) | 1 (5.9) |
| ET Secretion | 2 (5.6) | 0 (0) |
| Total | 36 | 17 |
Antibiotic susceptibility profile of K. pneumoniae
Antibiotic susceptibility profile showed that 91.7% (n = 33) and 86.1% (n = 31) of total K. pneumoniae were resistant to ciprofloxacin and cephalosporins respectively. Likewise, 61.1% (n = 22) and 69.4% (n = 25) K. pneumoniae were resistant to Meropenem and Imipenem, respectively and 91.7% (n = 33) were multi-drug resistance (Table 2).
Table 2.
Antibiotic susceptibility pattern of K. pneumonia (n = 36)
| Antibiotics | Class | Potency | Susceptible N (%) |
Resistant N (%) |
|---|---|---|---|---|
| Nitrofurantoin | Imidazolidinedione | 300 μg | 5(13.9) | 12(33.3) |
| Ciprofloxacin | Fluoroquinolone | 5 μg | 3(8.3) | 33(91.7) |
| Cotrimoxazole | Sulphonamide | 25 μg | 18 (50) | 18 (50) |
|
Amoxicillin/ Clavulanic Acid |
β-lactam/ β-lactamase inhibitor combination | 20/10 μg | 11(30.6) | 25(69.4) |
| Ampicillin/Sulbactum | β-lactam/ β-lactamase inhibitor combination | 10/10 μg | 11(30.6) | 25(69.4) |
| Cefixime |
Third generation Cephalosporin |
5 μg | 9(25) | 27(75) |
| Ceftriaxone |
Third generation Cephalosporin |
30 μg | 9(25) | 27(75) |
| Ceftazidime |
Third generation Cephalosporin |
30 μg | 9(25) | 27(75) |
| Cefepime |
Fourth generation Cephalosporin |
5 μg | 8(22.2) | 28(77.8) |
| Cefotaxime |
Third generation Cephalosporin |
30 μg | 7(19.4) | 29(80.6) |
| Amikacin | Aminoglycoside | 30 μg | 15(41.7) | 21(58.3) |
| Gentamicin | Aminoglycoside | 10 μg | 12(33.3) | 24 (66.7) |
|
Piperacillin/ Tazobactum |
β-lactam/ β-lactamase inhibitor Combination | 100/10 μg | 12(33.3) | 24(66.7) |
| Imipenem | Carbapenem | 10 μg | 11 (30.6) | 25(69.4) |
| Meropenem | Carbapenem | 10 μg | 14(38.9) | 22(61.1) |
Comparison of Meropenem susceptibility with KPC production
Among 14 Meropenem sensitive K. pneumoniae isolates, none of them were KPC producers whereas 17 K. pneumoniae isolates among 22 Meropenem resistant K. pneumoniae isolates were found to be KPC producers (Table 3).
Table 3.
KPC producers among Meropenem resistant K. pneumoniae
| Tested Antibiotic | Confirmation | KPC Production | Total (N, %) | |
|---|---|---|---|---|
| Positive (N, %) | Negative (N, %) | |||
| Meropenem | Sensitive | 0 (0) | 14 (73.7) | 14 (38.9) |
| Resistant | 17 (100) | 5 (26.3) | 22 (61.1) | |
| Total | 17 (47.2) | 19 (52.8) | 36 (100) | |
Meropenem resistant K. pneumoniae with blaKPC gene
Among 22 Meropenem resistant K. pneumoniae isolates, two harbored blaKPC gene and one Meropenem sensitive isolate also harbored blaKPC gene (Table 4).
Table 4.
Meropenem resistant K. pneumoniae harboring blaKPC gene
| blaKPC Detection | Meropenem | Total (%) |
|
|---|---|---|---|
| Sensitive (N, %) |
Resistant (N, %) |
||
| Positive | 1(7.1%) | 2(9.1%) | 3(8.3%) |
| Negative | 13(92.9%) | 20(90.9%) | 33(91.7%) |
| Total | 14(38.9%) | 22(61.1%) | 36(100%) |
Association of KPC producer and the presence of blaKPC gene
Among the 17 KPC positive isolates, only 11.8% (n = 2) of them harboured blaKPC gene while rest were negative for blaKPC gene. No significant association was found between carbapenemase production and presence of blaKPC gene (P > 0.05) (Table 5).
Table 5.
Comparison of KPC positive with blaKPC gene detection
| Carbapenemase Production |
blaKPC detection | Total (%) | P-value | |
|---|---|---|---|---|
| Positive (N, %) | Negative (N, %) | |||
| Positive | 2 (66.67) | 15 (45.45) | 17 (47.22) | 0.481* |
| Negative | 1 (33.3) | 18 (54.55) | 19 (52.78) | |
| Total | 3 (8.33) | 33 (91.67) | 36 (100) | |
PCR amplification of blaKPC gene in Meropenem resistant isolates
The primers designed to target the blaKPC gene successfully amplified a 538 base pairs fragment in 3 out of the 36 tested isolates using polymerase chain reaction. Fig. 1 illustrates the outcomes of the amplification process.
Fig. 1.

This study evaluated the isolated samples by conducting agarose gel electrophoresis on the PCR products amplified using primer designed for blaKPC gene. Lane M, 1 kb DNA size marker (100-1000 bp); Lane 1/2/3: blaKPC positive isolates, Lane 4/5/6/7: blaKPC negative isolates
Discussion
Low culture positivity of K. pneumoniae has been reported in this study which agrees with other studies [11, 18, 19]. The use of antibiotics prior to sample collection, control of bacterial infection within the hospitals as well as success of infection control strategy are the common factors behind the low growth rate observed [20]. The total number of growth positive isolates of K. pneumoniae in this study was comparable with the study done by Nepal et al. [18].
This research aimed to detect the blaKPC gene in SGNHC, as individuals with heart conditions are at a heightened risk of developing severe infections that can have a significant impact on their healing and overall health. This hospital also has huge patient flow patients including a diverse range of cases, which makes it a suitable sample for studying bacterial infections in Nepal. Therefore, the research intends to enhance infection control procedures, which could result in better patient results, shorter hospital stays, and decreased healthcare expenses.
Similar to Lidd et al. [21], greater number of K. pneumoniae isolates were received from inpatient department in this study. High number of isolates from inpatient departments is because these K. pneumoniae are often associated with hospital acquired infections [21]. Similarly, higher percentage of KPC was found in inpatient department which is in concordance to other studies [22] [23]. The Enterobacteriaceae family, particularly K. pneumoniae, is one of the most common causes of nosocomial infections.
At the time of admission to the inpatient department like ICU, a longer stay in hospital is a risk factor for KPC colonization. The use of carbapenems at ICU admission (starting 48 hours before ICU admission), upper digestive endoscopy, and transfer from another hospital are also the risk factors.
In this study, K. pneumoniae was found to be isolated in higher number from urine followed by sputum samples. This was in accordance with other study in Nepal [11]. Various studies show that K. pneumoniae is predominantly isolated from urine sample [24–26]. K. pneumoniae being one of the common causative agents of UTI, its isolation is very common from the urine sample [26]. However, Biradar and Roopa [27] reported the highest percentage of K. pneumoniae from pus followed by urine.
High percentage of K. penumoniae isolates were resistant to third-generation cephalosporin antibiotics i.e., Cefixime, Cefotaxime, Ceftazidime, Ceftriaxone, and fourth generation cephalosporin Cefepime. Increased resistance to third generation cephalosporin antibiotics has been described by previous studies also [28–30]. A study conducted by Adhikari et al. [11] and Lohani et al. [31] also reported more than 90.0% of the isolates being resistant to these antibiotics. The widespread use of cephalosporin antibiotics without knowing the severity of infection could explain the increased resistance towards these antibiotics [32].
In addition, reduced susceptibility towards carbapenem was observed in this study like that reported by Estabraghi et al. [18, 33–35]. Meropenem and Imipenem had the highest resistance levels. Shrestha et al. [17] found a higher rate of Meropenem and Imipenem resistance in K. pneumoniae. The presence of an analogously significant fraction of carbapenem-resistant clinical isolates is indicated by these resistance patterns. Because there has been very little research done in Nepal to discover carbapenemase producers, it is impossible to assess whether the trend of carbapenemase producers is increasing or decreasing. The increasing trend of using cephalosporin and carbapenem directly for treatment of infection caused by MDR isolates is major problem in developing countries like Nepal [36]. Multiple mechanisms developed by organism are responsible for rise in resistance towards carbapenem such as production of β-lactamases, blocking the entry of these antibiotics, or efflux pumps [37–39]. However, polymyxin B has been found to be the choice of treatment which is considered effective to treat the infections caused by MDR Gram-negative bacteria in adult patients [40]. Factors like poor regulation of antibiotics without prescription, self-medication and lack of laboratory facilities contribute to increasing rates of antibiotic resistance [41, 42]. The resistance among pathogens is also mediated by horizontal spread of clones of resistant bacteria, within hospitals and nursing homes, as well as facilitated to some extent by migration and international mobility [43].
High number of K. pneumoniae were found to be MDR. Variation in the range of MDR K. pneumonia was detected extending from 3.0–100% from studies in Nepal [11, 18, 28, 30, 44–46]. Poor hygiene, misuse of antibiotics and absence of antimicrobial surveillance program are the common risk factors associated with the development of MDR [47, 48]. The rising incidence of the clinical MDR-KPC phenotype has been linked to greater mortality rates, constituting a significant public health issue [49]. Hence, carbapenem resistance has become a serious global problem. These drugs are generally used as last resort for serious Gram-Negative infections like infections caused by K. pneumoniae [50, 51].
The phenotypic method was used to screen KPC producers among carbapenem resistant isolates. Nearly half of the isolates were detected as KPC producers which is like the result obtained by Shrestha et al. [17]. Boronic acid tests using Imipenem, or Meropenem as an antibiotic substrate demonstrated an excellent ability to differentiate KPC enzymes [52]. The elevated frequency of KPC positive isolates in present study might be due to the increased use of carbapenem.
Among total Meropenem sensitive K. pneumoniae isolates, none of them were KPC producers whereas almost half of K. pneumoniae isolates were found to be KPC producers among Meropenem resistant K. pneumoniae isolates. This result is higher than that reported by Foschi et al. [53] (56.36%). It’s possible that high frequencies of several types of carbapenemase producers exist in some places, such as Greece (KPC and VIM) and the Indian subcontinent (KPC, NDM, OXA-181) [54]. K. pneumoniae plays a vital role since it has been continuously detected as most prevalent species of Enterobacteriaceae for propagating ESBL genes in hospitals over past 30 years. It could also have a role in the spread of carbapenemase production in patients with similar risk characteristics (patients who are receiving broad-spectrum antibiotherapy, immunocompromised patients, patients in intensive care units, transplant patients, and surgical patients) [55].
In the study, all the isolates of K. pneumoniae were subjected to molecular characterization for blaKPC and the total of 8.3% (n = 3) harbored the corresponding gene. Shrestha et al. [17]reported 6.45% of blaKPC carbapenemase resistant gene among Meropenem resistant isolates. However, Bina et al. [9] showed 80.5% isolates were positive phenotypically and all of them possessed blaKPC genes. Only 2 Meropenem resistant isolates have 2 blaKPC gene. This suggests that a carbapenemase other than KPC is present in other isolates. One isolate from Meropenem sensitive isolate harbored blaKPC gene. The acquisition of carbapenemase-encoding genes is not always linked to high levels of carbapenem resistance [56]. Several variables can account for this varied susceptibility, as the presence of additional resistance mechanisms [57]; genetic suppression resulting in a silenced gene; plasmid copy number-dependent gene dosage [58]Therefore, it is reported that carbapenemase gene is detected with higher sensitivity by molecular approach [58].
One K. pneumoniae isolate that was phenotypically sensitive to Meropenem harbored blaKPC gene. Shrestha et al. [17]have reported that there might be chance of expression of these genes in isolates but not phenotypically expressed. Also, it might not be expressed in phenotypically resistant isolates in some cases. Shrestha et al. [17]. Likewise, Kitchel et al. [58] have mentioned that the number of copies of blaKPC in the upstream genetic environment, as well as deletions in the upstream genetic environment, may impact the level of KPC production. Similarly, another relevant finding showed that no resistance was seen to carbapenems by isolate which were positive for blaKPC gene. Similar results were reported by Peleg et al. [59] that showed only 5 out of 19 isolates that carried carbapenemases genes expressed resistance to carbapenems.
Among 17 KPC producers, only two isolates harbored blaKPC gene. Even though 17 K. pneumoniae isolates tested positive for the KPC gene using PBA in this study, only three of them had the blaKPC gene. Because boronic acid derivatives are effective inhibitors of these enzymes, the false-positive results could be attributed to the synthesis of AmpC beta-lactamases or some CTXM beta-lactamases [60]. As a result, noting the false-positive result during phenotypic confirmation is extremely important. Further negative results from molecular analysis do not necessarily imply that those isolates lack the genes of our choice; they may have those genes but are unable to express them [17].
Antibiotic resistance is increasing, according to the studies, and medical societies are rapidly running out of treatment alternatives. This is causing a significant issue in the pharmacopeia. Early detection of these sorts of resistance genes, such as KPC would be a beneficial tool for identifying infections and aiding in their control and prevention. As a result, it is critical for all laboratories to become aware of such infections, which may pose a hazard to public health if not treated and controlled promptly [17]. Furthermore, the clonal expansion of blaKPC gene reported in various epidemics suggests that infection management for this organism is challenging. Worse, because of their antibiotic resistance, treating infections caused by K. pneumoniae is extremely challenging, resulting in high fatality rates. KPCs are found in several Gram-negative bacteria, not just Klebsiella spp. It is important to detect KPC gene to improve the quality of health care, to minimize the prevalence of infections and the emergence of carbapenem resistance in these bacteria and other Gram-negative pathogens. Consequently, phenotypic, and genotypic identification techniques should be used for precise diagnosis and study even if KPC positive K. pneumoniae is not significantly linked to blaKPC gene.
The blaKPC genes that code for the KPC enzymes are frequently flanked by transposon-related sequences found on transferable plasmids, giving them the ability to spread quickly. Because of its position on plasmids, the KPC family has the greatest potential for spread, especially as it is most frequently seen in K. pneumoniae, an organism known for its propensity to acquire and transfer resistance determinants. Although KPC-lactamases are most detected in K. pneumoniae, these enzymes have also been found in Enterobacter spp. and Salmonella spp. [2]. Hence, the presence of gene blaKPC encoding KPC enzyme can later result in production of KPC enzyme.
Strengths and limitations
This research is the first comprehensive investigation to determine the occurrence of blaKPC gene in K. pneumoniae using both phenotypic and genetic techniques. The result of this study can be valuable to many major tertiary hospitals with high rates of hospital-acquired infections. These results can help shape the antimicrobial guidelines for tertiary care facilities in developing strategies for managing hospital infections, deciding on treatment plans, and determining diagnostic procedures. Limitation of this research includes the short duration of the study, a smaller number of participants, and its focus on a single medical facility. A longitudinal study can be carried out at multiple tertiary care centers for future research. This study is going to be an invaluable resource for future research on blaKPC in Nepal, as this study can become an important reference for future studies on blaKPC in Nepal.
Conclusion
This study demonstrates the higher level of MDR and KPC producing K. pneumonia isolates that has challenged the use of antimicrobial agents. Molecular approaches aimed at detecting strains harboring carbapenemase genes are highly sensitive and efficient for confirmation of cases. This study also showed that phenotypically Meropenem sensitive isolates does not mean that they are KPC non-producers. Conversely, there are no proper phenotypic methodologies to routinely conduct clinical and laboratory finding of KPC producers. In this respect, the presence of the blaKPC gene must be confirmed by molecular biology techniques to define the production of blaKPC gene. To prevent emergence and spread of blaKPC gene, an antimicrobial policy must be developed and strictly enforced, as well as proper infection control measures.
Findings of this study will be useful in developing and implementing an efficient infection disease control strategy in Nepal to avoid and reduce the prevalence of KPC-producing K. pneumoniae. Carbapenem resistance in K. pneumoniae has been detected in clinical settings, hence continuous microbiology, and molecular surveillance to assist early detection and minimize the further dissemination of blaKPC should be initiated.
Acknowledgements
I would like to express my sincere appreciation to my supervisor and the individuals who provided guidance and support throughout my research. I am also grateful to the staff of the Pathology Laboratory and my family for their assistance and encouragement.
Abbreviations
- KPC
Klebsiella pneumoniae carbapenemase
- SGNHC
Shahid Gangalal National Heart Center
- IOST
Institution of Science and Technology
- IRC
Institutional Review Committee
- MHA
Mueller Hinton agar
- PBA
Phenyl Boronic Acid
- DMSO
dimethyl sulphoxide
- MDR
Multidrug resistance
- ICU
Intensive Care Unit
- VIM
Verona integron-encoded metallo β-lactamase
- NDM
New Delhi metallo beta lactamase 1
- ET Secretion
Endotracheal Secretion
Authors’ contributions
Rakshya Baral is the main author. R.B. wrote the original draft. A.S. supervised the work. R.T., S.S., and Sam.S. reviewed the final draft.
Funding
No financial support was provided to this research by governmental, corporate, or non-profit organizations.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
All procedures in this work were approved by the Institutional Review Committee of Institute of Science and Technology, Kirtipur, Kathmandu, Nepal. Reference number: IRC/IOST-16).
Written informed consent was obtained from all the participants during sample collection. The study methodologies were conducted in compliance with appropriate guidelines and regulations.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Francis RO, Wu F, Della-Latta P, Shi J, Whittier S. Rapid Detection of Klebsiella pneumoniae Carbapenemase Genes in Enterobacteriaceae Directly From Blood Culture Bottles by Real-Time PCR. Am J Clin Pathol. 2012;137(4):627–632. doi: 10.1309/AJCP9SNHJG2QGLWU. [DOI] [PubMed] [Google Scholar]
- 2.Pitout JDD, Nordmann P, Poirel L. Carbapenemase-producing Klebsiella pneumoniae, a key pathogen set for global nosocomial dominance. Antimicrob Agents Chemother. 2015;59(10). 10.1128/AAC.01019-15. [DOI] [PMC free article] [PubMed]
- 3.Yigit H, et al. Novel carbapenem-hydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother. 2001;45(4):1151–1161. doi: 10.1128/AAC.45.4.1151-1161.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Seki LM, et al. Molecular epidemiology of KPC-2- producing Klebsiella pneumoniae isolates in Brazil: the predominance of sequence type 437. Diagn Microbiol Infect Dis. 2011;70(2):274–277. doi: 10.1016/J.DIAGMICROBIO.2011.01.006. [DOI] [PubMed] [Google Scholar]
- 5.Nordmann P, Cuzon G, Naas T. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect Dis. 2009;9(4):228–236. doi: 10.1016/S1473-3099(09)70054-4. [DOI] [PubMed] [Google Scholar]
- 6.Wang D, Chen J, Yang L, Mou Y, Yang Y. Phenotypic and Enzymatic Comparative Analysis of the KPC Variants, KPC-2 and Its Recently Discovered Variant KPC-15. PLoS One. 2014;9(10):e111491. doi: 10.1371/JOURNAL.PONE.0111491. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chen L, Mathema B, Chavda KD, DeLeo FR, Bonomo RA, Kreiswirth BN. Carbapenemase-producing Klebsiella pneumoniae: molecular and genetic decoding. Trends Microbiol. 2014;22(12):686–696. doi: 10.1016/J.TIM.2014.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Richter SN, Frasson I, Franchin E, Bergo C, Lavezzo E, Barzon L, et al. KPC-mediated resistance in Klebsiella pneumoniae in two hospitals in Padua, Italy, June 2009-December 2011: massive spreading of a KPC-3-encoding plasmid and involvement of non-intensive care units. Gut Pathog. 2012;4(1):7. 10.1186/1757-4749-4-7. [DOI] [PMC free article] [PubMed]
- 9.Bina M, Pournajaf A, Mirkalantari S, Talebi M, Irajian G. Detection of the Klebsiella pneumoniae carbapenemase (KPC) in K.pneumoniae isolated from the clinical samples by the phenotypic and genotypic methods. Iran J Pathol. 2015;10(3). [PMC free article] [PubMed]
- 10.Falagas ME, Lourida P, Poulikakos P, Rafailidis PI, Tansarli GS. Antibiotic treatment of infections due to carbapenem-resistant enterobacteriaceae: Systematic evaluation of the available evidence. Antimicrob Agents Chemother. 2014;58(2):654–663. doi: 10.1128/AAC.01222-13/ASSET/C794BAF9-C950-41CF-BDF5-B3C2C3977954/ASSETS/GRAPHIC/ZAC0121324050001.JPEG. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Adhikari RP, Shrestha S, Richhinbung Rai J, Amatya R. Antimicrobial Resistance Patterns in Clinical Isolates of Enterobacteriaceae from a Tertiary Care Hospital, Kathmandu, Nepal. Nepalese Med J. 2018;1(2). 10.3126/nmj.v1i2.21578.
- 12.Chesbrough M. District laboratory practice in tropical countries, part II. 2. New York: Cambridge University Press; 2006.
- 13.Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing. 28th edition Informational supplement M100-S28. Wayne PCalsi. 2018.
- 14.Giske CG, Gezelius L, Samuelsen M, Warner AS, Woodford N. A sensitive and specific phenotypic assay for detection of metallo-β-lactamases and KPC in Klebsiella pneumoniae with the use of meropenem disks supplemented with aminophenylboronic acid, dipicolinic acid and cloxacillin. Clin Microbiol Infect. 2011;17(4). 10.1111/j.1469-0691.2010.03294.x. [DOI] [PubMed]
- 15.Gurung S, et al. Detection of oxa-48 gene in carbapenem-resistant escherichia coli and klebsiella pneumoniae from urine samples. Infect Drug Resist. 2020;13:2311–2321. doi: 10.2147/IDR.S259967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Vol. 1, 2nd ed. Cold Spring Harbor Laboratory Press; 1989.
- 17.Shrestha B, Sah AK, Thakuri LS, Pradhan RN, Nath DK, Mainali S, et al. Detection Of Kpc And Oxa-48 Gene In Clinical Isolates Of Carbapenem Resistant Klebsiella Pneumoniae. 2019. 10.21203/rs.2.15835/v1.
- 18.Nepal K, Pant ND, Neupane B, Belbase A, Baidhya R, Shrestha RK, et al. Extended spectrum beta-lactamase and metallo beta-lactamase production among Escherichia coli and Klebsiella pneumoniae isolated from different clinical samples in a tertiary care hospital in Kathmandu, Nepal. Ann Clin Microbiol Antimicrob. 2017;16(1):62. 10.1186/s12941-017-0236-7. [DOI] [PMC free article] [PubMed]
- 19.Nirwati H, Sinanjung K, Fahrunissa F, Wijaya F, Napitupulu S, Hati VP, et al. Biofilm formation and antibiotic resistance of Klebsiella pneumoniae isolated from clinical samples in a tertiary care hospital, Klaten, Indonesia. BMC Proc. 2019;13(S11):20. 10.1186/s12919-019-0176-7. [DOI] [PMC free article] [PubMed]
- 20.Hamid ME, Mustafa FY, Alwaily A, Abdelrahman S, Al Azragi T. Prevalence of Bacterial Pathogens in Aseer Region, Kingdom of Saudi Arabia: Emphasis on Antimicrobial Susceptibility of Staphylococcus aureus. Oman Med J. 2011;26(5):368. doi: 10.5001/OMJ.2011.91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kidd TJ, Mills G, Sá‐Pessoa J, Dumigan A, Frank CG, Insua JL, et al. A Klebsiella pneumoniae antibiotic resistance mechanism that subdues host defences and promotes virulence. EMBO Mol Med. 2017;9(4):430–47. 10.15252/emmm.201607336. [DOI] [PMC free article] [PubMed]
- 22.Arnold RS, Thom KA, Sharma S, Phillips M, Kristie Johnson J, Morgan DJ. Emergence of Klebsiella pneumoniae Carbapenemase (KPC)-Producing Bacteria. South Med J. 2011;104(1):40. doi: 10.1097/SMJ.0B013E3181FD7D5A. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Salomão MC, Freire MP, Boszczowski I, Raymundo SF, Guedes AR, Levin AS. Increased risk for carbapenem-resistant enterobacteriaceae colonization in intensive care units after hospitalization in emergency department. Emerg Infect Dis. 2020;26(6). 10.3201/EID2606.190965. [DOI] [PMC free article] [PubMed]
- 24.Seifi K, Kazemian H, Heidari H, Rezagholizadeh F, Saee Y, Shirvani F, et al. Evaluation of Biofilm Formation Among Klebsiella pneumoniae Isolates and Molecular Characterization by ERIC-PCR. Jundishapur J Microbiol. 2016;9(1). 10.5812/jjm.30682. [DOI] [PMC free article] [PubMed]
- 25.Khairy RMM, Mahmoud MS, Shady RR, Esmail MAM. Multidrug-resistant Klebsiella pneumoniae in hospital-acquired infections: Concomitant analysis of antimicrobial resistant strains. Int J Clin Pract. 2020;74(4):e13463. doi: 10.1111/IJCP.13463. [DOI] [PubMed] [Google Scholar]
- 26.Cprek JB, Gallagher JC. Ertapenem-containing double-carbapenem therapy for treatment of infections caused by carbapenem-resistant Klebsiella pneumoniae. Antimicrob Agents Chemother. 2016;60(1):669–673. doi: 10.1128/AAC.01569-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Biradar S, Roopa C. Isolation and antibiogram of Klebsiella species from various clinical specimens. Int J Curr Microbiol Appl Sci. 2015;4(9):991–995. [Google Scholar]
- 28.Bhandari P, Thapa G, Pokhrel BM, Bhatta DR, Devkota U. Nosocomial Isolates and Their Drug Resistant Pattern in ICU Patients at National Institute of Neurological and Allied Sciences, Nepal. Int J Microbiol. 2015;2015:572163. 10.1155/2015/572163. [DOI] [PMC free article] [PubMed]
- 29.Parajuli NP, Acharya SP, Mishra SK, Parajuli K, Rijal BP, Pokhrel BM. High burden of antimicrobial resistance among gram negative bacteria causing healthcare associated infections in a critical care unit of Nepal. Antimicrob Resist Infect Control. 2017;6(1):1–9. doi: 10.1186/S13756-017-0222-Z/TABLES/5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Yadav KK, Adhikari N, Khadka R, Pant AD, Shah B. Multidrug resistant Enterobacteriaceae and extended spectrum β-lactamase producing Escherichia coli: a cross-sectional study in National Kidney Center, Nepal. Antimicrob Resist Infect Control. 2015;4(1). 10.1186/s13756-015-0085-0. [DOI] [PMC free article] [PubMed]
- 31.Lohani B, Thapa M, Sharma L, Adhikari H, Sah AK, Khanal AB, et al. Predominance of CTX-M Type Extended Spectrum β-lactamase (ESBL) Producers Among Clinical Isolates of Enterobacteriaceae in a Tertiary Care Hospital, Kathmandu, Nepal. Open Microbiol J. 2019;13(1):28–33. 10.2174/1874285801913010028.
- 32.Mshana SE, Kamugisha E, Mirambo M, Chakraborty T, Lyamuya EF. Prevalence of multiresistant gram-negative organisms in a tertiary hospital in Mwanza, Tanzania. BMC Res Notes. 2009;2. 10.1186/1756-0500-2-49. [DOI] [PMC free article] [PubMed]
- 33.Ali FS, Authman SH, Al Marjani MF. Imipenem resistance and biofilm formation in Klebsiella pneumoniae from some hospitals in Baghdad city. J Pharm Sci Res. 2019;11(1):233–8.
- 34.Estabraghi E, Salehi TZ, Amini K, Jamshidian M. Molecular Identification of Extended-Spectrum β-lactamase and Integron Genes in Klebsiella pneumonia. vol. 54, no. 2. [PubMed]
- 35.Rizwan M, Akhtar M, Najmi AK, Singh K. Escherichia coli and Klebsiella pneumoniae Sensitivity/Resistance Pattern Towards Antimicrobial Agents in Primary and Simple Urinary Tract Infection Patients Visiting University Hospital of Jamia Hamdard New Delhi. Drug Res. 2018;68(7). 10.1055/a-0576-0079. [DOI] [PubMed]
- 36.Shilpakar A, Ansari M, Rai KR, Rai G, Rai SK. Prevalence of multidrug-resistant and extended-spectrum beta-lactamase producing Gram-negative isolates from clinical samples in a tertiary care hospital of Nepal. Trop Med Health. 2021;49(1). 10.1186/s41182-021-00313-3. [DOI] [PMC free article] [PubMed]
- 37.Steinbuch KB, Fridman M. Mechanisms of resistance to membrane-disrupting antibiotics in Gram-positive and Gram-negative bacteria. Medchemcomm. 2016;7(1):86–102. doi: 10.1039/C5MD00389J. [DOI] [Google Scholar]
- 38.Sun K, Yajjala VK, Bauer C, Talmon GA, Fischer KJ, Kielian T, et al. Nox2-derived oxidative stress results in inefficacy of antibiotics against post-influenza S. aureus pneumonia. J Exp Med. 2016;213(9):1851–64. 10.1084/jem.20150514. [DOI] [PMC free article] [PubMed]
- 39.Arias CA, Murray BE. Antibiotic-Resistant Bugs in the 21st Century—A Clinical Super Challenge. N Engl J Med. 2009;360(5):439–43. 10.1056/NEJMp0804651. [DOI] [PubMed]
- 40.Ngamprasertchai T, Boonyasiri A, Charoenpong L, Nimitvilai S, Lorchirachoonkul N, Wattanamongkonsil L, et al. Effectiveness and safety of polymyxin B for the treatment of infections caused by extensively drug-resistant Gram-negative bacteria in Thailand. Infect Drug Resist. 2018;11:1219–24. 10.2147/IDR.S169939. [DOI] [PMC free article] [PubMed]
- 41.Acharya KP, Wilson RT. Antimicrobial Resistance in Nepal. Front Med. 2019;6:105. 10.3389/fmed.2019.00105. [DOI] [PMC free article] [PubMed]
- 42.Rai GK, Upreti HC, Rai SK, Shah KP, Shrestha RM. Causative agents of urinary tract infections in children and their antibiotic sensitivity pattern: a hospital based study. Nepal Med Coll J. 2008;10(2). [PubMed]
- 43.Dalhoff A. Global fluoroquinolone resistance epidemiology and implictions for clinical use. Interdiscip Perspect Infect Dis. 2012;2012:976273. 10.1155/2012/976273. [DOI] [PMC free article] [PubMed]
- 44.Baral P, Neupane S, Marasini BP, Ghimire KR, Lekhak B, Shrestha B. High prevalence of multidrug resistance in bacterial uropathogens from Kathmandu, Nepal. BMC Res Notes. 2012;5:38. 10.1186/1756-0500-5-38. [DOI] [PMC free article] [PubMed]
- 45.Poudyal S, Bhatta DR, Shakya G, Upadhyaya B, Dumre SP, Buda G, et al. Extended spectrum â-lactamase producing multidrug resistant clinical bacterial isolates at National Public Health Laboratory, Nepal. Nepal Med Coll J: NMCJ. 2011;13(1):34–8. [PubMed]
- 46.Shakya P, Shrestha D, Maharjan E, Sharma VK, Paudyal R. ESBL Production Among E. coli and Klebsiella spp. Causing Urinary Tract Infection: A Hospital Based Study. Open Microbiol J. 2017;11(1). 10.2174/1874285801711010023. [DOI] [PMC free article] [PubMed]
- 47.Jaggi N, Sissodia P, Sharma L. Control of multidrug resistant bacteria in a tertiary care hospital in India. Antimicrob Resist Infect Control. 2012;1(1):1–8. doi: 10.1186/2047-2994-1-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Kanafani ZA, Mehio-Sibai A, Araj GF, Kanaan M, Kanj SS. Epidemiology and risk factors for extended-spectrum β-lactamase- producing organisms: A case control study at a tertiary care center in Lebanon. Am J Infect Control. 2005;33(6). 10.1016/j.ajic.2005.03.009. [DOI] [PubMed]
- 49.Marcel J-P, Alfa M, Baquero F, Etienne J, Goossens H, Harbarth S, et al. Healthcare-associated infections: Think globally, act locally. Clinical Microbiology and Infection: The Official Publication of the European Society of Clinical Microbiology and Infectious Diseases. 2008;14(10):895–907. 10.1111/j.1469-0691.2008.02074.x. [DOI] [PubMed]
- 50.Endimiani A, Hujer AM, Perez F, Bethel CR, Hujer KM, Kroeger J, et al. Characterization of blaKPC-containing Klebsiella pneumoniae isolates detected in different institutions in the Eastern USA. J Antimicrob Chemother. 2009;63(3):427–37. 10.1093/jac/dkn547. [DOI] [PMC free article] [PubMed]
- 51.Centers for Disease Control and Prevention (CDC). Vital signs: Carbapenem-resistant Enterobacteriaceae. MMWR. Morb Mortal Wkly Rep. 2013;62(9):165–70. [PMC free article] [PubMed]
- 52.Tsakris A, Kristo I, Poulou A, Themeli-Digalaki K, Ikonomidis A, Petropoulou D, et al. Evaluation of Boronic Acid Disk Tests for Differentiating KPC-Possessing Klebsiella pneumoniae Isolates in the Clinical Laboratory. J Clin Microbiol. 2009;47(2):362–7. 10.1128/JCM.01922-08. [DOI] [PMC free article] [PubMed]
- 53.Foschi C, Salvo M, Laghi L, Zhu C, Ambretti S, Marangoni A, et al. Impact of meropenem on Klebsiella pneumoniae metabolism. PLOS ONE. 2018;13(11):e0207478. 10.1371/journal.pone.0207478. [DOI] [PMC free article] [PubMed]
- 54.Bonomo RA. β-Lactamases: A Focus on Current Challenges. Cold Spring Harb Perspect Med. 2017;7(1):a025239. doi: 10.1101/CSHPERSPECT.A025239. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Nordmann P, Naas T, Poirel L. Global Spread of Carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis. 2011;17(10):1791. doi: 10.3201/EID1710.110655. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Poirel L, Pitout JD, Nordmann P. Carbapenemases: Molecular diversity and clinical consequences. Future Microbiol. 2007;2(5):501–12. 10.2217/17460913.2.5.501. [DOI] [PubMed]
- 57.Livermore DM. Multiple mechanisms of antimicrobial resistance in Pseudomonas aeruginosa: Our worst nightmare? Clin Infect Dis. 2002;34(5):634–640. doi: 10.1086/338782/2/34-5-634-FIG002.GIF. [DOI] [PubMed] [Google Scholar]
- 58.Kitchel B, Rasheed JK, Endimiani A, Hujer AM, Anderson KF, Bonomo RA, et al. Genetic factors associated with elevated carbapenem resistance in KPC-producing Klebsiella pneumoniae. Antimicrob Agents Chemother. 2010;54(10):4201–7. 10.1128/AAC.00008-10. [DOI] [PMC free article] [PubMed]
- 59.Peleg AY, Franklin C, Bell JM, Spelman DW. Dissemination of the metallo-β-lactamase gene blaIMP-4 among gram-negative pathogens in a clinical setting in Australia. Clin Infect Dis. 2005;41(11):1549–1556. doi: 10.1086/497831/2/41-11-1549-FIG002.GIF. [DOI] [PubMed] [Google Scholar]
- 60.Pournaras S, Poulou A, Tsakris A. Inhibitor-based methods for the detection of KPC carbapenemase-producing Enterobacteriaceae in clinical practice by using boronic acid compounds. J Antimicrob Chemother. 2010;65(7):1319–1321. doi: 10.1093/JAC/DKQ124. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
