Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 Jan 1.
Published in final edited form as: J Aerosol Sci. 2023 Sep 11;175:106263. doi: 10.1016/j.jaerosci.2023.106263

The BioCascade-VIVAS system for collection and delivery of virus-laden size-fractionated airborne particles

Sripriya Nannu Shankar a,*, William B Vass a, John A Lednicky b,c, Tracey Logan b,c, Rebeccah L Messcher b,c, Arantzazu Eiguren-Fernandez d, Stavros Amanatidis d, Tara Sabo-Attwood b,c, Chang-Yu Wu a,e
PMCID: PMC11044810  NIHMSID: NIHMS1939879  PMID: 38680161

Abstract

The size of virus-laden particles determines whether aerosol or droplet transmission is dominant in the airborne transmission of pathogens. Determining dominant transmission pathways is critical to implementing effective exposure risk mitigation strategies. The aerobiology discipline greatly needs an air sampling system that can collect virus-laden airborne particles, separate them by particle diameter, and deliver them directly onto host cells without inactivating virus or killing cells. We report the use of a testing system that combines a BioAerosol Nebulizing Generator (BANG) to aerosolize Human coronavirus (HCoV)-OC43 (OC43) and an integrated air sampling system comprised of a BioCascade impactor (BC) and Viable Virus Aerosol Sampler (VIVAS), together referred to as BC-VIVAS, to deliver the aerosolized virus directly onto Vero E6 cells. Particles were collected into four stages according to their aerodynamic diameter (Stage 1: >9.43 μm, Stage 2: 3.81–9.43 μm, Stage 3: 1.41–3.81 μm and Stage 4: <1.41 μm). OC43 was detected by reverse-transcription quantitative polymerase chain reaction (RT-qPCR) analyses of samples from all BC-VIVAS stages. The calculated OC43 genome equivalent counts per cm3 of air ranged from 0.34±0.09 to 70.28±12.56, with the highest concentrations in stage 3 (1.41–3.81 μm) and stage 4 (<1.41 μm). Virus-induced cytopathic effects appeared only in cells exposed to particles collected in stages 3 and 4, demonstrating the presence of viable OC43 in particles <3.81 μm. This study demonstrates the dual utility of the BC-VIVAS as particle size-fractionating air sampler and a direct exposure system for aerosolized viruses. Such utility may help minimize conventional post-collection sample processing time required to assess the viability of airborne viruses and increase the understanding about transmission pathways for airborne pathogens.

Keywords: Exposure system, virus infectivity, air sampling, bioaerosols, particle size

1. Introduction

Airborne viruses can be transmitted from an infected person to others by direct or indirect contact with infectious secretions from infected hosts. For example, transmission can occur through contact between virus-containing droplets and susceptible respiratory epithelial cells of the upper respiratory tract, or through inhalation of virus-laden particles (Leung 2021; Geng and Wang 2023). Respiratory viruses such as influenza virus, severe acute respiratory syndrome coronavirus (SARS-CoV), SARS-CoV-2 and Middle East respiratory syndrome coronavirus (MERS-CoV) can be transmitted through droplets or aerosols (Lednicky and Loeb 2013; Booth et al. 2005; Lednicky et al. 2020a; Kim et al. 2016). According to the World Health Organization (WHO) and Centers for Disease Control and Prevention (CDC), particles with aerodynamic diameter more than 5 μm are called droplets and those less than 5 μm are called aerosols or droplet nuclei (Siegel et al. 2007; WHO 2014; Jayaweera et al. 2020). Under standard atmospheric conditions, droplets evaporate before reaching the ground, and the evaporated droplet residue can remain suspended in the air as droplet nuclei, for prolonged time periods (Morawska 2006). Thus, the size of virus-laden particles shed by infected individuals determines whether droplet or aerosol transmission is dominant and is the basis upon which mitigation strategies for minimizing exposure risks are recommended. Environmental monitoring through air sampling methods can provide information on the size of virus-laden particles in the air.

Variabilities in biochemical and biophysical characteristics of different types of viruses complicate devising a standard protocol or using a standard air sampler to collect airborne viruses (Pan et al. 2019a). Attempts to collect airborne viruses in a liquid medium have been made using air samplers such as the BioSampler® (Verreault at al. 2008), a high air flow rate electrostatic sampler (Kim et al. 2021), and impingers (Chen et al. 2021). Others have attempted to collect airborne viruses onto rigid surfaces, such as impaction plates in the Andersen cascade impactor (Appert et al. 2012), tubes in the NIOSH 2-stage cyclone bioaerosol sampler (Cao et al. 2011), and filters as in the Sioutas cascade impactor (Lednicky and Loeb 2013). Though these samplers collect particles by size-fractionation, collection onto dry surfaces is only suitable for short-term sampling since longer sampling time can lead to desiccation and loss of virus viability. Collection into a liquid medium is advantageous as it prevents desiccation and facilitates extraction of genetic materials for subsequent analyses (Uhrbrand et al. 2018). However, the existing samplers that collect virus-laden particles into a liquid medium do not provide information on the particle size.

Post collection of virus-laden particles, it is important to assess the infectivity or viability of the virus, since only viable viruses can cause infection. Conventionally, assessing the viability of the virus is performed by inoculating a fraction of the sample collected by an air sampler onto susceptible/permissive cells and observation thereof for signs of virus isolation, such as the production of virus-induced cytopathic effects (CPE). Depending on the air sampler used in the study, several post-collection steps might be required prior to inoculation. For example, influenza A H3N2 virus was isolated from samples collected onto filters in a Sioutas personal cascade impactor sampler by the following steps: (1) wetting the filter with 0.5% bovine serum albumin (BSA) in phosphate buffered saline (PBS); (2) scraping the filters with wetted flocked swabs; (3) transferring the scraped material into 10 mL aliquots of BSA in PBS; (4) concentrating the volume to 400 μL by ultrafiltration; (5) re-adjusting the volume to 500 μL by addition of BSA in PBS; (6) inoculating a fraction (50 μL) of the concentrated sample onto susceptible/permissive (indicator) cells or storing the sample at −80 °C until analysis (Lednicky and Loeb 2013). In the same study, airborne particles were also collected into a liquid medium (15 mL), using the SKC BioSampler®. The sample was then (1) concentrated to 400 μL by ultrafiltration; (2) re-adjusted to 500 μL by addition of BSA in PBS; and (3) either a fraction of the re-adjusted sample was inoculated to indicator cells, or the samples were stored at −80 °C until analysis. Similar procedures are usually followed for collection of air samples, either on a surface (such as filters, or empty Petri dishes) or in a liquid collection medium. Thus, the viability of the virus can possibly be lost during collection, post-collection processing steps, or during storage.

Delivering size-fractionated virus-laden particles directly onto cells can minimize the time and effort on the post-collection processes mentioned above, while concurrently providing information on the viability of the virus. Exposure systems such as VITROCELL® (Ding et al. 2020), CULTEX® (Kaur et al. 2021) and Dosimetric Aerosol in Vitro Inhalation Device (Tilly et al. 2019) have been established as tools for the direct delivery of airborne nanoparticles to lung cells. However, past studies with these exposure systems have not involved the classification of airborne particles according to their aerodynamic diameters, nor have they demonstrated the direct delivery of viruses to host cells.

From the literature cited above, it is evident that (1) no standard air sampler or air sampling method exists for the collection of airborne viruses; (2) air samples collected by current samplers require additional processing involving virus inoculation into flasks or onto Petri dishes containing susceptible indicator cells to demonstrate the infectivity of the virus; (3) no air samplers efficiently collect virus-laden particles, separate them into size fractions, and also conserve the virus viability; and (4) exposure systems used for direct delivery of nanoparticles to lung cells have not been publicly disclosed for delivering airborne viruses to host cells. Therefore, a system that can alleviate these limitations can offer great benefit toward improved understanding related to the predominant mode of virus transmissions (i.e., droplet or aerosol).

In this study, a recently developed air sampler (the BioCascade impactor) was integrated with a Viable Virus Aerosol Sampler (VIVAS) to collect virus-laden airborne particles according to their aerodynamic diameters in 4 stages (<1.41, 1.41–3.81, 3.81–9.43 and >9.43 μm) containing liquid collection medium. Further, the integrated system was also used to directly deliver the collected particles onto indicator cells, to provide information on the viability of the virus.

2. Materials and Methods

2.1. Air Samplers

Two air samplers, namely the BioCascade (BC) and VIable Virus Aerosol Sampler (VIVAS) designed and developed by Aerosol Dynamics Inc., USA, were integrated to collect size-fractionated airborne particles in four stages for this study. Briefly, the BC is a planar cascade impactor consisting of 3 successive stages on the same plane to collect particles by gentle impaction into liquid medium. The BC impaction stages were customized for this study to operate at a flowrate of 4.5 LPM with 9.43, 3.81 and 1.41 μm as the nominal cut-points. Additional information on the impaction stage characteristics is included in the supplementary information that accompanies this article (Table S1). The VIVAS works on water-based condensational growth technology, wherein airborne particles are efficiently size-amplified by condensation as they travel through the growth tubes (Hering and Stolzenburg 2005; Hering et al. 2014; Eiguren-Fernandez et al. 2014). Prior studies have demonstrated the ability of the VIVAS to collect viable airborne viruses in laboratory (Lednicky et al. 2016) and field studies (Pan et al. 2017; Lednicky et al. 2020a; Nannu Shankar et al. 2022). When the outlet of the BC was connected to the inlet of the VIVAS, particles of size <1.41 μm that exited the BC entered the VIVAS. Thus, the integrated system (BC-VIVAS) collected particles across 4 stages (Stage 1: >9.43 μm, Stage 2: 3.81–9.43 μm, Stage 3: 1.41–3.81 μm and Stage 4: <1.41 μm). The collection units of all the stages house commercially available Petri dishes (35 mm diameter, Nunclon™ Delta Surfaced, Thermo Fisher Scientific Inc., USA) containing Vero E6 cells cultured as stated in section 2.3.

2.2. Experimental Setup

Experiments were conducted with Human coronavirus-OC43 strain JL diluted in virus transport medium (VTM) to achieve a working concentration of 3.88×108±7.49×107 virus genome equivalents (GE) per mL as measured by Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-qPCR). A 5-port system described and validated by Tuttle et al. (2010) was used to generate and collect virus-laden aerosols in a BSL2+ facility by trained personnel that performed work using BSL3 practices. Briefly, the setup consisted of a 3-jet BioAerosol Nebulizing Generator (BANG, BGI Inc., USA) operating at 3 LPM to produce virus-laden particles for 15 min from 10 mL of a suspension of OC43 within a nebulizer jar containing 0.25% Antifoam B emulsion (Figure 1). The aerosols were further diluted with 9 LPM of particle-free clean air. The supply air for both the BANG and that used for dilution was high-pressure air generated by an air compressor and filtered with a high efficiency particle arresting (HEPA) filter. The total flow rate of the BC-VIVAS was set to 4.5 LPM, since this flow rate was shown to have no effect on the viability of cells in an earlier study with a VIVAS prototype (Tilly et al. 2019). Excess air in the setup was released to the ambient through a valved exhaust system equipped with HEPA filters. A Magnehelic® differential pressure gauge (Dwyer Instruments Inc., USA) at the exhaust system was used to monitor negative pressure (~0.5 in H2O) within the setup. The center port of the 5-port system was connected to the inlet of the BC-VIVAS. A similar setup was used to deliver the virus-laden particles to the VIVAS only and also to measure the aerosol size distribution using an aerodynamic particle sizer spectrometer (APS, Model 3321, TSI Inc., USA).

Figure 1.

Figure 1.

Open in a new tab

(a) Integrated setup of BC-VIVAS operated at 4.5 LPM; (b) Experimental setup for aerosolization and delivery of HCoV-OC43. The dash lines of BC-VIVAS, VIVAS and APS represent experiments conducted sequentially from the same port of the system.

2.3. Cell Culture

The composition of VTM used to prepare working concentration of OC43 virus was described in Nannu Shankar et al. (2022). Vero E6 cells (African green monkey kidney cells, ATCC CRL-1586) were used as the host cells to determine the infectivity of OC43. The cells were grown in 35 mm diameter Petri dishes (Nunclon™ Delta surface treated, Fisher Scientific, USA) containing advanced Dulbecco’s Modified Eagle Medium (Gibco, Fisher Scientific, USA) supplemented with 10% heat activated & gamma irradiated fetal bovine serum, 1% Penicillin-Streptomycin-Neomycin and 1% Glutamax (Fisher Scientific, USA). Once the monolayer of cells achieved 80% confluence, they were used for the experiments.

2.4. Collection and Processing of Virus-Laden Particles

Post-collection, the Petri dishes were incubated in a CO2 incubator (ThermoScientific, USA) maintained at 37 °C and 5% CO2. To ensure that the nebulizer suspension used for aerosolization contained viable OC43, 50 μL aliquots of the suspension before and after each trial were also inoculated into Petri dishes containing Vero E6 cells. Sham controls included Vero E6 cells exposed to particle-free air by connecting a HEPA filter to the inlet of BC-VIVAS or VIVAS. The Vero E6 cell cultures were observed daily for development of CPE using an inverted microscope (CKX41, Olympus Life Science, USA). Aliquots of the medium from the Petri dishes (on the day of the experiment and 24 hr after the experiment was conducted) were stored in a −80 °C freezer until analysis.

2.5. Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-qPCR) Analysis

Virus RNA (vRNA) was extracted from the virions in the collection media and the nebulizer suspensions using a QIAamp Viral RNA Kit (Qiagen, USA). RT-qPCR tests were performed in a BioRad CFX96 touch real-time PCR detection system using 5 μL of purified RNA. SuperScript III reverse transcriptase from a SuperScript III Platinum One-Step RT-qPCR Kit (Invitrogen, USA) was used for cDNA synthesis, and Platinum Taq DNA polymerase from the same kit for PCR. The RT-qPCR reactions were performed using primers and the probe described by Vijgen et al. (2005). Thermocycling conditions were as follows: reverse transcription at 50 °C for 20 min, initial denaturation at 95 °C for 2 min, followed by 45 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C for 30 s and extension at 68 °C for 10 s. With this detection system, the limit of detection (LOD) was 25 OC43 genome equivalents per 25 μL qPCR reaction. A 6-log standard curve (Figure S1) was obtained from 10-fold dilutions of plasmid DNA consisting of the OC43 strain JL M gene that had been synthesized at IDT Technologies Inc., (Coralville, Iowa, USA), and the details of the primers/probe used are presented in Table 1. Data analyses to calculate the GE/cm3 per ΔlogDp from the standard curve and the evaporation of collection medium are detailed in the supplementary information that accompanies this article (sections 1.1 and 1.3).

Table 1.

HCoV-OC43 strain JL M gene RT-qPCR detection system.

Primer/Probe Sequence (5’ to 3’) Location in NC_006213.1a
Forward-primer ATGTTAGGCCGATAATTGAGGACTAT 28777-28802
Reverse-primer AATGTAAAGATGGCCGCGTATT 28844-28823
Probe 6-FAM / CATACTCTG / ZEN / ACGGTCACAAT / IABkFQ 28803-28822
M-Gene G-Block Control Template CGCAGTATGTTTGTTTATGTTATTAAGATGATTATTTTGTGGCTTATGTGGCCCCTTACTATAATCTTAACTATTTTCAATTGCGTATACGCATTGAATAATGTGTATCTTGGCCTTTCTATAGTTTTTACCATAGTGGCCATTATTATGTGGATTGTGTATTTTGTGAATAGTATCAGGTTGTTTATTAGAACTGGAAGTTTTTGGAGTTTCAACCCAGAAACAAACAACTTGATGTGTATAGATATGAAAGGAACAATGTATGTTAGGCCGATAATTGAGGACTATCATACTCTGACGGTCACAATAATACGCGGCCATCTTTACATTCAAGGTATAAAACTAGGTACTGGCTATTCTTTGGCAGATTTGCCAGCTTATATGACTGTTGCTAAGGTTACACACCTGTGCACATATAAG 28515-28934
Open in a new tab
a

Human coronavirus OC43 strain ATCC VR-759, complete genome (GenBank No. NC_006213.1).

2.6. Estimation of Viable and Inactivated Virus

One-step growth assays conducted by our group have indicated that progeny (replicated) OC43 started to accumulate in the cell media by 36 hrs post-infection, but the maximal level occurred over 48 hrs post-infection of the cells (data unpublished). Although OC43 was detected at 24 hrs, it could not be passed yet, i.e., it was not infectious. This was the basis of our assumption that OC43 detected in the cell culture medium after 24 hr of exposure contained the non-viable fraction. The percentage of OC43 GE/mL that was viable and hence infected the cells was then calculated as

%ViableOC43=(GEmL)exposureday−(GEmL)24hpostexposure(GEmL)exposureday×100 (1)
%Inactivatedvirus=100−%Viablevirus (2)

An example of the calculation is presented in the supplementary information (section 1.2).

2.7. Statistical Analysis

Experiments were conducted in triplicate, and the results presented as mean ± standard deviation. An unpaired t-test was used to compare the means of GE/cm3 collected by the BC-VIVAS and VIVAS. A Mann-Whitney U test was used to assess significant differences in collection between replicate experiments using the BC-VIVAS. A Friedman test and Tukey’s multiple comparison test were used to compare the GE/cm3 collected by different stages of the BC-VIVAS on the day of exposure. The same statistical tests (Friedman test and Tukey’s multiple comparison test) were used to compare the GE/mL in samples aliquoted from different stages of BC-VIVAS 24 hr post-exposure. The threshold for a significantly different result was set at p = 0.05 for all tests. All statistical analyses were performed in GraphPad Prism (Version 9.5.1 (733)), or R (Version 4.1.2) and the graphs plotted with Origin (Pro), (Version 2023b, OriginLab Corporation, USA).

3. Results

3.1. RT-qPCR Analysis

The concentration of OC43 RNA/cm3 (i.e., GE/cm3) determined in samples aliquoted from the BC-VIVAS immediately after their collection are presented in Figure 2. The highest GE/cm3 values were detected in material collected in stage 3 (70.28 ± 12.56) of the BC-VIVAS, followed by stages 4 (16.62 ± 1.09), 2 (2.28 ± 0.09) and 1 (0.34 ± 0.09). This corresponded to 78.19±3.93, 18.86±3.57, 2.57±0.32 and 0.38±0.11 % of the total OC43 GE/cm3 of air collected by the BC-VIVAS, respectively. There was no significant difference between the three replicate experiments conducted with the BC-VIVAS (p>0.05). There was significant difference in the GE/cm3 between stages of the BC-VIVAS, as recorded by Friedman rank sum test (p=0.029) and Tukey’s multiple comparison test (p<0.0001). An unpaired t-test showed that the total GE/cm3 collected by the BC-VIVAS had a significant difference (p=0.03) when compared with that collected by VIVAS alone, though they were in the same order of magnitude (89.51±11.79 GE/cm3 by BC-VIVAS vs. 59.76±11 GE/cm3 by VIVAS).

Figure 2.

Figure 2.

Open in a new tab

OC43 GE/cm3 of air per Δlog(aerodynamic diameter) for BC-VIVAS and aerosol size distribution measured by the APS (The GE/cm3 recorded in each stage is marked against the corresponding size bins).

The aerosol size distribution recorded by the APS supports detection of vRNA in all the stages of the BC-VIVAS. As shown in Figure 2, the aerosol size distribution by surface area had a mode at 2.6 μm, supporting detection of OC43 predominantly in particles <3.81 μm.

3.2. Infectivity of OC43 Collected by BC-VIVAS

Cell-culture images representative of the virus-induced CPE post-exposure to OC43 are presented in Figure 3. The following sequence of CPE were evident in stages 3 and 4 of the BC-VIVAS (corresponding to particles of aerodynamic diameter 1.41–3.81 μm and <1.41 μm respectively). Three days post-inoculation (dpi), foci of infection were observed (Figure 3a). On days 4 and 5, vacuolization and some dead cells were evident (Figure 3b, c). By day 6, rounding of cells was more pronounced, suggesting that cells were detaching from the surface of the Petri dish due to cell death, and by day 7 (Figure 3d) almost all the cells were dead, as evidenced by translucent, floating cells and “open spaces” resulting from detachment of cells from the growing surface of the Petri dish. A similar sequence of CPE was also observed when the virus-laden particles were collected only by the VIVAS, i.e., without size-fractionation. No CPE were observed in the sham control up to 14 days post-exposure (Figure 3e), which shows that particle-free air caused minimal to no damage to Vero E6 cells. The cells in stages 1 and 2 of the BC-VIVAS appeared same as the sham control, suggesting the absence of viable OC43 in particles collected by those stages. As evidenced by CPE, viable OC43 was present in particles <3.81 μm.

Figure 3.

Figure 3.

Open in a new tab

Virus-induced CPEs in Vero E6 cells exposed to HCoV-OC43 in stage 3 (a) 3 dpi, (b) 4 dpi, (c) 5 dpi, and (d) 7 dpi. (e) Vero E6 cells exposed to particle free air; (f) Unexposed Vero E6 cells (negative control). All images at 400x magnification. [Translucent, floating cells in b-d are dead cells].

RT-qPCR analyses of samples aliquoted from the Petri dishes 24 hr post experiments suggested a fraction of the OC43 had not infected the cells, likely because they were not viable. The non-viable or inactivated OC43 in the nebulizer suspension was <0.001% of the total OC43 GE/mL, as calculated according to Eq. 2. In samples collected by the BC-VIVAS, the highest % of inactivated OC43 was in stage 1 (4.84±1.46%), followed by stage 2 (0.69±0.14%), stage 4 (0.1±0.04%) and stage 3 (0.013±0.002%) (Table 2).

Table 2.

GE/mL recorded in this study and the percent of viable and inactivated OC43.

BC-VIVAS VIVAS
Stage 1 2 3 4
GE/mL on the exposure day 1.35E+04±3.51E+03 8.78E+04±4.85E+03 2.64E+06±4.65E+05 7.61E+05±4.00E+04 2.57E+06±4.79E+05
GE/mL 24 h post exposure 6.33E+02±1.52E+02 6.06E+02±1.45E+02 3.36E+02±6.17E+01 7.35E+02±3.45E+02 1.73E+03±1.23E+03
Viable OC43 (%) 95.16±1.46 99.31±0.14 99.99±0.002 99.90±0.04 99.94±0.03
Inactivated OC43 (%) 4.84±1.46 0.69±0.14 0.013±0.002 0.10±0.04 0.06±0.03
Open in a new tab

4. Discussion

By connecting the outlet of the BC to the inlet of the VIVAS, OC43-laden particles were successfully collected by size-classification into 4 stages (<1.41, 1.41–3.81, 3.81–9.43 and >9.43 μm) in this study. The cut points of the BC are similar to the ISO/ACGIH/CEN sampling convention for the respirable (4 μm) and thoracic (10 μm) fractions (Ashley and Fey 2017). From the RT-qPCR analysis, it is evident that OC43 was present in all stages of the BC-VIVAS. Stages 3 & 4 of the BC-VIVAS possessed the highest percentage of OC43 GE/cm3 with respect to the total GE/cm3 collected by the BC-VIVAS. Correlating this with the CPE observed in these stages in 3 dpi suggests that viable OC43 was predominantly present in particles <3.81 μm.

The nebulizer used to generate aerosols is an important factor in determining the size of virus-containing particles, and the viability of the virus. Niazi et al. (2021) compared the impact of nebulizing influenza viruses (H1N1 and H3N2) and human rhinovirus-16, using the Collison nebulizer, vibrating mesh nebulizer and hydraulic spray atomizer. The authors of that study found that the survival fraction of the virus after aerosolization and the aerosol concentrations varied, which could be attributed to the variations in the mechanism in which these nebulizers function, and also the sensitivity of the virus towards physical stress. Coronaviruses are enveloped viruses - their envelopes are supported by proteins, and the genome is bound by the nucleocapsid protein inside the envelope (Liu et al. 2021). In general, nucleocapsid protein protects the viral genome (Wade et al. 2022). This suggests the need for choosing a suitable nebulizer with minimal to no impact on the viral integrity, such as the BANG used in this study.

According to Lee (2009) and Zuo et al. (2013) the concentrations of infectious and total virus (MS2 bacteriophage, transmissible gastroenteritis virus, swine influenza virus, and avian influenza virus) followed particle volume distribution rather than particle number distribution, since the latter could include particles consisting of chemicals dissolved in the nebulization medium (i.e., particles with no virus) and thus, does not necessarily indicate how the virus is distributed among particles of varying sizes. Through a conceptual model, Pan et al. (2019b) showed that aerosolized viruses could aggregate in the virus-containing particles, distribute homogenously within particles, or accumulate on the surface of particles, depending on the nebulizing medium used. In addition, the extraction process for the components of the medium and preparation process of the medium can affect the hydrophilic or hydrophobic nature of the medium. In this study, the hydrophilic or hydrophobic interactions between the VTM and OC43 were not tested. Since the VTM contained water soluble components, we hypothesized that VTM was less hydrophobic than OC43. According to Pan et al. (2019b), when the virus is more hydrophobic compared to the suspension medium, the virus is attracted to the surface of the particles. In our observation on size distributions weighted by number, volume, and surface area measured by the APS (Figure S2), the distribution of OC43 GE collected in 4 stages of the BC-VIVAS followed the aerosol size distribution by surface area, which validated our hypothesis.

Small human viruses such as circoviruses are 15–25 nm in diameter (Mankertz 2008), while others such as poxviruses (e.g., variola virus) are larger than 100 nm (Louten 2016). Based on literature, OC43 is 80–120 nm in diameter (Liu et al. 2021). In a study by Kutter et al. (2021), the amount of infectious virus collected in each stage of the Andersen cascade impactor varied for different respiratory viruses, which is likely because of the pleomorphic character, size differences or aggregation of viruses. Therefore, size-fractionated collection of virus-laden particles generated in the laboratory or those collected in field studies can yield different results for different viruses. In a laboratory study by Paton et al. (2022), >90% of the total plaque forming units (PFU) of SARS-CoV-2 captured was collected using an Andersen cascade impactor in stages that collected particles <3.3 μm. In a field study, SARS-CoV-2 RNA was detected in particles <4 μm, when collecting air samples in hospitals using the May-type cascade impactor (Groma et al. 2023). In a laboratory study by Cao et al. (2011), infectious influenza virus was present in all size ranges (i.e., <1 μm, 1–4 μm and >4 μm) of the NIOSH BC251 bioaerosol sampler. Using the G-II sampler, Milton et al. (2013) showed that fine particles (≤5 μm) collected from the exhaled breath of patients with influenza virus contained ~9 fold more RNA copies than did coarse particles (>5 μm). Infectious Influenza H3N2 virus was primarily present in particles <1 μm collected using the Sioutas personal cascade impactor from the air of 3 different residences housing infected individuals (Lednicky and Loeb 2013). Infectious SARS-CoV-2 was present in particles <1 μm when air sampling was conducted using the NIOSH BC251 bioaerosol sampler in a hospital setting (Santarpia et al. 2022). The authors of that study also indicate that infectious SARS-CoV-2 could be present in particles up to 4 μm, but it was inconclusive due to potential viral decay during aerosol collection. The abovementioned studies and several other reports in the literature (Weber and Stilianakis 2008; Gralton et al. 2011; Zuo et al. 2013; Alonso et al. 2015) demonstrate that the particle size in which the viruses are present depend on several parameters such as the working principle of the air sampler used and its collection efficiency, the distance between the infected patient and the sampler, the ventilation at the sampling site, environmental parameters (temperature, humidity, etc.), duration between onset of symptoms and sampling, source of particle shedding, sample processing post collection, the host cells used for isolating the virus, etc. Due to such complexities involved in assessing the airborne transmission of viruses, a standard air sampler or a standard method does not exist yet (Pan et al. 2019a).

In this study, CPE were not observed in cells that were exposed to particle-free air, which demonstrates the BC-VIVAS maintained the viability of the cells throughout the collection duration. Thus, the BC-VIVAS could be a powerful tool to deliver infectious airborne viruses directly to host cells, without compromising the viability of the host cells or the virus, thereby minimizing the efforts involved in processing of the samples collected. While the total GE/cm3 of OC43 collected by the BC-VIVAS was in the same order of magnitude as that collected by VIVAS, the latter does not provide information on the size-fractionation. A p-value of 0.03 in the comparison of total GE/cm3 between BC-VIVAS and VIVAS is in the borderline with respect to the threshold (0.05), due to a small sample size. Conducting experiments with a different OC43 concentration in the nebulizer suspension or a larger sample size may provide different results.

Previously, in Fennelly et al. (2015), a monolayer of cells on a Petri dish with liquid medium in an Andersen single-stage impactor could survive short-term desiccation (4 min) resulting from a flowing airstream. Therefore, they recommended collecting the virus in a liquid medium followed by isolating the virus in cell cultures. Lednicky et al. (2016) demonstrated efficient collection of viable influenza virus using a prototype VIVAS, wherein aerosolized virus was collected in a liquid collection medium. In comparison, they found that the VIVAS was superior with its collection efficiency at least 13 times that of the BioSampler®. However, that study did not involve size-fractionation, and required further inoculation of the samples collected onto cells to determine the infectivity. In this study, the total GE aerosolized was ~53 times higher than the total GE collected by the VIVAS, when used as a stand-alone system. For the BC-VIVAS, this ratio was reduced to ~34 times. The total GE/cm3 value collected by the BC-VIVAS (89.51±11.79) was higher than that collected by the VIVAS (59.76±11). According to simulations conducted by Aerosol Devices Inc., (data not shown), particles were deposited at the inlet of the VIVAS with respect to the particle size. Over 90% of particles ≤7.5 μm enter the VIVAS, while >50% of particles ≥10 μm are lost at the inlet, when the VIVAS was operated at 8 LPM. Such loss could have led to a lower GE/cm3 recorded for the VIVAS as a standalone sampler. By connecting the BC to the inlet of the VIVAS, particles >1.41 μm were collected by the BC and those <1.41 μm entered the VIVAS, thus resulting in a higher GE/cm3. This is an important finding, as it shows the significance of integrating BC with the VIVAS, to provide information on size-fractionation as well as the improved collection of the VIVAS in the BC-VIVAS system. Another advantage is the reduction of total concentration entering the VIVAS (stage 4) in the BC-VIVAS system. For systems like VIVAS that operate by condensational particle growth, the number concentration of particles entering the system is an important parameter in determining system efficiency. At high number concentrations, the degree of supersaturation decreases, which limits particle growth (Lewis and Hering 2013). Though this phenomenon is demonstrated in our approach, elaborate studies on determining the biological collection efficiency of the BC-VIVAS vs. VIVAS were not performed, due to the challenges involved in quantifying the viable virus concentrations in the air and transport losses. Nevertheless, the BC-VIVAS is advantageous over existing exposure systems because it sorts particles by their aerodynamic diameters and conserves the viability of both virus and host cells during sampling. In addition, the approach used in this study minimizes the efforts in processing samples, thereby minimizing post-collection viability losses.

There were a few limitations in this study. First, results from conditions used in this study cannot be generalized for all viruses. Varying the experimental conditions, including the virus strain beyond that used in this study, is recommended for future studies, since such variations can yield different results. Second, the % of inactive OC43 was ~<5% of the total OC43 collected across all stages of the BC-VIVAS, yet CPE were evident only in stages 3 and 4. There could be several reasons for the lack of CPE in stages 1 & 2: (1) It is possible that the virus got inactivated in stages 1 and 2 and therefore, was not viable. (2) It is well established that virus inactivation can occur during aerosolization process itself (Li et al. 2021), as a result of which particles >3.81 μm predominantly contained inactivated OC43. (3) Alternatively, it could be that the aerosol generation system produced relatively few particles >3.81 μm with viable virus and that concentration was below the threshold for infecting. (4) The hydrophobicity of the virus or the presence of debris or compounds on the surface of the particles inactivated the virus. (5) In addition, turbulence between the nozzles and the impaction plane in stages 1 and 2 could have inactivated the virus. These potential effects should be considered as areas for investigation in future work.

Third, despite the laboratory application of the BC-VIVAS and VIVAS in directly delivering virus-laden particles to host cells being evident, it is challenging to collect specific airborne viruses through environmental sampling in field studies, since different viruses can infect the same host cell (Pan et al. 2017; Lednicky et al. 2020b; Nannu Shankar et al. 2022). Finally, the collection medium in the BC evaporated quickly, likely due to the dry air flowing through the system and/or the lack of temperature control for the unit. After 15 min of collection, the volume loss was ~16±1.32, 12.5±1.8 and 10.17±0.29 % for stages 1, 2 and 3 of the BC, respectively. In VIVAS, the volume loss was comparatively low (~6.89±3.01%), since it had a temperature control unit attached to the sample holder. The BC was designed based on established guidelines for impaction on flat surfaces and collection in a liquid medium (Table S1). Evaporation of the liquid from the Petri dishes is an important issue to address, since it increases the distance between the nozzle orifices and the impaction plane over time, which can affect the collection efficiency of the stages. To minimize collection volume losses and increase sampling duration, engineering the collection unit of the BC with a temperature module or liquid injection mechanism is recommended.

Further, it is well known that particles in the ambient air (Jamhari et al. 2022), those generated by humans (Lindsley et al. 2010; Lindsley et al. 2012) or those generated during processes such as combustion (Hata et al. 2014), medical procedures (Lahdentausta et al. 2022), etc., are polydisperse. Since the BC-VIVAS can collect particles according to their aerodynamic diameters and also deliver the particles to cells, several materials can be tested for direct assessment of the viability of bioaerosols or toxicity of particles. Future studies on extending the applicability of the BC-VIVAS in different scenarios can provide information on the size distribution of the airborne particles and their impact on environmental health.

5. Conclusions

Direct delivery of OC43 onto Vero E6 cells using the BC-VIVAS showed viable OC43 was present in aerosols <3.81 μm. Both the VIVAS and the BC-VIVAS collected viable OC43, as evidenced by the CPE in particles collected by the VIVAS and stages 3 & 4 of the BC-VIVAS system. The highest GE/cm3 of air was collected by stage 3 (70.28 ± 12.56), followed by stage 4 (16.62 ± 1.09), stage 2 (2.28 ± 0.09) and stage 1 (0.34 ± 0.09). This study shows that the BC-VIVAS is an effective tool to collect viable OC43 in airborne particles, separate them according to their aerodynamic diameters, and deliver them directly to host cells without inactivating the virus or killing host cells. Further environmental monitoring studies with the BC-VIVAS are warranted to improve the understanding of dominant transmission mechanisms for airborne viruses. Additionally, the applicability of the BC-VIVAS can be extended in different scenarios to gain information on the size distribution of the airborne particles and their impact on environmental health.

Supplementary Material

Supplementary material

Acknowledgements

This study was funded by NIH (Grants R43AI157123 and 2R44AI157123-02). Sripriya Nannu Shankar was funded through NIH-NCATS (under UF and FSU CTSI awards TL1TR001428 & UL1TR001427), and the Herbert Wertheim College of Engineering, UF. Tuition for William B. Vass was paid through the US Army Medical Service Corps Long-Term Health Education and Training fellowship.

Footnotes

Declaration of interest

Aerosol Dynamics Inc. holds the rights to the patent underlying the laminar flow, water-based condensational particle growth for concentrated collection of airborne particles (US-20140060155).

References

  1. Alonso C, Raynor PC, Davies PR, & Torremorell M (2015). Concentration, size distribution, and infectivity of airborne particles carrying swine viruses. PloS one, 10(8), e0135675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Appert J, Raynor PC, Abin M, Chander Y, Guarino H, Goyal SM, … & Kuehn TH (2012). Influence of suspending liquid, impactor type, and substrate on size-selective sampling of MS2 and adenovirus aerosols. Aerosol Science and Technology, 46(3), 249–257. [Google Scholar]
  3. Ashley K & Fey O’connor P (2017). NIOSH Manual of Analytical Methods (NMAM), Fifth Edition. Pp. 82. [Google Scholar]
  4. Booth TF, Kournikakis B, Bastien N, Ho J, Kobasa D, Stadnyk L, … & Plummer F (2005). Detection of airborne severe acute respiratory syndrome (SARS) coronavirus and environmental contamination in SARS outbreak units. The Journal of infectious diseases, 191(9), 1472–1477. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cao G, Noti JD, Blachere FM, Lindsley WG & Beezhold DH (2011). Development of an improved methodology to detect infectious airborne influenza virus using the NIOSH bioaerosol sampler. Journal of Environmental Monitoring 13(12), 3321–3328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chen YC, Wang IJ, Cheng CC, Wu YC, Bai CH, & Yu KP (2021). Effect of selected sampling media, flow rate, and time on the sampling efficiency of a liquid impinger packed with glass beads for the collection of airborne viruses. Aerobiologia, 37(2), 243–252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen Y, Chen J, Nannu Shankar S, Amanatidis S, Eiguren-Fernandez A, Lednicky JA, & Wu CY Direct Collection of Size-Fractionated aerosols containing Saccharomyces kudriavzevii and Micrococcus luteus into a Liquid Medium Using a Novel BioCascade Impactor. (Unpublished).
  8. Ding Y, Weindl P, Lenz AG, Mayer P, Krebs T, & Schmid O (2020). Quartz crystal microbalances (QCM) are suitable for real-time dosimetry in nanotoxicological studies using VITROCELL® Cloud cell exposure systems. Particle and fibre toxicology, 17(1), 1–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Eiguren Fernandez A, Lewis GS, & Hering SV (2014). Design and laboratory evaluation of a sequential spot sampler for time-resolved measurement of airborne particle composition. Aerosol Science and Technology, 48(6), 655–663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fennelly KP, Tribby MD, Wu CY, Heil GL, Radonovich LJ, Loeb JC, & Lednicky JA (2015). Collection and measurement of aerosols of viable influenza virus in liquid media in an Andersen cascade impactor. Virus Adapt Treat, 7, 1–9. [Google Scholar]
  11. Geng Y, & Wang Y (2023). Stability and transmissibility of SARS‐CoV‐2 in the environment. Journal of Medical Virology, 95(1), e28103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gralton J, Tovey E, McLaws ML, & Rawlinson WD (2011). The role of particle size in aerosolised pathogen transmission: a review. Journal of infection, 62(1), 1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hata M, Chomanee J, Thongyen T, Bao L, Tekasakul S, Tekasakul P, … & Furuuchi M (2014). Characteristics of nanoparticles emitted from burning of biomass fuels. Journal of Environmental Sciences, 26(9), 1913–1920. [DOI] [PubMed] [Google Scholar]
  14. Hering SV, & Stolzenburg MR (2005). A method for particle size amplification by water condensation in a laminar, thermally diffusive flow. Aerosol Science and Technology, 39(5), 428–436. [Google Scholar]
  15. Hering SV, Spielman SR, & Lewis GS (2014). Moderated, water-based, condensational particle growth in a laminar flow. Aerosol Science and Technology, 48(4), 401–408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Jamhari AA, Latif MT, Wahab MIA, Hassan H, Othman M, Abd Hamid HH, … & Rajab NF (2022). Seasonal variation and size distribution of inorganic and carbonaceous components, source identification of size-fractioned urban air particles in Kuala Lumpur, Malaysia. Chemosphere, 287, 132309. [DOI] [PubMed] [Google Scholar]
  17. Jayaweera M, Perera H, Gunawardana B, & Manatunge J (2020). Transmission of COVID-19 virus by droplets and aerosols: A critical review on the unresolved dichotomy. Environmental research, 188, 109819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kaur K, Overacker D, Ghandehari H, Reilly C, Paine R, & Kelly KE (2021). Determining real-time mass deposition with a quartz crystal microbalance in an electrostatic, parallel-flow, air-liquid interface exposure system. Journal of Aerosol Science, 151, 105653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kim HR, An S, & Hwang J (2021). High air flow-rate electrostatic sampler for the rapid monitoring of airborne coronavirus and influenza viruses. Journal of hazardous materials, 412, 125219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim SH, Chang SY, Sung M, Park JH, Bin Kim H, Lee H, … & Min JY (2016). Extensive viable Middle East respiratory syndrome (MERS) coronavirus contamination in air and surrounding environment in MERS isolation wards. Reviews of Infectious Diseases, 63(3), 363–369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kutter JS, de Meulder D, Bestebroer TM, Mulders A, Fouchier RA, & Herfst S (2021). Comparison of three air samplers for the collection of four nebulized respiratory viruses‐Collection of respiratory viruses from air. Indoor Air, 31(6), 1874–1885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lahdentausta L, Sanmark E, Lauretsalo S, Korkee V, Nyman S, Atanasova N, … & Paju S (2022). Aerosol concentrations and size distributions during clinical dental procedures. Heliyon, 8(10). [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Lednicky JA & Loeb JC (2013). Detection and isolation of airborne influenza A H3N2 virus using a Sioutas Personal Cascade Impactor Sampler. Influenza research and treatment, 2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lednicky J, Pan M, Loeb J, Hsieh H, Eiguren-Fernandez A, Hering S, … & Wu CY (2016). Highly efficient collection of infectious pandemic influenza H1N1 virus (2009) through laminar-flow water-based condensation. Aerosol Science and Technology, 50(7), i–iv. [Google Scholar]
  25. Lednicky JA, Lauzardo M, Fan ZH, Jutla A, Tilly TB, Gangwar M, … & Wu CY (2020a). Viable SARS-CoV-2 in the air of a hospital room with COVID-19 patients. International Journal of Infectious Diseases, 100, 476–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lednicky JA, Shankar SN, Elbadry MA, Gibson JC, Alam MM, Stephenson CJ, … & Wu CY (2020b). Collection of SARS-CoV-2 virus from the air of a clinic within a university student health care center and analyses of the viral genomic sequence. Aerosol and air quality research, 20(6), 1167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lee JH (2009). Assessment of the performance of iodine-treated biocidal filters and characterization of virus aerosols (Doctoral dissertation, University of Florida, Gainesville).
  28. Leung NH (2021). Transmissibility and transmission of respiratory viruses. Nature Reviews Microbiology, 19(8), 528–545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lewis GS & Hering SV (2013). Minimizing Concentration Effects in Water-Based, Laminar-Flow Condensation Particle Counters. Aerosol Science and Technology. 47(6), 645–654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lindsley WG, Blachere FM, Thewlis RE, Vishnu A, Davis KA, Cao G, … & Beezhold DH (2010). Measurements of airborne influenza virus in aerosol particles from human coughs. PloS one, 5(11), e15100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lindsley WG, Pearce TA, Hudnall JB, Davis KA, Davis SM, Fisher MA, … & Beezhold DH (2012). Quantity and size distribution of cough-generated aerosol particles produced by influenza patients during and after illness. Journal of occupational and environmental hygiene, 9(7), 443–449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Li P, Koziel JA, Zimmerman JJ, Hoff SJ, Zhang J, Cheng TY, … & Jenks WS (2021). Designing and testing of a system for aerosolization and recovery of viable porcine reproductive and respiratory syndrome virus (PRRSV): Theoretical and engineering considerations. Frontiers in Bioengineering and Biotechnology, 9, 659609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Liu DX, Liang JQ, & Fung TS (2021). Human Coronavirus-229E, -OC43, -NL63, and -HKU1 (Coronaviridae). Encyclopedia of Virology, 428–440. [Google Scholar]
  34. Louten J (2016). Virus structure and classification. Essential human virology, 19. [Google Scholar]
  35. Mankertz A (2008). Circoviruses. In Encyclopedia of Virology; Elsevier: Amsterdam, The Netherlands. 513–519. [Google Scholar]
  36. Milton DK, Fabian MP, Cowling BJ, Grantham ML, & McDevitt JJ (2013). Influenza virus aerosols in human exhaled breath: particle size, culturability, and effect of surgical masks. PLoS pathogens, 9(3), e1003205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Morawska L (2006). Droplet fate in indoor environments, or can we prevent the spread of infection?. Indoor air, 16(5), 335–347. [DOI] [PubMed] [Google Scholar]
  38. Nannu Shankar S, Witanachchi CT, Morea AF, Lednicky JA, Loeb JC, Alam MM, … & Wu CY (2022). SARS-CoV-2 in residential rooms of two self-isolating persons with COVID-19. Journal of aerosol science, 159, 105870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Niazi S, Philp LK, Spann K, & Johnson GR (2021). Utility of three nebulizers in investigating the infectivity of airborne viruses. Applied and Environmental Microbiology, 87(16), e00497–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Pan M, Bonny TS, Loeb J, Jiang X, Lednicky JA, Eiguren-Fernandez A, … & Wu CY (2017). Collection of viable aerosolized influenza virus and other respiratory viruses in a student health care center through water-based condensation growth. Msphere, 2(5), e00251–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Pan M, Lednicky JA, & Wu CY (2019a). Collection, particle sizing and detection of airborne viruses. Journal of applied microbiology, 127(6), 1596–1611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Pan M, Carol L, Lednicky JA, Eiguren-Fernandez A, Hering S, Fan ZH, & Wu CY (2019b). Determination of the distribution of infectious viruses in aerosol particles using water-based condensational growth technology and a bacteriophage MS2 model. Aerosol Science and Technology, 53(5), 583–593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Paton S, Clark S, Spencer A, Garratt I, Dinesh I, Thompson KA, … & Pottage T (2022). Characterisation of particle size and viability of SARS-CoV-2 aerosols from a range of nebuliser types using a novel sampling technique. Viruses, 14(3), 639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Santarpia JL, Herrera VL, Rivera DN, Ratnesar-Shumate S, Reid SP, Ackerman DN, … & Lowe JJ (2022). The size and culturability of patient-generated SARS-CoV-2 aerosol. Journal of exposure science & environmental epidemiology, 32(5), 706–711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Siegel JD, Rhinehart E, Jackson M, & Chiarello L (2007). 2007 guideline for isolation precautions: preventing transmission of infectious agents in health care settings. American journal of infection control, 35(10), S65–S164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tilly TB, Ward RX, Luthra JK, Robinson SE, Eiguren-Fernandez A, Lewis GS, … & Wu CY (2019). Condensational particle growth device for reliable cell exposure at the air–liquid interface to nanoparticles. Aerosol Science and Technology, 53(12), 1415–1428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Tuttle RS, Sosna WA, Daniels DE, Hamilton SB, & Lednicky JA (2010). Design, assembly, and validation of a nose-only inhalation exposure system for studies of aerosolized viable influenza H5N1 virus in ferrets. Virology journal, 7(1), 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Uhrbrand K, Koponen IK, Schultz AC, & Madsen AM (2018). Evaluation of air samplers and filter materials for collection and recovery of airborne norovirus. Journal of Applied Microbiology, 124(4), 990–1000. [DOI] [PubMed] [Google Scholar]
  49. Verreault D, Moineau S, & Duchaine C (2008). Methods for sampling of airborne viruses. Microbiology and molecular biology reviews, 72(3), 413–444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wade H, Duan Q, & Su Q (2022). Interaction between SARS-CoV-2 structural proteins and host cellular receptors: From basic mechanisms to clinical perspectives. Advances in Protein Chemistry and Structural Biology, 132, 243–277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Weber TP, & Stilianakis NI (2008). Inactivation of influenza A viruses in the environment and modes of transmission: a critical review. Journal of infection, 57(5), 361–373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. WHO (World Health Organization). (2014). Infection prevention and control of epidemic-and pandemic-prone acute respiratory infections in health care. https://www.ncbi.nlm.nih.gov/books/NBK214359/ [PubMed]
  53. Zuo Z, Kuehn TH, Verma H, Kumar S, Goyal SM, Appert J, … & Pui DY (2013). Association of airborne virus infectivity and survivability with its carrier particle size. Aerosol Science and Technology, 47(4), 373–382. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material
NIHMS1939879-supplement-Supplementary_material.docx (213.8KB, docx)

RESOURCES