Abstract
Ergosterol is an important component of fungal cell membrane. Ergosterol biosynthesis involves sterol C-14 reductase, a key enzyme in ergosterol biosynthesis, which has been well studied in Saccharomyces cerevisiae. However, little studies about this important enzyme in Aspergillus oryzae. In this study, two sterol C-14 reductases named AoErg24A and AoErg24B were identified in A. oryzae using bioinformatics analysis. Through phylogenetic tree, expression pattern, subcellular localization, and yeast functional complementation analyses, we discovered that both AoErg24A and AoErg24B are conserved and localized to the endoplasmic reticulum (ER). Both enzymes can partially restore the temperature sensitivity phenotype of a S. cerevisiae erg24 weak mutant. Overexpression of AoErg24A in A. oryzae increased 1.6 times of ergosterol content, while overexpression of AoErg24B led to a slight decrease of ergosterol. Both genes affect the sporulation of A. oryzae. These results uncovered that the two genes function differently in ergosterol biosynthesis. Thus, this study further enhances our understanding of ergosterol biosynthesis in A. oryzae and lays a good foundation for A. oryzae to be used in industrial ergosterol production.
Keywords: Aspergillus oryzae, Sterol C-14 reductases, Ergosterol, Subcellular localization, Gene function
Introduction
Ergosterol is a characteristic steroid compound of the fungal cell membrane (Li et al. 2020). It is also the precursor of the fat-soluble vitamin D2 (Huang et al. 2017). Ergosterol and its derivatives show obvious biological activities such as anti-inflammatory, anti-hyperlipidemia, anti-oxidation, and anti-tumor properties (Hu et al. 2017; Liu et al. 2019; Tan et al. 2017; Sun et al. 2023; Tong et al. 2024). It is widely used in medicine and is of great economic value. Therefore, ergosterol is not only important in traditional medicine but is also important for the development of new anticancer drugs. The biosynthesis of ergosterol is a very complex enzymatic process involving many essential and non-essential genes (Jordá and Puig 2020; Dhingra and Cramer 2017).
Sterol C-14 reductase is one of the essential and key enzymes in ergosterol biosynthesis pathway (Crowley et al. 1996). It catalyzes the production of sterol 14α-demethylase to 4, 4-dimethylcholestine-8, 24-dienol, an intermediate of ergosterol biosynthesis (Lai et al. 1994; Pierson et al. 2004; Liu et al. 2011). Several studies have shown that the enzyme greatly influences growth and development in animals, plants, and fungi. For example, in mice, sterol C-14 reductase activity is required for neutrophil differentiation (Kasbekar 2012). In Arabidopsis, Erg24 links the two processes of asymmetric division and cell differentiation and is required for cell division and expansion as well as for root growth and embryonic development (Qian et al. 2013; Schrick et al. 2000).
In Candida albicans and Saccharomyces cerevisiae genomes, the Erg24 gene exists as a single copy. In C. albicans, Erg24 is critical for fungal virulence and drug resistance, and Erg24 null mutant cells have multilayered or densely clustered vacuolar defect structures (Jia et al. 2002; Luna-Tapia et al. 2015). In S. cerevisiae, Erg24 is essential for aerobic growth and is thought to be required for survival in rich medium under aerobic conditions. However, exogenous addition of calcium or magnesium inhibits the defective phenotype of Erg24 mutants (Crowley et al. 1996; Shah Alam Bhuiyan et al. 2007). In filamentous fungi, Erg24 often contains duplicate copies that show functional redundancy. For example, Aspergillus fumigatus genome contains two Erg24 genes, Erg24A and Erg24B. It was revealed that Erg24A and Erg24B are required for mycelial growth and conidiation and also play important roles in virulence and drug resistance of A. fumigatus (Li et al. 2021). While single gene deletions are not lethal, the combined deletion of both genes causes lethality indicating that Erg24A and Erg24B are functionally complementary. Similarly, in Fusarium graminearum genome, there are two complementary Erg24 genes, FgErg24A and FgErg24B, that cause lethality when deleted together. However, unlike A. fumigatus, single deletions of either FgErg24A or FgErg24B do not show any significant change in the mutant phenotype when compared with the wild type. Interestingly, FgErg24B controls the intrinsic resistance of F. graminearum to amines (Liu et al. 2011).
Aspergillus oryzae is a filamentous fungus approved by FDA and WHO for safe production. As one of the most important filamentous fungi in industry, it has been used in food brewing for nearly a thousand years. Because of its strong capacity for protein secretion, it is increasingly used in modern biotechnology industries such as in enzyme and recombinant protein production (Merz et al. 2015; Wang et al. 2021; Kadooka et al. 2023). A. oryzae also serves as a source of primary and secondary metabolites and can be a potential host for heterologous production of useful metabolites. Indeed, the synthetic pathways of kojic acid (Chen et al. 2023), sphingolipid (Yamashita et al. 2021), and ceramide (Jiang et al. 2021) have been analyzed in A. oryzae. Our previous studies have analyzed the function of some genes involved in ergosterol biosynthesis such as AoErg10, AoErg19, and AoErg11, and revealed that their functions are more complex than in S. cerevisiae (Huang et al. 2021; Sun et al. 2019b; Jin et al. 2023). However, very few studies have been conducted on the sterol C-14 reductase in ergosterol synthesis pathway in A. oryzae. In this study, we identified two sterol C-14 reductases, AoErg24A and AoErg24B, localized to the endoplasmic reticulum (ER) in A. oryzae. The aim of this study is to identify the function of these two genes by investigation their expression pattern, subcellular localization, and effects on the growth and ergosterol biosynthesis, which further enhances our understanding of ergosterol biosynthesis in A. oryzae and lays foundation for A. oryzae to be used for industrial ergosterol production.
Materials and methods
Phylogenetic analysis and functional motifs prediction
The unrooted phylogenetic tree was established by the MEGA-X neighbor-joining method. The conserved motifs of all proteins were identified by MEME program. The registration number of sterol C-14 reductase protein sequences in different species are given in parentheses: Aspergillus niger (XP_001389123.1), A. niger (XP_025458899.1), Aspergillus flavus [RAQ58453.1], A. flavus (XP_041140074.1), Aspergillus nidulans (XP_661698.1), S. cerevisiae (NP_014119.1), C. albicans [KGQ89461.1], Mus musculus [AAH21516.1], Homo sapiens (NP_002287.2), Cebus imitator (XP_017381900.1), Arabidopsis thaliana [AAF81279.1], Oryza sativa (XP_015618068.1), and Zea mays (NP_001147742.1). The accession numbers of A. oryzae sterol C-14 reductase AoErg24A and AoErg24B were EIT78405.1 and EIT72491.1.
Strains and growth conditions
Two strains of A. oryzae were used in this study: the wild-type strain A. oryzae 3.042 (CICC 40092) was obtained from the China Center of Industry Culture Collection (Beijing, China) and the uridine/uracil auxotrophic (ΔpyrG) A. oryzae 3.042 strain was constructed in our laboratory (Sun et al. 2019a). The ΔpyrG A. oryzae 3.042 strain was cultured at 30 C for 72 h in CD medium supplemented with uracil and uridine, and conidial suspensions were collected for Agrobacterium-mediated transformation. Escherichia coli DH5α was used for plasmid constructions and Agrobacterium tumefaciens AGL1 was used for Agrobacterium-mediated transformation. Both E. coli and A. tumefaciens were cultured in Luria–Bertani (LB) medium supplemented with appropriate antibiotics at 37 C and 28 C, respectively.
Gene expression analysis
The conidial suspension of wild-type A. oryzae 3.042 was cultured on CD medium and incubated at 30 °C for 24, 48, and 72 h, or at 22 °C, 30 °C, 37 °C, and 48 °C for 72 h, or cultured on CD medium supplemented with NaCl or ethanol (EtOH) and incubated at 30 °C for 72 h, respectively. The mycelia at different growth times or under different stress conditions were collected, frozen with liquid nitrogen and immediately crushed. Total RNAs were extracted using the fungal RNA Kit (Omega Bio-tek, Norcross, GA, USA) and cDNAs were synthesized using the Prime Script™ RT reagent kit (Perfect Real Time; Takara). The quality and concentrations of the nucleic acids were determined using a NanoDrop ND-2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). All qRT-PCR (quantitative reverse transcription-PCR) analyses were performed using SYBR Premix Ex Taq (Takara, Japan) on a CFX96 real-time PCR detection system (Bio-Rad, CA, USA). All experiments were repeated three times and the averages were used to calculate gene expression. The housekeeping gene encoding histone H4 was used as a normalization control. Relative expression was calculated using the formula 2–ΔΔCt. The sequences of the primers used for qRT–PCR are shown in Table 1.
Table 1.
Primers used for qRT-PCR
| Name | Forward (5ʹ → 3ʹ) | Reverse (5ʹ → 3ʹ) |
|---|---|---|
| rH | AACATCCAGGGTATCACTAAGC | GTCTCCTCGTAGATCATGGCA |
| qRT-Erg24A | GTGCTCTACTTTGCCATCC | ATTCCTCCCAGTCTTCTCC |
| qRT-Erg24B | TTCTTTCCACCGCATTCC | CATGAAACCCAGTCCATCC |
Functional complementation in yeast
Yeast complementation experiments were performed using yeast BY4741 as a wild-type control, temperature-sensitive yeast (erg24 mutant) as background, and pYES2.0 plasmid containing a galactose-inducible promoter as vector. The erg24 mutant (Y07707) was purchased from EUROSCARF (http://www.euroscarf.de/index.php). The full-length coding sequences (CDS) of AoErg24A and AoErg24B were fused into pYES2.0 by the one-step cloning kit (Vazyme Biotech Co., Ltd, China), and the vector generated was transformed into the erg24 mutant by yeast transformation Kit II (Coolaber, Beijing, China). All transformants were randomly selected and verified by PCR using specific primers (primer sequences are listed in Table 2). The control and transformants were subsequently cultured in YPD (1% yeast extract, 2% peptone, 2% glucose) and YPG (1% yeast extract, 2% peptone, 2% galactose) agar medium at 30 °C and 37 °C, respectively, to observe the phenotypes. The experiments were repeated three times to determine phenotype stability. The yeast strains were then cultured in YPD and YPG liquid medium at 30 °C for 2 d, following which the cells were collected for determination of ergosterol content.
Table 2.
Primers used for vector construction
| Name | Forward (5ʹ → 3ʹ) | Reverse (5ʹ → 3ʹ) |
|---|---|---|
| pEX2B-AoErg24A-DsRed-AflII | TTCACGTGCCCGTGCTTAAGATGCCCTCTCATACTGAATC | GAGGCCATGATATCCTTAAGGTAGACCCAAGGCAGAATTC |
| pEX2B-AoErg24B-DsRed-AflII | TTCACGTGCCCGTGCTTAAGATGGCGCCGAAGAAGAATTC | GAGGCCATGATATCCTTAAGGTAGATACCAGGGACGATGC |
| pEX1-ptrA-AoclxA-GFP-AflII | GCAGACATCACCCTCGAGATGCGTTTCAACGCAGCTGTTG | GGTACCTACGTACTCGAGCTGGGCAGAAGAACGGGTGGTA |
| pEX1-ptrA-MTS-GFP-AflII | GAGCAGACATCACCCTCGAGATGGCTTCTTCCTTGAGAATCG | CTCACCATGGTACCTACGTACTGGTCGAGGGTGACCTCGC |
| pYes2.0-AoErg24A-HindIII | CTATAGGGAATATTAAGCTTATGCCCTCTCATACTGAATC | GATGGATATCTGCAGAATTCGTAGACCCAAGGCAGAATTC |
| pYes2.0-AoErg24B-HindIII | CTATAGGGAATATTAAGCTTATGGCGCCGAAGAAGAATTC | GATGGATATCTGCAGAATTCGTAGATACCAGGGACGATGC |
Gene overexpression
Gene overexpression experiments were carried out using the binary vector pEX2B containing a maltose promoter. pEX2B was linearized with AflII and ligated to the CDS of AoErg24A and AoErg24B to generate pEX2B-AoErg24A-DsRed and pEX2B-AoErg24B-DsRed vectors. The primers used in this study are shown in Table 2. The constructed vector was transformed into Agrobacterium tumefaciens AGL1 and then transformed into the ΔpyrG A. oryzae 3.042 through Agrobacterium-mediated transformation. At least three individual strains of each transformant were collected and cultured in CD, PDA, and DPY agar medium (all with maltose as carbon source) to determine the stability of the phenotype. One transformant with confirmed phenotype was then selected for subsequent growth experiments. Growth experiments were repeated three times and the average values were calculated for data statistics. The control and transformants were cultured in DPY agar medium at 30 °C for 3 d and the mycelia were collected for determination of ergosterol content.
Subcellular localization analysis
Localization of AoErg24A and AoErg24B proteins was predicted by the iPSORT prediction website. ER localized protein AoClxA (Watanabe et al. 2007) and mitochondrial localized signal (MTS) (Mabashi et al. 2006) were used as ER and mitochondrial localization markers respectively. AoclxA and MTS were cloned into pEX1-ptrA-GFP vector to generate GFP localized vectors. These vectors were then transformed into the ΔpyrG A. oryzae 3.042 containing pEX2B-AoErg24A-DsRed and pEX2B-AoErg24B-DsRed vectors to study colocalization. From the resulting transformation, at least three strains were observed under different conditions. The fluorescence of the confirmed strain was then observed under 100 × oil microscope with a Leica DM6000B microscope. The primer sequences used for plasmid construction are shown in Table 2.
Measurement of ergosterol
A. oryzae mycelia from the control and test transformants were collected, freeze-dried in vacuum to a constant weight, and then ground to powder. 50 mg of each A. oryzae dry powder was weighed accurately followed by addition of 3 mL ethanolic potassium hydroxide (25 g KOH + 35 mL ddH2O, 100% ethanol constant volume to 100 mL) and was vortexed for one min. The mixture was then incubated in a water bath at 85 °C for 1.5 h. After cooling to room temperature, 3 mL n-heptane and 1 mL distilled water were added and vortexed for 3 min. The top layer (n-heptane layer) was separated and stored at − 20 °C for 24 h before analysis using a Waters Alliance E2695-2489 UV/Vis detector HPLC (Milford, MA, USA). Analysis was performed using a Zorbax SB-C18 column with the UV detector set at 282 nm at an elution rate of 1.5 mL/min. Methanol/water (95:5, V/V) was used as the mobile phase. Commercially available ergosterol (Sigma-Aldrich) was used to calibrate the curves. Each experiment was repeated three times.
Results
A. oryzae contains two homologs of S. cerevisiae Erg24
To identify the potential Erg24 homolog proteins in A. oryzae, a BLAST analysis of S. cerevisiae Erg24 protein sequence was performed on NCBI (http://www.ncbi.nlm.nih.gov/). Two homologous proteins were identified, which were named AoErg24A and AoErg24B. To obtain more information, we further analyzed the phylogenetic relationship of Erg24 proteins among different species based on the whole protein sequence. As shown in Fig. 1, Erg24 is relatively conserved in fungi, animals, and plants. S. cerevisiae and C. albicans have only one Erg24 in their genomes, while most filamentous fungi genomes contain two Erg24, with the exception of A. nidulans (Fig. 1A). In addition, motif analysis showed that a vast majority Erg24 proteins contained six conserved motifs except for those of S. cerevisiae and C. albicans. When compared with Erg24 from animals, Erg24 from S. cerevisiae and C. albicans lacks motif 4, while Erg24 from plants lacks motif 6 (Fig. 1B). Thus, Erg24 is a relatively conserved protein in fungi, animals, and plants.
Fig. 1.
Phylogenetic and conserved motif analysis of Erg24. A Phylogenetic analysis of Erg24 from A. niger, A. oryzae, A. flavus, A. nidulans, S. cerevisiae, C. albicans, M. musculus, H. sapiens, C. imitator, A. thaliana, O. sativa, Z. mays using MEGA-X software. The IDs of the sequences were included after the species names in the figure. B Motif analysis of Erg24 and homologous proteins from selected species using MEME program. Protein sequences are indicated by thin black lines, and the conserved motifs are represented by different colored boxes. The length (the number of amino acids) of the protein and motif can be estimated using the scale bar at the bottom
Expression pattern of AoErg24s
To investigate the role of the AoErg24s genes in the growth of A. oryzae, the expression levels of AoErg24s at different growth times or under different growth conditions were determined by qRT-PCR. Under normal conditions, the expression of both AoErg24 genes at different growth times was different, with AoErg24A being mainly expressed (Fig. 2A). The expression level of AoErg24A at 24 h and 48 h was similar, but increased by 23% at 72 h. When compared with AoErg24A, the expression of AoErg24B was very low trending toward higher values at 24 h and 72 h but low at 48 h (Fig. 2A).
Fig. 2.
Expression levels of AoErg24A and AoErg24B on CD agar medium at different growth times and under various abiotic stresses. A Expression of AoErg24A and AoErg24B at 24, 48, and 72 h of growth; B–D Expression of AoErg24A and AoErg24B upon temperature, salt, and ethanol (EtOH) stress. The wild-type A. oryzae spore suspension was plated on CD agar medium alone or when supplemented with NaCl or ethanol and incubated at 30 °C (except for temperature stress). For the determination of AoErg24A and AoErg24B mRNA levels at different growth times, mycelia were harvested at 24, 48, and 72 h; for other tests, the mycelia were harvested at 72 h. GraphPad T-Test was used for statistical analysis (*P < 0.05; **P < 0.01). The values represent the mean ± standard deviation of three independent experiments
Ergosterol has been reported to be involved in the stress response of S. cerevisiae (Kodedová and Sychrová 2015). Therefore, we also investigated the expression of AoErg24 under conditions of temperature, salt, and ethanol stress. Upon temperature stress, the expression of AoErg24A at 30 °C and 42 °C was similar but decreased at 22 °C and 37 °C, while AoErg24B showed relatively high expression at 22 °C and 37 °C (Fig. 2B). Upon salt stress, the expression of AoErg24A decreased significantly with increasing salt concentration, while the expression of AoErg24B increased at 5% and 15% and decreased at 10% salt (Fig. 2C). Upon ethanol stress, the expression of AoErg24A decreased to 4% and 29% that of the control at 2% and 4% ethanol concentrations and the expression of AoErg24B was also decreased (Fig. 2D). These results indicate that both AoErg24 genes are involved in the growth of A. oryzae and respond to abiotic stress.
Subcellular localization
In S. cerevisiae and A. fumigatus, Erg24 has been reported to be localized in the ER (Jordá & Puig 2020; Li et al. 2021). We predicted the subcellular localization of AoErg24s protein using the iPSORT prediction website and found a plant mitochondrial targeting peptide at the N-terminus of AoErg24A and a non-plant mitochondrial targeting peptide at the N-terminus of AoErg24B. Therefore, we investigated whether AoErg24A/B were localized in mitochondria or ER by using DsRed and GFP as reporter proteins. To achieve this, overexpression vectors were constructed by fusing the DsRed gene to the C-terminus of AoErg24s, using uridine/uracil auxotrophy as a selective marker. The ER (AoClxA-GFP)- and mitochondrial (MTS-GFP)- targeting GFP vectors were constructed using pyrithiamine as a selective marker, as described previously (Sun et al. 2019b). The AoErg24A-DsRed and AoErg24B-DsRed strains were co-transformed with ER or mitochondria targeting GFP vectors, respectively. The results showed that the fluorescence of AoErg24A-DsRed and AoErg24B-DsRed showed a chain network similar to that of ER localization pattern, and both proteins were colocalized with ER-located GFP markers (Fig. 3A) but not with mitochondria located GFP markers (Fig. 3B). Thus, we concluded that the two sterol C-14 reductases in A. oryzae are localized to the ER.
Fig. 3.
Subcellular localization analysis of AoErg24A and AoErg24B. A A. oryzae 3.042 ΔpyrG mycelium was co-transformed with AoErg24s-DsRed and AoClxA-GFP vectors. B A. oryzae 3.042 ΔpyrG mycelium was co-transformed with AoErg24s-DsRed and MTS-GFP vectors. Left to right: phase contrast; DsRed fluorescence image; GFP fluorescence image; DsRed, GFP and phase contrast merged image. The scale in the figure represents 5 μm
Functional complementation in yeast
The S. cerevisiae erg24 weak mutant is temperature sensitive and lethal at 37 °C (Bhuiyan et al. 2007). Therefore, we used the temperature-sensitive erg24 (Y07707) mutant for yeast heterologous complementation assays. The full-length CDS of AoErg24A and AoErg24B were cloned into yeast expression vector (pYES2.0) and transformed separately into the erg24 mutant. The pYES2.0 contains a galactose-inducible promoter, GAL1. Therefore, we tested phenotypes of all transformants on YPD and YPG medium at 30 °C and 37 °C. The results showed that both AoErg24A and AoErg24B could partially restore the lethal phenotype of erg24 mutant at 37 °C with the AoErg24A/erg24 strain showing better growth than the AoErg24B/erg24 strain (Fig. 4A). In addition, we determined the ergosterol content of all transformants in liquid medium at 30 °C. Compared to the erg24 mutant, the ergosterol content of AoErg24A/erg24 and AoErg24B/erg24 transformants increased by more than sevenfold and fourfold, respectively, in YPG liquid medium (Fig. 4B). Compared to the WT, the ergosterol content of AoErg24A/erg24 was slightly higher, while the ergosterol content of AoErg24B/erg24 was still lower, consistent with the previous results. Thus, we conclude that the functions of AoErg24A and AoErg24B are conserved between S. cerevisiae and A. oryzae.
Fig. 4.
Functional complementation of AoErg24A and AoErg24B in S. cerevisiae. A Growth of wild-type, erg24 mutant (Y07707), and AoErg24s/erg24 transformants on YPD and YPG agar medium at 30 °C and 37 °C. B Ergosterol content in S. cerevisiae and the corresponding transformants. Control and transformants were cultured in YPD and YPG medium at 30 °C for 2 days. All yeast were collected to determine ergosterol content. GraphPad T-Test was used for statistical analysis (*P < 0.05; **P < 0.01). The values represent the mean ± standard deviation of three independent experiments. The ergosterol content in each group was compared with pYes2.0/erg24 mutant in the corresponding medium
Phenotypes of AoErg24s overexpression strains
To investigate the effect of Erg24s on the growth and development of A. oryzae, we observed the phenotypes of strains overexpressing AoErg24A and AoErg24B. The overexpression transformants were cultured in CD, PDA, and DPY medium. The results showed that the colony morphology and diameter of AoErg24A and AoErg24B overexpression strains did not change significantly when compared with the control, but sporulation was significantly increased (Fig. 5). In addition, the spore Erg24 content of the strain overexpressing AoErg24B was higher than that in the strain overexpressing AoErg24A.
Fig. 5.
Phenotypes of AoErg24A and AoErg24B overexpression strains. A Schematic depiction of Figure B. B Colony morphology of CK (wild-type A. oryzae transformed pEX2B vector), AoErg24A and AoErg24B overexpression strains cultured on CD, PDA, and DPY for 72 h. C and D Colony diameters and the relative concentrations of spores of different transgenic strains. Different spore suspensions of the same concentration were placed on CD, PDA, and DPY agar medium, respectively, and incubated at 30 °C for 72 h. Values represent the mean ± standard deviation of three independent experiments. GraphPad T-Test was used for statistical analysis (*P < 0.05; **P < 0.01). All experimental groups were compared with the corresponding controls
Ergosterol contents in AoErg24s overexpression strains
Researchers have shown that Erg24 expression in S. cerevisiae, C. albicans, and F. graminearum positively correlates with ergosterol synthesis (Lai et al. 1994; Pierson et al. 2004; Liu et al. 2011). Therefore, we analyzed the ergosterol content of A. oryzae AoErg24A and AoErg24B overexpressing strains. The results showed that overexpression of AoErg24A was positively correlated with ergosterol synthesis and the ergosterol content was increased by 1.6 times when compared to the control (Fig. 6). However, the ergosterol content of AoErg24B overexpression strain decreased slightly when compared with the control (Fig. 6). These results indicate that AoErg24A and AoErg24B play different roles in ergosterol biosynthesis.
Fig. 6.

Ergosterol contents in AoErg24A and AoErg24B overexpression strains. Control and transformants were cultured on DPY at 30 °C for 3 days, and mycelia were collected to determine ergosterol content. GraphPad T-Test was used for statistical analysis (*P < 0.05; **P < 0.01). Values represent the mean ± standard deviation of three independent experiments. Ergosterol contents in the experimental groups were compared with the control group
Discussion
The ergosterol biosynthetic pathway has been well studied in the fungal model biotype S. cerevisiae but is poorly understood in the industrially important filamentous fungus A. oryzae. There is only one single copy of Erg24 in most yeast-like fungi, but there are usually two copies in filamentous fungi. Previous studies have shown that repetitive genes in filamentous fungi may be involved in adaptation of membrane composition and integrity (Jordá and Puig 2020). In this study, two sterol C-14 reductase coding genes, named AoErg24A and AoErg24B, were identified in A. oryzae by bioinformatics analysis. Subcellular localization results showed that both AoErg24s were localized to the ER, an observation similar to that for Erg11s reported by our previous studies (Jin et al. 2023). Compared with only one in yeast, the expression pattern of the two AoErg24s in A. oryzae is also different, resulting in more complex functions. Therefore, our research on AoErg24s in A. oryzae is of great significance.
It has been reported that ergosterol takes part in lipid rafts on fungal cell membranes with sphingolipid and other sterols (Dhingra and Cramer 2017; Song et al. 2020). These microdomains are enriched in several important biological proteins, such as ion pumps, drug efflux pumps, and nutrient transporters, which are important for environmental adaptation and stress responses (Athanasopoulos 2019; Ribeiro et al. 2022). Expression pattern analysis in this study revealed that the two AoErg24s were significantly different upon different growth times and under abiotic stresses. AoErg24A is the main sterol C-14 reductase gene. Under all tested stress conditions, AoErg24B expression was very low, while AoErg24A was responsive to all abiotic stresses. In addition, the expression of AoErg24s was high at 24 h and 72 h and low at 48 h. This is possibly because cell expansion is vigorous at 24 h while conidia start to produce at 72 h and a large amount of ergosterol may be needed for these processes. These results indicate that AoErg24s are involved in the growth and sporulation of A. oryzae. AoErg24A and AoErg24B yeast complementation experiments showed that Erg24s function in A. oryzae was similar to that in S. cerevisiae. Both genes can partially restore the thermosensitive lethal phenotype of erg24 mutant in S. cerevisiae. The degree of recovery is better with AoErg24A than with AoErg24B. This result indicates that AoErg24A may be the main gene involved in ergosterol biosynthesis. The results of expression pattern showed that AoErg24A was the mainly expressed gene as the expression level of AoErg24B was very low under normal conditions compared with AoErg24A. However, their responses to stress are different (Fig. 2B–D), indicating that the function of the two is different under stress conditions. Thus, the two C-14 reductases are not simply functional redundancy. In addition, yeast functional complementation and phenotypes of overexpressed strains further proved that the functions of the two enzymes are distinct. These results uncovered that the synthesis and regulation of ergosterol in A. oryzae is more complex than that in yeast.
Multiple copies of Erg24s show functional redundancy. In A. fumigatus, deletion of one Erg24 gene does not affect ergosterol content and cell survival, but damages mycelium growth, sporulation, and virulence (Li et al. 2021). In F. graminearum, deletion of one Erg24 gene had minimal effect on the growth, pathogenicity, and ergosterol synthesis (Liu et al. 2011). Expression analyses and growth experiments performed in this study showed that AoErg24s, especially AoErg24B, affect the growth and sporulation of A. oryzae. Although expression of AoErg24B is very low, it may greatly affect the growth and sporulation of A. oryzae. Overexpression of AoErg24s plays different roles in ergosterol biosynthesis. Unfortunately, due to the presence of multiple nuclei in both mycelia and spores in A. oryzae, we were unable to obtain a single or double mutant of AoErg24 to fully reveal the function of AoErg24s.
In recent years, ergosterol has been widely used as a raw material in food, feed, medicine, and other industries (Sun et al. 2021; Rangsinth et al. 2023). In future experiments, we aim to develop efficient and stable gene editing techniques for A. oryzae to further identify the function of ergosterol synthetase in A. oryzae, explore its regulatory mechanism, and increase the possibility of changing the metabolic flow of ergosterol through molecular techniques. This study further enhances our understanding of ergosterol biosynthesis in A. oryzae and lays a good foundation for the use of A. oryzae in industrial ergosterol production.
Acknowledgements
This study was supported by National Natural Science Foundation of China (NSFC Grant No. 32260009), Natural Science Foundation of Jiangxi Province (20212BAB205001), the youth talent support program of Jiangxi Science & Technology Normal University (2019QNBJRC004), and Open Foundation of Hubei Key Laboratory of Edible Wild Plants Conservation and Utilization (Grant No. EWPL202207).
Author contributions
Zhihong Hu designed the manuscript. Yitong Shang performed the experiments and revised the manuscript; Qi Jin wrote the draft of the manuscript; Ganghua Li and Mingquan Yu contributed to the statistical analysis of the data, and Huanhuan Yan participated in the collecting of data.
Declarations
Conflict of interest
The authors have no financial conflicts of interest to declare.
Footnotes
Yitong Shang and Qi Jin contributed equally to this work.
References
- Athanasopoulos A, Gournas C. Fungal plasma membrane domains. FEMS Microbiol Rev. 2019;43(6):642–673. doi: 10.1093/femsre/fuz022. [DOI] [PubMed] [Google Scholar]
- Bhuiyan M, Eckstein J, Barbuch R, Bard M. Synthetically lethal interactions involving loss of the yeast ERG24: the sterol C-14 reductase gene. Lipids. 2007;42(1):69. doi: 10.1007/s11745-006-1001-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen ZM, Chen TM, Zhang HX, Li YZ, Fan JX, Yao LH, Zeng B, Zhang Z. Functional role of a novel zinc finger protein, AoZFA, in growth and kojic acid synthesis in Aspergillus oryzae. Appl Environ Microbiol. 2023 doi: 10.1128/aem.00909-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Crowley JH, Smith SJ, Leak FW, Parks LW. Aerobic isolation of an ERG24 null mutant of Saccharomyces cerevisiae. J Bacteriol. 1996;178(10):2991–2993. doi: 10.1111/j.1365-2672.1996.tb03258.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dhingra S, Cramer R. Regulation of sterol biosynthesis in the human fungal pathogen Aspergillus fumigatus: opportunities for therapeutic development. Front Microbiol. 2017;8:92. doi: 10.3389/fmicb.2017.00092. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu Z, He B, Ma L, Sun Y, Niu Y, Zeng B. Recent advances in ergosterol biosynthesis and regulation mechanisms in Saccharomyces cerevisiae. Indian J Microbiol. 2017;57(3):270–277. doi: 10.1007/s12088-017-0657-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang G, Cai W, Xu B. Vitamin D2, ergosterol, and vitamin B2 content in commercially dried mushrooms marketed in China and increased vitamin D2 content following UV-C irradiation. Int J Vitamin Nutr Res. 2017;87:1–10. doi: 10.1024/0300-9831/a000294. [DOI] [PubMed] [Google Scholar]
- Huang H, Niu Y, Jin Q and Hu Z (2021) Identification of six thiolases and their effects on fatty acid and ergosterol biosynthesis in Aspergillusoryzae [DOI] [PMC free article] [PubMed]
- Jia N, Arthington-Skaggs B, Lee W, Pierson C, Lees N, Eckstein J, Barbuch R, Bard M. Candida albicans sterol C-14 reductase, encoded by the ERG24 gene, as a potential antifungal target site. Antimicrob Agents Chemother. 2002;46(4):947–957. doi: 10.1128/aac.46.4.947-957.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang C, Ge J, He B, Zeng B. Glycosphingolipids in filamentous fungi: biological roles and potential applications in cosmetics and health foods. Front Microbiol. 2021;12:690211. doi: 10.3389/fmicb.2021.690211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jin Q, Li G, Qin K, Shang Y, Yan H, Liu H, Zeng B, Hu Z. The expression pattern, subcellular localization and function of three sterol 14α-demethylases in Aspergillus oryzae. Front Genetics. 2023;14:1009746. doi: 10.3389/fgene.2023.1009746. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jordá T, Puig S. Regulation of ergosterol biosynthesis in Saccharomyces cerevisiae. Genes. 2020 doi: 10.3390/genes11070795. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kadooka C, Tanaka Y, Hira D, Maruyama J-i, Goto M, Oka T. Identification of galactofuranose antigens such as galactomannoproteins and fungal-type galactomannan from the yellow koji fungus (Aspergillus oryzae) Front Microbiol. 2023 doi: 10.3389/fmicb.2023.1110996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kasbekar D. Lymphohematopoietic licence: sterol C-14 reductase activity of lamin B receptor (Lbr) is essential for neutrophil differentiation. J Biosci. 2012;37(2):199–201. doi: 10.1007/s12038-012-9203-9. [DOI] [PubMed] [Google Scholar]
- Kodedová M, Sychrová H. Changes in the sterol composition of the plasma membrane affect membrane potential, salt tolerance and the activity of multidrug resistance pumps in Saccharomyces cerevisiae. PLoS ONE. 2015;10(9):e0139306. doi: 10.1371/journal.pone.0139306. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lai M, Bard M, Pierson C, Alexander J, Goebl M, Carter G, Kirsch D. The identification of a gene family in the Saccharomyces cerevisiae ergosterol biosynthesis pathway. Gene. 1994;140(1):41–49. doi: 10.1016/0378-1119(94)90728-5. [DOI] [PubMed] [Google Scholar]
- Li R, Shi W, Zhang R, Huang L, Yi Y, Li A, Jing H, Tao M, Zhang M, Pei N. Effects of CGA-N12 on the membrane structure of Candida tropicalis cells. Biochem J. 2020;477(10):1813–1825. doi: 10.1042/bcj20190939. [DOI] [PubMed] [Google Scholar]
- Li Y, Dai M, Zhang Y, Lu L. The sterol C-14 reductase Erg24 is responsible for ergosterol biosynthesis and ion homeostasis in Aspergillus fumigatus. Appl Microbiol Biotechnol. 2021;105(3):1253–1268. doi: 10.1007/s00253-021-11104-5. [DOI] [PubMed] [Google Scholar]
- Liu X, Fu J, Yun Y, Yin Y, Ma Z. A sterol C-14 reductase encoded by FgERG24B is responsible for the intrinsic resistance of Fusarium graminearum to amine fungicides. Microbiology (reading, England) 2011;157:1665–1675. doi: 10.1099/mic.0.045690-0. [DOI] [PubMed] [Google Scholar]
- Liu J, Xia J, Nie K, Wang F, Deng L. Outline of the biosynthesis and regulation of ergosterol in yeast. World J Microbiol Biotechnol. 2019;35(7):98. doi: 10.1007/s11274-019-2673-2. [DOI] [PubMed] [Google Scholar]
- Luna-Tapia A, Peters B, Eberle K, Kerns M, Foster T, Marrero L, Noverr M, Fidel P, Palmer G. ERG2 and ERG24 are required for normal vacuolar physiology as well as Candida albicans pathogenicity in a murine model of disseminated but not vaginal candidiasis. Eukaryot Cell. 2015;14(10):1006–1016. doi: 10.1128/ec.00116-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mabashi Y, Kikuma T, Maruyama J, Arioka M, Kitamoto K. Development of a versatile expression plasmid construction system for Aspergillus oryzae and its application to visualization of mitochondria. Biosci Biotechnol Biochem. 2006;70(8):1882–1889. doi: 10.1271/bbb.60052. [DOI] [PubMed] [Google Scholar]
- Merz M, Eisele T, Berends P, Appel D, Rabe S, Blank I, Stressler T, Fischer L. Flavourzyme, an enzyme preparation with industrial relevance: automated nine-step purification and partial characterization of eight enzymes. J Agric Food Chem. 2015;63(23):5682–5693. doi: 10.1021/acs.jafc.5b01665. [DOI] [PubMed] [Google Scholar]
- Pierson C, Eckstein J, Barbuch R, Bard M. Ergosterol gene expression in wild-type and ergosterol-deficient mutants of Candida albicans. Med Mycol. 2004;42(4):385–389. doi: 10.1080/13693780410001712016. [DOI] [PubMed] [Google Scholar]
- Qian P, Han B, Forestier E, Hu Z, Gao N, Lu W, Schaller H, Li J, Hou S. Sterols are required for cell-fate commitment and maintenance of the stomatal lineage in Arabidopsis. Plant J. 2013;74(6):1029–1044. doi: 10.1111/tpj.12190. [DOI] [PubMed] [Google Scholar]
- Rangsinth P, Sharika R, Pattarachotanant N, Duangjan C, Wongwan C, Sillapachaiyaporn C, Nilkhet S, Wongsirojkul N, Prasansuklab A, Tencomnao T, Leung GPH, Chuchawankul S. 2023. Potential beneficial effects and pharmacological properties of ergosterol, a common bioactive compound in edible mushrooms. Foods. [DOI] [PMC free article] [PubMed]
- Ribeiro RA, Godinho CP, Vitorino MV, Robalo TT, Fernandes F, Rodrigues MS, Sa-Correia I. Crosstalk between yeast cell plasma membrane ergosterol content and cell wall stiffness under acetic acid stress involving Pdr18. Journal of Fungi. 2022 doi: 10.3390/jof8020103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schrick K, Mayer U, Horrichs A, Kuhnt C, Jürgens G. FACKEL is a sterol C-14 reductase required for organized cell division and expansion in Arabidopsis embryogenesis. Genes Development. 2000;14(12):1471–1484. doi: 10.1016/j.fcr.2008.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shah Alam Bhuiyan M, Eckstein J, Barbuch R, Bard M. Synthetically lethal interactions involving loss of the yeast ERG24: the sterol C-14 reductase gene. Lipids. 2007;42(1):69–76. doi: 10.1007/s11745-006-1001-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Song J, Liu X, Li R. Sphingolipids: regulators of azole drug resistance and fungal pathogenicity. Mol Microbiol. 2020;114(6):891–905. doi: 10.1111/mmi.14586. [DOI] [PubMed] [Google Scholar]
- Sun Y, Niu Y, He B, Ma L, Li G, Tran V, Zeng B, Hu Z. A dual selection marker transformation system using Agrobacterium tumefaciens for the industrial Aspergillus oryzae 3.042. J Microbiol Biotechnol. 2019;29(2):230–234. doi: 10.4014/jmb.1811.11027. [DOI] [PubMed] [Google Scholar]
- Sun Y, Niu Y, Huang H, He B, Ma L, Tu Y, Tran V, Zeng B, Hu Z. Mevalonate diphosphate decarboxylase MVD/Erg19 is required for ergosterol biosynthesis, growth, sporulation and stress tolerance in Aspergillus oryzae. Front Microbiol. 2019;10:1074. doi: 10.3389/fmicb.2019.01074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun Z-J, Lian J-Z, Zhu L, Jiang Y-Q, Li G-S, Xue H-L, Wu M-B, Yang L-R, Lin J-P. combined biosynthetic pathway engineering and storage pool expansion for high-level production of ergosterol in industrial Saccharomyces cerevisiae. Front Bioeng Biotechnol. 2021 doi: 10.3389/fbioe.2021.681666. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun P, Li WL, Guo JZ, Peng Q, Ye XS, Hu S, Liu YC, Liu W, Chen HF, Qiao JL, Sun BL. Ergosterol isolated from suppresses LPS-induced neuroinflammatory responses in microglia cells and ICR mice. Molecules. 2023 doi: 10.3390/molecules28052406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tan W, Pan M, Liu H, Tian H, Ye Q, Liu H. Ergosterol peroxide inhibits ovarian cancer cell growth through multiple pathways. Onco Targets Ther. 2017;10:3467–3474. doi: 10.2147/ott.S139009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tong Z, Kong L, Zhang Y, Hu T, Dai R, Wang Y, Ji J, Huang Z, Hu L. Brassisterol A, a new ergosterol from co-cultivation of fungi attenuates neuroinflammation via targeting NLRP3/caspase-1/GSDMD pathway. Bioorgan Chem. 2024;142:106955. doi: 10.1016/j.bioorg.2023.106955. [DOI] [PubMed] [Google Scholar]
- Wang L, Hu T, Jiang Z, Yan Q, Yang S. Efficient production of a novel alkaline cold-active phospholipase C from Aspergillus oryzae by molecular chaperon co-expression for crude oil degumming. Food Chem. 2021;350:129212. doi: 10.1016/j.foodchem.2021.129212. [DOI] [PubMed] [Google Scholar]
- Watanabe T, Matsuo I, Maruyama J, Kitamoto K, Ito Y. Identification and characterization of an intracellular lectin, calnexin, from Aspergillus oryzae using N-glycan-conjugated beads. Biosci Biotechnol Biochem. 2007;71(11):2688–2696. doi: 10.1271/bbb.70289. [DOI] [PubMed] [Google Scholar]
- Yamashita S, Higaki C, Kikuchi N, Suzuki D, Kinoshita M, Miyazawa T. Sake (rice wine) brewing hydrolyzes highly polar sphingolipids to ceramides and increases free sphingoid bases. J Oleo Sci. 2021;70(8):1147–1156. doi: 10.5650/jos.ess21125. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Citations
- Rangsinth P, Sharika R, Pattarachotanant N, Duangjan C, Wongwan C, Sillapachaiyaporn C, Nilkhet S, Wongsirojkul N, Prasansuklab A, Tencomnao T, Leung GPH, Chuchawankul S. 2023. Potential beneficial effects and pharmacological properties of ergosterol, a common bioactive compound in edible mushrooms. Foods. [DOI] [PMC free article] [PubMed]





