Abstract
Background
Antibiotic resistance in Klebsiella pneumoniae isolates, particularly resistance to colistin, has become a growing concern. This study seeks to investigate the upregulation of specific genes (pmrA, pmrB, pmrC, phoQ, phoP, and arnT) that contribute to colistin resistance in K. pneumoniae isolates collected from human clinical samples in Tehran, Iran.
Methods
Thirty eight K. pneumoniae isolates were obtained and subjected to antibiotic susceptibility testing, as well as evaluation for phenotypic AmpC and ESBL production according to CLSI guidelines. The investigation of antibiotic resistance genes was conducted using polymerase chain reaction (PCR), whereas the quantification of colistin resistance related genes expressions was performed via Real-Time PCR.
Results
The highest and lowest antibiotics resistance were observed for cefotaxime 33 (86.8%) and minocycline 8 (21.1%), respectively. Twenty-four (63.2%) and 31 (81.6%) isolates carried AmpC and ESBLs, respectively. Also, antibiotic resistance genes containing blaNDM, blaIMP, blaVIM, blaSHV, blaTEM, blaCTXM, qnrA, qnrB, qnrS, and aac(6')-Ib were detected in K. pneumoniae isolates. Only 5 (13.1%) isolates were resistant to colistin and the MIC range of these isolates was between 4 and 64 μg ml−1. Upregulation of the pmrA, pmrB, pmrC, phoQ, phoP, and arnT genes was observed in colistin-resistant isolates. The colistin-resistant isolates were found to possess a simultaneous presence of ESBLs, AmpC, fluoroquinolone, aminoglycoside, and carbapenem resistant genes.
Conclusions
This study reveals escalating antibiotic resistance in K. pneumoniae, with notable coexistence of various resistance traits, emphasizing the need for vigilant surveillance and innovative interventions.
Keywords: Carbapenemases, ESBL, AmpC, Colistin-resistant, Klebsiella pneumoniae
1. Introduction
The irreversible increase in antibiotic resistance in countries around the world has led the World Health Organization (WHO) to declare antibiotic resistance as one of the three substantial menaces to public health [[1], [2], [3]]. Meanwhile, resistance to β-lactams such as cephalosporins, carbapenems, fluoroquinolones, aminoglycosides and other antibiotics, especially last resort antibiotics in Enterobacteriaceae, is a global challenge [[4], [5], [6]]. Today, the development of multidrug-resistant (MDR) and extensively drug-resistant (XDR) as well as colistin-resistant isolates has been reported [7]. Based on CDC guidelines any Klebsiella pneumoniae (K. pneumoniae) isolate demonstrating either intermediate or resistant susceptibility to at least one antimicrobial agent in a minimum of three specified categories was classified as MDR. These categories included: Extended-spectrum cephalosporins (ceftriaxone, ceftazidime, cefepime, cefotaxime, ceftolozane/tazobactam, ceftazidime/avibactam), Fluoroquinolones (ciprofloxacin, levofloxacin, moxifloxacin), Aminoglycosides (amikacin, gentamicin, tobramycin), Carbapenems (the isolate must have exhibited resistance to imipenem, meropenem, doripenem, ertapenem, meropenem/vaborbactam, or imipenem/relebactam), and Piperacillin/tazobactam (http://www.cdc.gov/hai/surveillance). Various factors cause antibiotic resistance, which over the past few decades, their overuse has gradually spread resistance in bacteria, so that in some infections, resistance to last-line antibiotics such as colistin has been reported [[8], [9], [10]]. Most studies have considered resistance against colistin in K. pneumoniae is due to clinical use of colistin and the multiclonal transmission of hospitalized patients to another. Colistin-resistant K. pneumoniae in vivo is probably correlated with previous colistin exposure in patients but various reports declare colistin-resistant K. pneumoniae in humans without any prior use of colistin. The prevalence of colistin-resistant K. pneumoniae is thus not known among healthy individuals. The emergence of colistin-resistant in major researches have emphasized on patients infected with MDR K. pneumoniae which treated with colistin and conclude colistin-resistant development occur after previous exposure, as most of the isolated K. pneumoniae also harbors the carbapenemase genes [11]. The substantial mechanism involved to colistin resistance is the upregulating of a two-component system which called PhoQ/PhoP consequently activates the pmrHFIJKLM operon. Mutations in CrrAB as a signaling system is detected in colistin resistant bacteria [12]. Recently, a remarkable mechanism has been introduced in colistin-resistant K. pneumoniae which is the inactivation of mgrB by mutation. The mgrB gene encodes a 47–amino acid transmembrane protein which applies a negative feedback effect on PhoQ/PhoP, consequently upregulates the PhoQ/PhoP, then develops resistance to colistin [11]. In addition to the chromosomal mutations that are responsible for colistin resistance, various mechanisms contribute to resistance to this antibiotic that can be spread by horizontal gene transmission between bacteria [13]. However, colistin-resistant isolates as superbug bacteria usually have the ability to resist most of the routine antibiotics for treatment by different mechanisms such as ESBLs, AmpC, fluoroquinolone, aminoglycoside, and carbapenem resistant genes [14]. Hence, the aim of current study was to investigate different transmissible antibiotic resistant mechanisms with upregulation of different operons contributing in resistance to colistin in superbug K. pneumoniae isolates.
2. Material and methods
The study was carried out between October 2020 and January 2021 at the Iran University of Medical Sciences, Tehran, Iran, with approval from the local Ethical Committee. K. pneumoniae samples described in this study were part of a set of pathogens in the hospital microbiology laboratory that are routinely isolated in the hospital. No further clinical samples were collected for purposes of this study; therefore, there was no need for ethical permission or patient consent to use these samples.
2.1. Sample collection
A total of 38 clinical K. pneumoniae samples were obtained from blood, sputum, and urine of individuals who had not taken antibiotics in the last one or two months. The samples were collected from five hospitals in Tehran (A, B, C, D, and E) over a period of 4 months. K. pneumoniae isolates re-grown on the culture medium and were identified with classic bacteriologic methods such as gram staining and biochemical tests [15]. All of K. pneumoniae isolates were transferred to TSB medium containing 10% glycerol and stored in −20 °C for subsequent tests.
2.2. Antibiotics susceptibility test and phenotypic detection of AmpC and ESBLs
The level of antibiotics resistance of K. pneumoniae isolates was checked using the disk diffusion method that disks including trimethoprim + sulfamethoxazole, imipenem, ceftazidime, cefotaxime norfloxacin, ciprofloxacin, kanamycin, chloramphenicol, ceftriaxone, gentamicin, fosfomycin, and minocycline from Mast Company (Liverpool, England) were used for this purpose following the instructions of the Clinical and Laboratory Standards Institute. Subsequently, the K. pneumoniae isolates were not susceptible to at least one antibiotic in three or more groups of antibiotics were considered MDR (http://www.cdc.gov/hai/surveillance). AmpC-β-lactamase-producing K. pneumoniae isolates were distinguished by AmpC disk test as described previously. Ceftazidime and cefotaxime discs were applied on Mueller Hinton agar 1.5 cm away from the center of two these discs combined with clavulanic acid and incubated at 37 °C for 24 h. Positive results were interpreted in accordance with previous studies, where Escherichia coli ATCC 25922 and K. pneumoniae ATCC 700603 were considered as negative and positive controls, respectively [[16], [17], [18]].
2.3. Minimum inhibitory concentraction
In this study, all the isolates that were confirmed as MDR were checked for resistance to colistin by microbroth dilution method. A final concentration (1024 μg/ml) of powder of colistin sulfate salt (Sigma-Aldrich, Merck, Germany) were stored at −80 °C. Consequently, different working concentrations of colistin range from 0.5 to 16 mg/L were prepared in the tubes of Mueller-Hinton broth according to the dilution recommendations by European Committee on Antimicrobial Susceptibility Testing guidelines. The MICs of colistin for each K. pneumoniae isolates were defined by microbroth dilution in triplicate. Colistin-resistant K. pneumoniae isolates were defined as a MIC ≥4 μg mL−1 [19].
2.4. DNA extraction and detection resistant genes
The K. pneumoniae isolates overnight culture at 37 °C in Luria–Bertani media were used to extract of bacterial genomic DNAs by Qiagen DNA Extraction Kit (QIAGEN, Crawley, UK). The presence of the antibiotic resistance genes including blaNDM, blaIMP, blaVIM, blaKPC, blaSHV, blaTEM, blaCTXM, qnrA, qnrB, qnrS, and aac(6')-Ib in the K. pneumoniae isolates were studied with PCR analysis. K. pneumoniae ATCC7881 served as the positive control for detecting blaSHV, blaTEM, blaCTXM genes. Enterobacter spp. strain KEJ-1, with blaNDM (GenBank accession no. KP347135), and K. pneumoniae ATCC BAA-1705, which carries blaVIM, blaIMP, and blaKPC genes, were utilized as positive controls for detecting Metallo-β-lactamase (MBL) genes. Additionally, K. pneumoniae UAB1 Strain containing the PMG252 plasmid (qnrA) or PMG298 plasmid (qnrB), and Salmonella enterica serotype Bovis morbificans strain AM12888 (qnrS) were employed as positive controls for the presence of the qnr gene. Enterobacter cloacae strain HM 477 was used as the positive control for detecting the aac(6′)-Ib gene. Water was utilized as the negative control in the experimental setup. The primers sequences used in this study are shown in Table 1. The PCR was carried out with a 25 μl of final volume including 12.5 μL of Master Mix 2x (Qiagen HotStar Taq polymerase), 7.5 μL nuclease-free water, 1 μL of 10 pmol of reverse and forward primers, 3 μL of genomic DNA (50 ng/μL). The thermal profile of PCR on a thermal cycler included initial denaturation, 94 °C for 5 min; 30 cycles of denaturation, 94 °C for 1 min; annealing variable temperature (Table 1) for 1 min; elongation, 72 °C for 1 min; and final extension, 72 °C for 5 min. Amplified products were detected on 1.5% agarose gel by electrophoresis and visualized by safe stain under a UV transilluminator. The sizes of amplifications were compared with a 1 kb DNA ladder.
Table 1.
Details of primers and probes used to perform PCR and Real Time PCR.
| Gene name | Oligonucleotide Sequence (5′–3′) | Annealing temperature (°C) | Reference | ||
|---|---|---|---|---|---|
| Real Time PCR | |||||
| pmrA | F | 5'-CGCAGGATAATCTGTTCTCCA-3' | 61 | [37] | |
| R | 5'-GGTCCAGGTTTCAGTTGCAA-3' | ||||
| pmrB | F | 5'-GCGAAAAGATTGGCAAATCG-3' | 61 | [37] | |
| R | 5'-ATCAATGGGTGCTGACGTT-3' | ||||
| pmrC | F | 5'-CTCTCGCCTCGTTCCTGAA-3' | 61 | [37] | |
| R | 5'-CGGAGTGGTGTCGAGGATA-3' | ||||
| phoQ | F | 5'-CCACAGGACGTCATCACCA-3' | 59 | [37] | |
| R | 5'-GCAGGTGTCTGACAGGGATT-3' | ||||
| phoP | F | 5'-GAGCGTCAGACTACTATCGA-3' | 59 | [37] | |
| R | 5'GTTTTCCCATCTCGCCAGCA-3' | ||||
| arnT | F | 5'-ATGGCGCATTACGCTTTGCT-3' | 60 | [38] | |
| R | 5'-CCAGGGGGAGACCACAAATG-3' | ||||
| Conventional PCR | Product size (bp) | ||||
| qnrA | F | 5'-GATCGGCAAAGGTTAGGT-3' | 53 | 627 | [4] |
| R | 5'-ATTTCTCACGCCAGGATT-3' | ||||
| qnrB | F | 5'-GATCGTGAAAGCCAGAAA-3' | 53 | 562 | [4] |
| R | 5'-ACGATGCCTGGTAGTTGT-3' | ||||
| qnrS | F | 5'-GCAGAATTCAGGGGTGTGAT-3' | 57 | 118 | [27] |
| R | 5'-AACTGCTCCAAAAGCTGCTC-3' | ||||
| aac(6')-Ib | F | 5'-TTGCGATGCTCTATGAGTGGC-3' | 55 | 472 | [4] |
| R | 5'-CTCGAATGCCTGGCGTG-3' | ||||
| blaNDM | F | 5'-GCAGCTTGTCGGCCATGCGGGC-3' | 52 | 621 | [40] |
| R | 5'-GGTCGCGAAGCTGAGCACCGCAT-3' | ||||
| blaIMP | F | 5'-GGAATAGAGTGGCTTAAYTCTC-3' | 58 | 232 | [17] |
| R | 5'-GGTTTAAYAAAACAACCACC-3' | ||||
| blaVIM | F | 5'-GATGGTGTTTGGTCGCATA-3' | 53 | 390 | [17] |
| R | 5'-CGAATGCGCAGCACCAG-3' | ||||
| blaKPC | F | 5'- CGTCTAGTTCTGCTGTCTTG -3' | 48 | 798 | [40] |
| R | 5'- CTTGTCATCCTTGTTAGGCG-3' | ||||
| blaSHV | F | 5'- GGTTATGCGTTATATTCGCC-3' | 58 | 867 | [40] |
| R | 5'- TTAGCGTTGCCAGTGCTC-3' | ||||
| blaTEM | F | 5'- ATGAGTATTCAACATTTCCG-3' | 44 | 931 | [40] |
| R | 5'- CCAATGCTTAATCAGTGAGC-3' | ||||
| blaCTXM | F | 5'-TTTGCGATGTGCAGTACCAG-3' | 58 | 544 | [40] |
| R | 5'-CGATATCGTTGGTGGTGCCATA-3' | ||||
2.5. Expression of colistin resistant genes
Expressions of colistin resistance related genes including pmrA, pmrB, pmrC, phoQ, phoP, and arnT were quantified by Real-Time PCR (Rotor-Gene, Qiagen Corbett, Hilden, Germany) via specific primers and probes (Table 1). The RNA of colistin resistant K. pneumoniae isolates were harvested from the log-phase growth of bacteria using a bacterial RNeasy mini kit (Qiagen). Then, the RNA from each isolate was synthesized to cDNA via Quantiscript Reverse Transcription kit (Qiagen).The Real-Time PCR reactions were in a volume of 20 μl including of 0.4 ml of TaqMan probe, 10 μL Power Sybr Green Master Mix (Takara Bio, Shiga, Japan), 0.4 ml of primer (forward and reverse), 5.8 ml water, and 1 ml of first-strand cDNA. The amplification conditions in thermocycler were in two stages as follows: a first denaturation of 1 cycle for 4 min at 94 °C, followed by 40 cycles at 94 °C for 5 min (annealing) and at 60 °C for 30s (extension). The expression of rpoB as a housekeeping gene was used for normalizing transcript levels. All experiments for studied genes were performed in triplicate. Finally, fold changes of expression of each colistin resistance gene were measured based on the threshold cycle (2-ΔΔCt) method.
2.6. Statistical analysis
All the results from K. pneumoniae isolates were collected and entered into SPSS version 22 after conducting the experiments of this research. Although the demographic information of the isolates was explained using descriptive statistics, the relationship between different variables such as sample type, gender, and hospital with the rate of antibiotic resistance, etc., were analyzed using the chi-square test.
3. Result
The frequency of K. pneumoniae infection according to the gender of the patients showed that 8 (21.2%) and 30 (78.9%) isolates were isolated from men and women, respectively. It was also found that 4 (10.5%) isolates were isolated from blood, 19 (50%) isolates from urine, and 15 (39.5%) isolates from sputum of patients. As mentioned, the samples were collected from 5 hospitals including A to E, that 1 (2.6%), 12 (31.6%), 15 (39.5%), 7 (18.4%), and 3 (7.9%) K. pneumoniae isolates were isolated from hospitals A, B, C, D, and E, respectively. According to the results of the antibiotic sensitivity test the highest and lowest resistance among K. pneumoniae isolates were to cefotaxime 33 (86.8%) and minocycline 8 (21.1%), respectively. Also, the most intermediate resistance of the isolates was obtained to minocycline 18 (47.4%). Nineteen (50%) of K. pneumoniae isolates were sensitive to fosfomycin. The details of the antibiogram results of clinical isolates can be seen in Table 2. The analysis of the antibiotic resistance pattern of isolates revealed that among 38 K. pneumoniae isolates, 35 (92.1%) were identified as MDR isolates. Examining the frequency of ESBL revealed that 31 (81.6%) of the isolates had the ability to produce these antibiotic resistance enzymes phenotypically. Statistical analysis showed that there was a significant relationship between ESBL-producing isolates and MDR resistance (P<0.05). Phenotypic test to identify AmpC-producing isolates showed that 24 (63.2%) isolates carried these antibiotic resistance enzymes. The statistical analysis revealed a significant relationship between AmpC-producing and MDR isolates (P = 0.04), as well as ESBL-producing isolates (P=0.04). Also, there was no significant relationship between hospitals, type of sample and gender of patients with the level of antibiotic resistance (P>0.05). The results of microbroth dilution on MDR isolates showed that among 38 isolates, only 5 (13.1%) isolates were resistant to colistin and the MIC range of these isolates was between 4 and 64 μg ml−1 (Table 4). All 5 colistin-resistant isolates were resistant to all other antibiotics that were investigated in this study. The abundance of antibiotic resistance genes using PCR technique revealed that 16 isolates (42.1%) carried blaNDM, 17 isolates (44.7%) carried blaIMP, 10 isolates (26.3%) carried blaVIM, 14 isolates (36.8%) carried blaSHV, 16 isolates (42.1%) carried blaTEM, 26 isolates (68.4%) carried blaCTXM, 12 isolates (31.6%) carried qnrA, 17 isolates (44.7%) carried qnrB, 7 isolates (18.4%) carried qnrS, and 15 isolates (39.5%) carried aac(6')-Ib. On the other hand, none of the isolates had the blaKPC gene. On one side, a significant relationship was observed between the type of sample and the abundance of blaVIM, blaTEM, and qnrS genes, on the other hand, there was a significant relationship between hospitals and the abundance of blaNDM (P=0.04), blaIMP (P=0.03), and qnrS (P=0.04) genes (Table 3).
Table 2.
Antibiotics resistance pattern of K. pneumoniae clinical isolates from five hospitals.
| Antibiotics | Total samples N (%) |
||
|---|---|---|---|
| Resistance | Intermediate | Sensitive | |
| Ceftazidime | 29 (76.3) | 3 (7.9) | 6 (15.8) |
| Cefotaxime | 33 (86.8) | 2 (5.3) | 3 (7.9) |
| Ceftriaxone | 25 (65.8) | 3 (7.9) | 10 (26.3) |
| Cefoxitin | 27 (71.0) | 7 (18.4) | 4 (10.5) |
| Imipenem | 31 (81.6) | 2 (5.3) | 5 (13.2) |
| Chloramphenicol | 15 (39.5) | 17 (44.7) | 6 (15.8) |
| Norfloxacin | 26 (68.4) | 4 (10.5) | 8 (21.1) |
| Fosfomycin | 12 (31.6) | 7 (18.4) | 19 (50.0) |
| Gentamicin | 26 (68.4) | 2 (5.3) | 10 (26.3) |
| Ciprofloxacin | 29 (76.3) | 4 (10.5) | 5 (13.2) |
| Minocycline | 8 (21.1) | 18 (47.4) | 12 (31.6) |
| Kanamycin | 18 (47.4) | 14 (36.8) | 6 (15.8) |
| Trimethoprim + sulfamethoxazole | 31 (81.6) | 1 (2.6) | 6 (15.8) |
Table 4.
Characteristics and expression level of resistance mechanisms in colistin-resistant isolates.
| Isolates number | hospital | Source of sample | MIC μg ml−1 | Upregulation of genes |
Co-existence of other resistance mechanisms |
|||||
|---|---|---|---|---|---|---|---|---|---|---|
| pmrA | pmrB | pmrC | phoQ | phoP | arnT | |||||
| K7 | C | Suptum | 64 | 35.01± 1.03 | 36.00± 0.34 | 57.28± 0.42 | 11.87± 0.87 | 12.81± 0.72 | 32.75± 0.76 | ESBL, AmpC, blaNDM, qnrA, qnrB, qnrS, and aac(6')-Ib |
| K9 | D | Blood | 16 | 93.05± 0.73 | 93.05± 0.52 | 5.81± 2.1 | 6.58± 2.01 | 3.73± 0.59 | 80.44± 1.05 | ESBL, AmpC, blaNDM, blaIMP, blaVIM, qnrA, qnrB, qnrS, and aac(6')-Ib |
| K10 | C | Suptum | 4 | 288.0± 0.88 | 52.70± 1.01 | 56.00± 0.35 | 96.00± 0.56 | 49.00± 1.2 | 135.0± 2.4 | ESBL, AmpC, blaNDM, blaIMP, qnrA, qnrB, qnrS, and aac(6')-Ib |
| K15 | B | Blood | 32 | 39.39± 1.45 | 136.0± 0.78 | 25.81± 0.67 | 55.71± 0.91 | 47.50± 0.66 | 1.03± 0.27 | ESBL, AmpC, blaNDM, blaIMP, blaVIM, qnrA, qnrB, qnrS, and aac(6')-Ib |
| K17 | D | Blood | 16 | 3.91± 2.22 | 274.0± 0.88 | 5.09± 1.2 | 196.00± 2.8 | 82.71± 0.46 | 29.65± 0.84 | ESBL, AmpC, blaNDM, blaIMP, qnrA, qnrB, and qnrS |
Table 3.
The correlation of different investigated variables in this study.
| MDR |
ESBL |
Abundance (N) |
Abundance (N) |
||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
blaVIM |
blaTEM, |
qnrS |
blaNDM, |
blaIMP |
qnrS |
||||||||||||||||
| No | Yes | No | Yes | No | Yes | No | Yes | No | Yes | No | Yes | No | Yes | No | Yes | ||||||
| AmpC | No | 3 | 11 | 5 | 9 | TOF | B | 0 | 4 | 1 | 3 | 0 | 4 | H | A | 1 | 0 | 1 | 0 | 1 | 0 |
| Yes | 0 | 24 | 2 | 22 | U | 15 | 4 | 16 | 3 | 12 | 7 | B | 11 | 1 | 10 | 2 | 7 | 5 | |||
| p-value | 0.04 | 0.04 | S | 13 | 2 | 14 | 1 | 9 | 5 | C | 14 | 1 | 6 | 9 | 10 | 5 | |||||
| p-value | 0.04 | 0.01 | 0.04 | D | 2 | 5 | 3 | 4 | 2 | 5 | |||||||||||
| E | 3 | 0 | 2 | 1 | 1 | 2 | |||||||||||||||
| p-value | 0.04 | 0.03 | 0.04 | ||||||||||||||||||
∗TOF: Type of sample; B: blood, U: urine, S: sputum; H: Hospital.
Investigating the upregulation of genes involved in colistin resistance by Real Time PCR determined that the expression level of pmrA gene enhanced between 3.91 and 288.00-fold in all colistin resistant isolates compared to the susceptible isolate. Besides that, 36.00 to 274-fold of the pmrB, 5.09 to 57.28-fold of pmrC, 6.58 to 196.00-fold of phoQ, 3.73 to 82.71-fold of phoP, and 1.03 to 135.00-fold of arnT genes overexpression were showed in colistin resistant isolates in comparison to the susceptible isolate (Table 4). An interesting observation from our data analysis was the co-existence of ESBLs, AmpC, fluoroquinolone, aminoglycoside, and carbapenem resistant genes in colistin-resistant isolates, which also exhibited overexpression of colistin-resistant related genes (pmrA, pmrB, pmrC, phoQ, phoP, and arnT).
4. Discussion
The presence of antibiotic resistance mechanisms such as ESBLs, AmpC, fluoroquinolone, aminoglycoside, and carbapenem resistant genes in MDR Gram-negative bacteria especially colistin-resistant bacteria are a warning sign for increasing antibiotic resistance [20,21]. Therefore, resistance to colistin as one of the last-line antibiotics is a challenging issue in treatment, so identifying the colistin-resistant mechanisms is very vital, because it causes an appropriate and accurate response, especially for native isolates of each geographical region [22]. In this study, the highest and lowest resistance among K. pneumoniae isolates were to cefotaxime (86.8 %) and minocycline (21.1 %), respectively. Studies have been conducted in line with our study, which determined that minocycline was one of the most effective antibiotics and reported high resistance to cephalosporins against K. pneumoniae clinical isolates [4,17,23]. Recently, activity of minocycline against MDR Gram negative isolates has been documented in some studies as a resulting minocycline has been suggested as an alternative therapy for Gram negative isolates [24]. Also, high resistance to cephalosporins was reported in K. pneumoniae isolates that has been increasing during the last few years, which confirms our results in the field of reducing the effectiveness of these antibiotics [[25], [26], [27], [28]]. In our analysis of antibiotic susceptibility patterns, we identified a high number of MDR (92.1%) K. pneumoniae isolates. Similar to our results, in recent years studies conducted on K. pneumoniae clinical isolates have reported a high rate of MDR. Abossedgh et al. reported the high rate of MDR (60.8%) in K. pneumoniae isolates [27]. In another study, Kiaei et al. reported that 63.3% of 30 K. pneumoniae clinical isolates collected from patients hospitalized in the burn ward were MDR [17]. In 2020, it was reported that 100% colistin-resistant isolates K. pneumoniae were MDR [23]. In our research, we found that a significant number of K. pneumoniae isolates tested positive for AmpC and ESBL enzymes, with 63.2% and 81.6% of the isolates carrying AmpC and ESBL, respectively. In 2019, a study found that 63.3% and 16.7% of K. pneumoniae isolates carried ESBL and AmpC, respectively [17]. In line with our results in 2020, it was found in the study that K. pneumoniae isolates collected from urinary infections had a high frequency of ESBL (94.1%) [27]. In consistent with our study, Khalifa et al. reported a high frequency of ESBL and AmpC enzymes in K. pneumoniae isolates, and the frequency of both enzymes in these isolates was 82.9% [29]. According to our PCR result, 36.8%, 42.1%, and 68.4% of K. pneumoniae isolates harbored blaSHV, blaTEM, and blaCTXM genes, respectively. In recent years, various studies have reported the high frequency of blaSHV, blaTEM, and blaCTXM genes in clinical isolates, which confirms the results obtained from our study. Moradi et al. found 76.7% of K. pneumoniae isolates have the blaTEM gene, 92.8% of the isolates have the blaCTXM gene, and 96.4% of the isolates carry the blaSHV gene [30]. In 2021, high rates of blaSHV (66%), blaTEM (74%), and blaCTXM (86%) genes were carried in K. pneumoniae isolates which is in agreement with our results [29]. In another study, it was found that the prevalence of ESBL genes varied, with blaSHV exhibiting the highest prevalence at 94.2% and blaTEM showing the lowest at 74.2%. Notably, 60% of the isolates in the study were identified as carrying all three ESBL genes: blaSHV, blaTEM, and blaCTXM [31]. Based on our result, the prevalence of carbapenmase genes including blaNDM, blaIMP, and blaVIM in K. pneumoniae isolates were 42.1%, 44.7%, 26.3%, respectively. In line with our results, Alizadeh et al. reported a high amount of carbapenemase genes including blaVIM (75%), blaIMP (17.5%), and blaNDM (17.5%) in K. pneumoniae isolates [32]. Urmi et al. reported the frequency of carbapenemase genes in K. pneumoniae isolates including blaIMP, blaNDM, and blaVIM were 10.3%, 22.4%, and 19%, respectively [33]. Based on our results, the frequency of plasmid-borne fluoroquinolone resistant genes including qnrA, qnrB, and qnrS was reported 31.6%, 44.7%, and 18.4%, respectively. Several studies have been conducted by researchers on the frequency of qnr genes, which show the increasing number of these genes in K. pneumoniae isolates. In this regard, the frequency of qnrA, qnrB, and qnrS genes were reported 5.6%, 32.9%, and 26.1% of K. pneumoniae isolates, respectively [4]. In 2020, the high frequency of qnrA, qnrB, and qnrS genes were detected in 13.7%, 29.4%, and 33.3 % of K. pneumoniae isolates, respectively [27]. In 2022, Roshani et al. reported the high frequency of qnr genes, that 22.5% of K. pneumoniae isolates carrying qnrA, 26.75% isolates had qnrB, and 46.25% of isolates horbored qnrS gene. These results confirm the high frequency of qnr genes in our study [34]. Also, in our study, it was shown that 39.5% isolates were expressing the aac(6')-Ib gene. Similar to the results of our study, Moghadam et al. reported the frequency of aac(6')-Ib antibiotic resistance gene was 31.8% in K. pneumoniae isolates [4]. Jomehzadeh et al. reported a high amount of acc(6')-Ib-cr (82.7%) from K. pneumoniae clinical isolates [35]. Analysis of the MIC results from this study revealed that a mere 13.1% of the isolates exhibited resistance to colistin. The MIC values for these resistant isolates ranged from 4 to 64 μg ml−1. The colistin-resistant isolates exhibited up-regulation of pmrA, pmrB, pmrC, phoQ, phoP, and arnT genes in comparison to the susceptible isolates. The emergence of colistin-resistant Gram-negative bacteria poses a substantial threat to public health, as colistin serves as the last line antibiotic against carbapenem-resistant Gram-negative bacteria. Colistin resistant Gram negative bacteria has previously been documented in different regions of the world. Although various mechanisms had been reported for resistance to colistin, increasing the expression of some chromosomal operons was one of the most important mechanisms in Gram-negative bacteria [36]. In their study, Khoshbayan et al. identified a notable association between colistin-resistant K. pneumoniae isolates and the upregulation of the pmrHFIJKLM and pmrCAB operons. The research reported that the expression levels of these operons were markedly elevated in colistin-resistant isolates compared to colistin-sensitive ones [37]. In another study, Sato et al. indicated that expression of arnT gene was increased in four colistin-resistant isolates compared to colistin-sensitive isolates [38]. Similar to our results, Cannatelli et al. reported overexpression of phoP, phoQ, and pmr operon in colistin-resistant K. pneumoniae isolates [39]. In addition to high antibiotic resistance, our results showed the simultaneous presence of different transmissible mechanisms including ESBLs, AmpC, fluoroquinolone, aminoglycoside, and carbapenem resistant genes in colistin-resistant K. pneumoniae isolates. Up-regulating of pmrA, pmrB, pmrC, phoQ, phoP and arnT genes in colistin-resistant isolates compared to colistin-sensitive isolates was considered one of the mechanisms of colistin resistance. Although ongoing studies have focused more on elucidating the mechanisms involved in colistin resistance, infection control and the application of antimicrobial stewardship strategies are urgently needed to prevent the spread of untreatable pathogens. One limitation of the study is the relatively small sample size, which may impact the generalizability of the results to a larger population. Additionally, the study focused on a specific set of genes and mechanisms related to colistin resistance, and other potential factors contributing to resistance may not have been fully explored. Furthermore, the study did not investigate the impact of other potential resistance mechanisms or genetic mutations that could also play a role in colistin resistance. Future research with larger sample sizes and a more comprehensive analysis of resistance mechanisms could provide a more nuanced understanding of colistin resistance in Gram-negative bacteria.
5. Conclusion
This study highlights the concerning rise in antibiotic resistance among K. pneumoniae isolates in Tehran, Iran. Our findings demonstrate a high prevalence of resistance to multiple antibiotics, with a significant proportion of isolates showing resistance to colistin. The detection of various antibiotic resistance genes, including ESBLs, AmpC, and carbapenemase genes, underscores the complex mechanisms driving resistance in these isolates. Furthermore, the upregulation of specific genes associated with colistin resistance, such as pmrA, pmrB, pmrC, phoQ, phoP, and arnT, in colistin-resistant isolates emphasizes the importance of understanding the molecular mechanisms underlying resistance development. The simultaneous presence of multiple resistance traits in colistin-resistant isolates highlights the urgent need for comprehensive surveillance and effective interventions to combat multidrug-resistant K. pneumoniae strains. Based on our findings, we recommend enhanced monitoring of antibiotic resistance patterns, implementation of strict infection control measures, and promotion of antibiotic stewardship programs in healthcare settings. Additionally, the development of novel treatment strategies and continued research into alternative therapies are crucial to address the escalating threat of antibiotic resistance in K. pneumoniae.
Funding
This research was supported by grant from Iran University of Medical Science (Approval ID: IR.IUMS.FMD.REC.1398.27).
Ethics approval
Not applicable.
Consent to participate
Not applicable.
Consent for publication
Not applicable.
Availability of data and material
All data supporting the conclusions of this article are included within the article.
Code availability
Not applicable.
CRediT authorship contribution statement
Maryam Mirshekar: Investigation, Methodology, Writing – original draft. Rezvan Golmoradi Zadeh: Investigation. Majid Taati Moghadam: Software, Writing – original draft. Shahla Shahbazi: Investigation, Software, Writing – review & editing. Faramarz Masjedian Jazi: Project administration, Supervision, Writing – review & editing.
Declaration of competing interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
None.
Acknowledgements
In this study, we are grateful to Dr. Behzad Taati who helped in the field of statistical analysis in this study. We are also grateful to Mr. Alireza Amini, who sincerely helped us during this project.
Contributor Information
Maryam Mirshekar, Email: maryam.mirshekar82@gmail.com.
Rezvan Golmoradi Zadeh, Email: rezvan.g.5054@gmail.com.
Majid Taati Moghadam, Email: majidtaati1367@gmail.com.
Shahla Shahbazi, Email: shahbazi.shahla@yahoo.com.
Faramarz Masjedian Jazi, Email: masjedian.faramarz@gmail.com.
References
- 1.Saboohi R., Siadat S., Aghasadeghi M., Razavi M., Rajaei B., Rad N.S., et al. Molecular detection of qnrA, qnrB and qnrS resistance genes among Salmonella spp. in Iran. Microbiol Curr Res. 2012;5:24–30. [Google Scholar]
- 2.Shahbazi S., Sabzi S., Goodarzi N.N., Fereshteh S., Bolourchi N., Mirzaie B., et al. Identification of novel putative immunogenic targets and construction of a multi-epitope vaccine against multidrug-resistant Corynebacterium jeikeium using reverse vaccinology approach. Microb Pathog. 2022;164 doi: 10.1016/j.micpath.2022.105425. [DOI] [PubMed] [Google Scholar]
- 3.Sabzi S., Shahbazi S., Noori Goodarzi N., Haririzadeh Jouriani F., Habibi M., Bolourchi N., et al. Genome-wide subtraction analysis and reverse vaccinology to detect novel drug targets and potential vaccine candidates against Ehrlichia chaffeensis. Appl Biochem Biotechnol. 2023;195(1):107–124. doi: 10.1007/s12010-022-04116-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Moghadam M., Shariati A., Mirkalantari S., Karmostaji A. The complex genetic region conferring transferable antibiotic resistance in multidrug-resistant and extremely drug-resistant Klebsiella pneumoniae clinical isolates. New microbes new infect. 2020;36 doi: 10.1016/j.nmni.2020.100693. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Goodarzi N.N., Fereshteh S., Sabzi S., Shahbazi S., Badmasti F. Construction of a chimeric FliC including epitopes of OmpA and OmpK36 as a multi-epitope vaccine against Klebsiella pneumonia. Health Biotechnol Biopharma. 2021;5:44–60. [Google Scholar]
- 6.Shahkolahi S., Shakibnia P., Shahbazi S., Sabzi S., Badmasti F., Asadi Karam M.R., et al. Detection of ESBL and AmpC producing Klebsiella pneumoniae ST11 and ST147 from urinary tract infections in Iran. Acta Microbiol Immunol Hung. 2022;69(4):303–313. doi: 10.1556/030.2022.01808. [DOI] [PubMed] [Google Scholar]
- 7.Kiaei S., Moradi M., Hosseini Nave H., Hashemizadeh Z., Taati-Moghadam M., Kalantar-Neyestanaki D. Emergence of co-existence of bla NDM with rmtC and qnrB genes in clinical carbapenem-resistant Klebsiella pneumoniae isolates in burning center from southeast of Iran. Folia Microbiol. 2019;64:55–62. doi: 10.1007/s12223-018-0630-3. [DOI] [PubMed] [Google Scholar]
- 8.Taati Moghadam M., Amirmozafari N., Shariati A., Hallajzadeh M., Mirkalantari S., Khoshbayan A., et al. How phages overcome the challenges of drug resistant bacteria in clinical infections. Infect Drug Resist. 2020:45–61. doi: 10.2147/IDR.S234353. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Olaitan A.O., Morand S., Rolain J.-M. Emergence of colistin-resistant bacteria in humans without colistin usage: a new worry and cause for vigilance. Int J Antimicrob Agents. 2016;47(1):1–3. doi: 10.1016/j.ijantimicag.2015.11.009. [DOI] [PubMed] [Google Scholar]
- 10.Shahbazi R., Alebouyeh M., Shahkolahi S., Shahbazi S., Hossainpour H., Salmanzadeh-Ahrabi S. Molecular study on virulence and resistance genes of ST131 clone (uropathogenic/enteropathogenic Escherichia coli) hybrids in children. Future Microbiol. 2023;18(18):1353–1361. doi: 10.2217/fmb-2023-0142. [DOI] [PubMed] [Google Scholar]
- 11.Olaitan A.O., Diene S.M., Kempf M., Berrazeg M., Bakour S., Gupta S.K., et al. Worldwide emergence of colistin resistance in Klebsiella pneumoniae from healthy humans and patients in Lao PDR, Thailand, Israel, Nigeria and France owing to inactivation of the PhoP/PhoQ regulator mgrB: an epidemiological and molecular study. Int J Antimicrob Agents. 2014;44(6):500–507. doi: 10.1016/j.ijantimicag.2014.07.020. [DOI] [PubMed] [Google Scholar]
- 12.Lippa A.M., Goulian M. Feedback inhibition in the PhoQ/PhoP signaling system by a membrane peptide. PLoS Genet. 2009;5(12) doi: 10.1371/journal.pgen.1000788. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Gharaibeh M.H., Shatnawi S.Q. An overview of colistin resistance, mobilized colistin resistance genes dissemination, global responses, and the alternatives to colistin: a review. Vet World. 2019;12(11):1735. doi: 10.14202/vetworld.2019.1735-1746. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Taati Moghadam M., Mirzaei M., Fazel Tehrani Moghaddam M., Babakhani S., Yeganeh O., Asgharzadeh S., et al. The challenge of global emergence of novel colistin-resistant Escherichia coli ST131. Microb Drug Resist. 2021;27(11):1513–1524. doi: 10.1089/mdr.2020.0505. [DOI] [PubMed] [Google Scholar]
- 15.Moradi M., Norouzi A. Prevalence of bla-CTX-M, bla-SHV, and bla-TEM genes and comparison of antibiotic resistance pattern in extended-spectrum β-lactamase producing and non-producing groups of Klebsiella pneumoniae isolated from clinical samples in kerman hospitals. J adv biomed sci. 2016;6(1):120–128. [Google Scholar]
- 16.Rahimzadeh M., Shahbazi S., Sabzi S., Habibi M., Asadi Karam M.R. Antibiotic resistance and genetic diversity among Pseudomonas aeruginosa isolated from urinary tract infections in Iran. Future Microbiol. 2023;18(16):1171–1183. doi: 10.2217/fmb-2023-0118. [DOI] [PubMed] [Google Scholar]
- 17.Kiaei S., Moradi M., Hosseini Nave H., Hashemizadeh Z., Taati-Moghadam M., Kalantar-Neyestanaki D. Emergence of co-existence of bla NDM with rmtC and qnrB genes in clinical carbapenem-resistant Klebsiella pneumoniae isolates in burning center from southeast of Iran. Folia Microbiol. 2019;64:55–62. doi: 10.1007/s12223-018-0630-3. [DOI] [PubMed] [Google Scholar]
- 18.Haghighatpanah M., Mojtahedi A. Characterization of antibiotic resistance and virulence factors of Escherichia coli strains isolated from Iranian inpatients with urinary tract infections. Infect Drug Resist. 2019:2747–2754. doi: 10.2147/IDR.S219696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Khoshbayan A., Shariati A., Shahmoradi S., Baseri Z., Mozafari H., Darban-Sarokhalil D. Prevalence and molecular mechanisms of colistin resistance in Acinetobacter baumannii clinical isolates in Tehran, Iran. Acta Microbiol Immunol Hung. 2021;68(4):262–266. doi: 10.1556/030.2021.01420. [DOI] [PubMed] [Google Scholar]
- 20.Shahbazi S., Habibi M., Badmasti F., Sabzi S., Farokhi M., Karam M.R.A. Design and fabrication of a vaccine candidate based on rOmpA from Klebsiella pneumoniae encapsulated in silk fibroin-sodium alginate nanoparticles against pneumonia infection. Int Immunopharm. 2023;125 doi: 10.1016/j.intimp.2023.111171. [DOI] [PubMed] [Google Scholar]
- 21.Shivaee A., Mirshekar M. Association between ESBLs genes and quinolone resistance in uropathogenic Escherichia coli isolated from patients with urinary tract infection. Infect Epidemiol Microbiol. 2019;5(1):15–23. [Google Scholar]
- 22.Moghadam M.T., Mojtahedi A., Moghaddam M.M., Fasihi-Ramandi M., Mirnejad R. Rescuing humanity by antimicrobial peptides against colistin-resistant bacteria. Appl Microbiol Biotechnol. 2022;106(11):3879–3893. doi: 10.1007/s00253-022-11940-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Mirshekar M., Darbandi A., Ghanavati R., Shivaee A., Masjedian F. Analysis of mgrB gene mutations in colistin-resistant Klebsiella pneumoniae in Tehran, Iran. Gene Rep. 2020;21 [Google Scholar]
- 24.Shokri D., Rabbani Khorasgani M., Fatemi S.M., Soleimani-Delfan A. Resistotyping, phenotyping and genotyping of New Delhi metallo-β-lactamase (NDM) among Gram-negative bacilli from Iranian patients. J Med Microbiol. 2017;66(4):402–411. doi: 10.1099/jmm.0.000444. [DOI] [PubMed] [Google Scholar]
- 25.Shivaee A., Shahbazi S., Soltani A., Ahadi E. Evaluation of the prevalence of broad-spectrum beta-lactamases (ESBLs) and carbapenemase genes in Klebsiella pneumoniae strains isolated from burn wounds in patients referred to Shahid Motahari Hospital in Tehran. Medical Sciences Journal of Islamic Azad University , Tehran Medical Branch. 2019 [Google Scholar]
- 26.Badmasti F, Habibi M, Sabzi S, Noori Goodarzi N, Farokhi M, Asadi Karam MR. In silico and in vivo investigations of the immunoreactivity of Klebsiella pneumonia OpmA protein as a vaccine candidate. Iran Biomed J.0-. [DOI] [PMC free article] [PubMed]
- 27.Abossedgh R., Ghane M., Babaeekhou L. High Frequency of qnr genes in urinary isolates of extended-spectrum β-lactamase (ESBL)-producing Klebsiella pneumoniae in Tehran, Iran. Shiraz E-Medical Journal. 2020;21(3) [Google Scholar]
- 28.Shivaee A., Meskini M., Shahbazi S., Zargar M. Prevalence of flmA, flmH, mrkA, ecpA, and mrkD virulence genes affecting biofilm formation in clinical isolates of K. pneumonia. Feyz Med Sci J. 2019;23(2):168–176. [Google Scholar]
- 29.Khalifa S.M., Abd El-Aziz A.M., Hassan R., Abdelmegeed E.S. β-lactam resistance associated with β-lactamase production and porin alteration in clinical isolates of E. coli and K. pneumoniae. PLoS One. 2021;16(5) doi: 10.1371/journal.pone.0251594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Moradi M., Norouzi A. Prevalence of bla-CTX-M, bla-SHV, and bla-TEM genes and comparison of antibiotic resistance pattern in extended-spectrum β-lactamase producing and non-producing groups of Klebsiella pneumoniae isolated from clinical samples in kerman hospitals. Journal of Advanced Biomedical Sciences. 2016;6(1):120–128. [Google Scholar]
- 31.Taati Moghadam M., Hossieni Nave H., Mohebi S., Norouzi A. The evaluation of connection between integrons class I and II and ESBL-producing and Non-ESBL klebsiella pneumoniae isolated from clinical samples, Kerman. Iran. J Med Microbiol. 2016;10(4):1–9. [Google Scholar]
- 32.Alizadeh R., Alipour M., Rezaee F. Prevalence of metallo-β-lactamase genes in clinical isolates of Klebsiella pneumoniae in health care centers in mazandaran province. Avicenna Journal of Clinical Microbiology and Infection. 2021;8(4):130–134. [Google Scholar]
- 33.Urmi U.L., Nahar S., Rana M., Sultana F., Jahan N., Hossain B., et al. Genotypic to phenotypic resistance discrepancies identified involving β-lactamase genes, bla KPC, bla IMP, bla NDM-1, and bla VIM in uropathogenic Klebsiella pneumoniae. Infect Drug Resist. 2020:2863–2875. doi: 10.2147/IDR.S262493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Roshani M., Goodarzi A., Hashemi A., Afrasiabi F., Goudarzi H., Arabestani M. Detection of qnrA, qnrB, and qnrS genes in Klebsiella pneumoniae and Escherichia coli isolates from leukemia patients. Rev Med Microbiol. 2022;33(1):14–19. [Google Scholar]
- 35.Jomehzadeh N., Ahmadi K., Bahmanshiri M.A. Investigation of plasmid‐mediated quinolone resistance genes among clinical isolates of Klebsiella pneumoniae in southwest Iran. J Clin Lab Anal. 2022;36(7) doi: 10.1002/jcla.24342. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Taati Moghadam M., Mirzaei M., Fazel Tehrani Moghaddam M., Babakhani S., Yeganeh O., Asgharzadeh S., et al. The challenge of global emergence of novel colistin-resistant Escherichia coli ST131. Microb Drug Resist. 2021;27(11):1513–1524. doi: 10.1089/mdr.2020.0505. [DOI] [PubMed] [Google Scholar]
- 37.Khoshbayan A., Shariati A., Razavi S., Baseri Z., Ghodousi A., Darban-Sarokhalil D. Mutation in mgrB is the major colistin resistance mechanism in Klebsiella pneumoniae clinical isolates in Tehran, Iran. Acta Microbiol Immunol Hung. 2022;69(1):61–67. doi: 10.1556/030.2022.01679. [DOI] [PubMed] [Google Scholar]
- 38.Sato T., Shiraishi T., Hiyama Y., Honda H., Shinagawa M., Usui M., et al. Contribution of novel amino acid alterations in pmrA or pmrB to Colistin resistance in mcr-negative Escherichia coli clinical isolates, including major multidrug-resistant lineages O25b: H4-ST131-H 30Rx and Non-x. Antimicrob Agents Chemother. 2018;62(9) doi: 10.1128/aac.00864-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Cannatelli A., D'Andrea M.M., Giani T., Di Pilato V., Arena F., Ambretti S., et al. In vivo emergence of colistin resistance in Klebsiella pneumoniae producing KPC-type carbapenemases mediated by insertional inactivation of the PhoQ/PhoP mgrB regulator. Antimicrob Agents Chemother. 2013;57(11):5521–5526. doi: 10.1128/AAC.01480-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Shahbazi S., Karam M.R.A., Habibi M., Talebi A., Bouzari S. Distribution of extended-spectrum β-lactam, quinolone and carbapenem resistance genes, and genetic diversity among uropathogenic Escherichia coli isolates in Tehran, Iran. J Clin Microbiol. 2018;14:118–125. doi: 10.1016/j.jgar.2018.03.006. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data supporting the conclusions of this article are included within the article.