Echinococcus granulosus comparative genotyping in sheep in Saudi Arabia and Egypt

Abstract

Background:

Cystic echinococcosis (CE), which is triggered by the parasite Echinococcus granulosus, is a global zoonotic disease that is common in rural regions in which there are frequent encounters between dogs and other domestic animals. The disease can have devastating consequences, impacting the health of people and animals and leading to huge financial losses, especially in the agricultural industry. In the Kingdom of Saudi Arabia (KSA) and Egypt, despite the high incidence of disease, few investigations have been conducted into the genetic variation in species of the genus Echinococcus.

Aim:

This study sought to compare the genetic features of the hydatid cysts carried in sheep in KSA with those found in Egypt.

Methods:

DNA from the protoscolices was used in a PCR targeting the mitochondrial NADH dehydrogenase 1 (NAD1), cytochrome c oxidase subunit 1 (COX1), and nuclear actin II (ACT II) genes, and the resulting amplification products of 30 KSA and Egyptian isolates were sequenced and compared.

Results:

Among the sheep in KSA, the overall prevalence of CE was 0.51%. Of the sheep cyst DNA samples, 95%, 100%, and 52% were positive for the Cox1, nad1, and act II genes, respectively. Targeting all three genes, all KSA samples belonged to the E. granulosus genotype (G1), whereas all Egyptian isolates belonged to E. granulosus (G1) and E. canadensis (G6).

Conclusion:

We conclude that isolates of E. granulosus from the two countries shared a common origin in Arabic North Africa, with sheep and camels as common hosts.

Introduction

The cestode genus Echinococcus is extremely important in terms of zoonotic transmission causing the parasitic disease echinococcosis, which can be a major health problem in humans (Eckert and Deplazes, 2004). Cystic echinococcosis (CE; also known as hydatidosis) is characterized by the presence of hydatid cysts that are caused by the larval phase of Echinococcus granulosus sensu lato (s.l.). Alveolar cysts, which are caused by Echinococcus multilocularis, are fatal (Bonardi et al., 2012).

Canids are definitive hosts of E. granulosus, whereas various herbivores and omnivores are intermediate hosts, including sheep, cattle, and camels. Infection of intermediate hosts occurs through the ingestion of adult parasite eggs in contaminated food, water, or soil; the eggs then develop into the larval phase, forming hydatid cysts in the intestine and internal organs. The definitive hosts ingest the cysts through the consumption of infected intermediate hosts. Humans are infected in the same way as intermediate hosts or via direct contact with animal hosts (Dowling et al., 2000; Thompson and McManus, 2002).

With a total population of approximately 13,444,435, small ruminants, cattle, and camels are the predominant farm animal species in Saudi Arabia that are used to produce red meat. Sheep comprise the majority of the livestock (72%) and are imported in considerable numbers from Middle Eastern and African nations where CE is a serious problem (GASTAT, 2021). Consequently, there is a substantial risk of infected animals being brought into the country. The Echinococcus parasites have been reported to leak into resident circulation as a result of large-scale parasite importation via cattle (El-Ghareeb et al., 2017; Toulah et al., 2017; Fdaladdin et al., 2018). This is pertinent for E. granulosus sensu stricto (s.s.), which is responsible for most of the human CE cases globally (Alvarez Rojas et al., 2014).

According to estimates, hydatidosis causes annual economic losses of several billion dollars in the global livestock industry, including in the Kingdom of Saudi Arabia (KSA). These losses are the result of low productivity, for example in milk, meat, and wool, and the mortality and/or morbidity of diseased animals and the condemnation of infested tissues of slaughtered animals (Borji et al., 2012; Singh et al., 2014). Owing to the potential for human transmission, hydatidosis also has public health significance (El-Ghareeb et al., 2017).

Echinococcus granulosus s.l. has been explored through biological and molecular studies, and shows great variety in its infectivity, host range, and genetic traits (Eckert et al., 2001). Numerous strains (G1–G10) that comprise separate clades have been found (Nakao et al., 2007; Nakao et al., 2013). On the other hand, E. equinus (G4) and E. ortleppi (G5) are proposed as the new taxonomic designations for G1–G3 (Ito et al., 2007), whereas G6–G10 are categorized as E. canadensis (Ito et al., 2007). According to Carmen and Cardona (2014) and Eslami et al. (2016), these varied strains exhibit variations in lifecycle patterns, host specificity, geographic distribution, pathogenesis, transmission dynamics, and sensitivity to chemotherapy. G1, which is a sheep-specific strain, is frequently linked to infections in humans (Farhadi et al., 2015). The presence of 10 genotypes is reinforced by mitochondrial DNA analysis, with G1–G2 representing ovine strains, G3–G5 representing bovine strains, G4 representing an equine strain, G6 representing a camel strain, and G7–G10 representing pig and cervid strains (Cardona and Carmena, 2013). The G1 sheep genotype is associated with human cases (Latif et al., 2010), and E. felidis in the E. granulosus complex (Thompson and McManus, 2002; Nakao et al., 2013).

The creation and implementation of prevention and control measures, diagnostic tests, and development of effective therapeutics are all significantly impacted by the identification and characterization of species of the genus Echinococcus (McManus, 2010). Advances in control measures, suggestive testing, and treatment choices can be facilitated by enhancing our understanding of species of the genus Echinococcus through improved characterization (McManus and Thompson, 2003). In addition, research on genetic variation in E. granulosus paves the way for the creation of disease management methods that are more successful, especially in endemic regions. This includes investigating vaccine resistance and examining progressive DNA vaccination utilizing recombinant DNA technology (Amini-Bavil-Olyaee et al., 2006).

According to Sadjjadi (2006), CE is a severe public health issue across Arabic North Africa and the Middle East. The frequency of the G1 and G6 strains (E. granulosus s.s. and E. canadensis, respectively) has been shown by molecular research on E. granulosus s.l. from different final and intermediate hosts in Africa (Abushhewa et al., 2010; Ibrahim et al., 2011). In several regions of KSA, this zoonosis continues to have an impact on cattle (Haroun et al., 2008; Ibrahim, 2010; Toulah et al., 2012). Only the isolation of E. granulosus s.s. from sheep and camels allowed for the genetic identification of the accountable species of the genus Echinococcus in KSA (Al-Mutairi et al., 2020).

Epidemiological research on E. granulosus s.l. in KSA is limited, with most published studies concentrating on the prevalence over seasons and the level of fertility of hydatid cysts collected from animals (Ibrahim, 2010; Fdaladdin et al., 2018; Hayajneh et al., 2014; Almalki et al., 2017; Amer et al., 2018). The genetic variation in E. granulosus in KSA has received little attention (Abdel-Baki et al., 2018; Metwally et al., 2018).

The goal of this study was to increase knowledge about the identity of E. granulosus s.l. cysts found in sheep in KSA and Egypt. To achieve this aim, partial mitochondrial NADH dehydrogenase 1 (NAD1), cytochrome C oxidase subunit 1 (COX1), and nuclear actin II (ACT II) gene sequences were analyzed using PCR amplification. To the best of our knowledge, this is the first attempt to detect and compare circulating sheep genetic strains of E. granulosus s.l. from the two countries.

Materials and Methods

This research used sheep in four slaughterhouses in the northern Saudi Arabian province of Al-Jouf. Over the course of a year, from January 2022 to December 2022, 153225 sheep that had been killed were evaluated for cystic hydatidosis. According to recommendations made by the World Health Organization, the Food and Agriculture Organization of the United Nations, and the United Nations Environment Programme (WHO/FAO/UNEP) (WHO/FAO/UNEP, 1994), animals that had been killed were inspected by visual examination and palpation for hydatid cysts in their organs.

For the Egyptian samples, hydatid cysts that had previously been identified from sheep at a slaughterhouse in the Egyptian governorates of Cairo and Giza were employed.

Sampling

One hundred sheep-derived hydatid cysts were selected for PCR testing using a simple random sampling method. A computer-generated list of 100 random numbers was used to ensure equal chances of selection from the total cyst population. Thereafter, the selected cysts were rinsed with a physiological saline solution. The external surface underwent sterilization, and the hydatid fluid was examined under a microscope to determine cyst fertility based on the presence or absence of protoscolices. Each sample yielded protoscolices from a single cyst, which were then placed into sterile test tubes, preserved in 70% ethanol, and stored at −20°C for DNA extraction.

Extraction of DNA

DNA extraction from 25 mg sediment of protoscolices from each hydatid cyst sample was performed following the manufacturer’s instructions with slight modifications. The commercially available DNeasy Blood & Tissue Kit (Qiagen Inc., Germany) was utilized for DNA extraction, as previously described (Alvi et al., 2023).

PCR amplification

A 25-µl reaction mixture comprising 12.5 µl of 2 × MyTaq™ Red Mix (Cat. BIO-25043, Meridian Life Science Inc., USA), 0.5 µl of each primer (10 µM), 10 µl nuclease-free water, and 2 µl of target DNA was used to amplify the genes COX1, NAD1, and ACT II. In addition, positive and negative controls were incorporated into the PCR assay. Positive control DNAs for three genes (COX1, NAD1, and ACT II) previously identified were obtained from the National Research Centre (NRC) in Cairo, Egypt. Negative controls lacking DNA were also included. PCR primers and conditions are shown in Tables 1 and 2, respectively. The PCR results were inspected using the InGenius3 gel documentation system (Syngene, UK), 1.5% agarose gel electrophoresis, ethidium bromide staining, and the 100 bp marker plus.

Table 1. PCR primers and probes used in the study.

Gene	Sequence (5′–3′)	Amplicon size (bp)	Reference
COX1	TTTTTTGGGCATCCTGAGGTTTAT TAAAGAAAGAACATAATGAAAATG	450	Bowles et al., 1992
NAD1	AGATTCGTAAGGGGCCTAATA ACCACTAACTAATTCACTTTC	550	Bowles and McManus, 1993
ACT II	GTCTTCCCCTCTATCGTGGG CTAATGAAATTAGTGCTTTGTGCGC	266	da Silva et al., 1993

Table 2. Cycling conditions for the detection of genes in this study.

Gene	Initial denaturation	Denaturation	Annealing	Extension	Final extension	Cycles
Cox1	95°C 5 minutes	95°C 20 seconds	55°C 30 seconds	72°C 45 seconds	72°C 10 minutes	40
nad1	95°C 5 minutes	95°C 30 seconds	51°C 30 seconds	72 °C 45 seconds	72°C 10 minutes	40
actII	95°C 5 minutes	95°C 20 seconds	60°C 30 seconds	72°C 75 seconds	72°C 10 minutes	40

DNA analysis and phylogenetic tree reconstruction

A GeneJETTM Gel Extraction Kit (K0691, Thermo Fisher Scientific, USA) was used to clean 30 of the positive PCR products from each of the KSA and Egyptian isolates (15 from KSA and 15 from Egypt) that targeted the COX1, NAD1, and ACT II genes. Sequencing was performed by Macrogen Company (Korea). Two-way sequencing using the specific primers used in PCR (NL1401, Vivantis Co, Malaysia) served as a confirmation of the accuracy of the data. The programs BioEdit 7.0.4.1 and MUSCLE were used to examine the acquired nucleotide sequences. Using the neighbor-joining technique in the application of CLC 6, the obtained sequences were aligned with reference sequences for the three genes of species of the genus Echinococcus available in the GenBank database (Tables 3–5).

Table 3. Cox1 gene sequences from the GenBank database used for phylogenetic tree reconstruction.

GenBank accession no.	Species	Host	Country	Genotype
AB921054	E. granulosus	Camel	Egypt	G1
AB921090	E. granulosus	Sheep	Egypt	G1
DQ341566	E. granulosus	Sheep	Algeria	G1
AB921055	E. ortleppi	Camel	Egypt	G5
AB921058	E. canadensis	Camel	Egypt	G6
HM636639	E. granulosus	Cattle	Libya	G1–3
HM636641	E. granulosus	Human	Libya	G1–3 (G1)
FJ796205	E. granulosus	Cattle, camel	Iran	G1–3 (G1)
HQ717150	E. granulosus	Cattle	Turkey	G1–3 (G1)
HQ717148	E. granulosus	Human	Turkey	G1–3 (G1)
KF612390	E. granulosus	Human	Iran	G1
DQ856467	E. granulosus	Sheep	Greece	G1
M84662	E. granulosus	Sheep	Australia	G2
DQ341574	E. granulosus	Sheep	Algeria	G2
FJ796206	E. granulosus	Camel	Iran	G1–3 (G3)
M84663	E. granulosus	Buffalo	Iran	G3
KF612397	E. granulosus	Human	Iran	G3
DQ856466	E. granulosus	Sheep	Greece	G3
M84664	E. granulosus	Horse	India	G4
M84665	E. granulosus	Cattle	Netherlands	G5
FJ796207	E. granulosus	Camel	Iran	G6–10 (G6)
M84666	E. granulosus	Camel	Africa	G6
DQ341581	E. canadensis	camel	Algeria	G6
HM636638	E. granulosus	Cattle, camel	Libya	G6
KF612400	E. granulosus	Human	Iran	G6
HQ717155	E. canadensis	Human	Turkey	G6–10 (G7)
DQ856468	E. canadensis	Goat	Greece	G7
AB235848	E. canadensis	Moose	USA	G8
AF525457	E. canadensis	Reindeer	Finland	G10
EF558356	E. felidis	Lion	Uganda
M84670	E. vogeli	Rodent	South Africa
M84668	E. multilocularis	Human	Alaska, China
M84669	E. multilocularis	Rodent	Germany
DQ341575	E. granulosus	Camel	Algeria	G2
DQ341568	E. granulosus	Camel	Algeria	G1
DQ341567	E. granulosus	Sheep	Ethiopia	G1
MZ350810	E. granulosus	Sheep	Taif–Saudi Arabia
MW051127	E. granulosus	Camel	Saudi Arabia
MN720282	E. granulosus	Sheep	Al-Madinah–Saudi Arabia
MN720281	E. granulosus	Camel	Al-Madinah–Saudi Arabia

Table 5. Act II gene sequences from the GenBank database used for phylogenetic tree reconstruction.

GenBank accession no.	Species	Host	Country	Genotype
AB921019	E. granulosus	Camel	Egypt	G1
AB921052	E. granulosus	Sheep	Egypt	G1
AB921053	E. granulosus	Sheep	Egypt	G1
AF528498	E. granulosus	Human	Algeria	G1
AF528500	E. granulosus	Camel	Algeria	G6
DQ341545	E. granulosus	Sheep	Algeria	G1
DQ341548	E. granulosus	Cattle	Mauritania	G6

A total of 15 nucleotide sequences for the KSA isolates in this study were deposited in the GenBank database under the accession numbers OQ970593– OQ970597 for the COX1 gene, OQ844076–OQ844080 for the NAD1 gene, and OQ791975–OQ791979 for the ACT II gene.

Fifteen nucleotide sequences produced in this investigation for the Egyptian isolates were deposited in the GenBank database under the accession numbers OQ970598–OQ970602 for the COX1 gene, OQ844081–OQ844085 for the NAD1 gene, and OQ791980–OQ791984 for the ACT II gene.

Ethical approval

Not needed for this study.

Results

Over the course of a year, from January 2022 to December 2022, a total of 153225 sheep that were killed in four slaughterhouses in the Al-Jouf Province of northern Saudi Arabia were tested for cystic hydatidosis. Among the sheep that were investigated, the overall prevalence of cystic hydatidosis was 0.51% (784/153225).

Table 4. Nad1 gene sequences from the GenBank database used for phylogenetic tree reconstruction.

GenBank accession no.	Species	Host	Country	Genotype
AB921120	E. canadensis	Camel	Egypt	G6
AB921111	E. canadensis	Camel	Egypt	G6
AB921119	E. canadensis	Camel	Egypt	G6
AB921121	E. canadensis	Camel	Egypt	G6
DQ856471	E. canadensis	Goat	Greece	G7
AJ237638	E. canadensis	Pig	Poland	G7
AB921095	E. canadensis	Camel	Egypt	G6
KF612372	E. granulosus	Human	Iran	G6
HM636642	E. granulosus	Cattle	Libya	G6
FJ796216	E. granulosus	Camel	Iran	G6
HQ717154	E. granulosus	Human	Turkey	G7
AF525297	E. canadensis	Reindeer	Finland	G10
AB921092	E. ortleppi	Camel	Egypt	G5
AJ237636	E. ortleppi	Cattle	Netherlands	G5
AB921125	E. granulosus	Sheep	Egypt	G1
AB921091	E. granulosus	Camel	Egypt	G1
DQ856470	E. granulosus	Sheep	Greece	G1
FJ796214	E. granulosus	Camel	Iran	G3
KF612369	E. granulosus	Human	Iran	G3
HM636643	E. granulosus	Cattle	Libya
HM636644	E. granulosus	Human	Libya
FJ796208	E. granulosus	Sheep	Iran	G1
HQ717153	E. granulosus	Human	Turkey	G1
HQ717151	E. granulosus	Cattle	Turkey	G1
KF612360	E. granulosus	---	Iran	G1
KF612349	E. granulosus	---	Iran	G1
DQ856469	E. granulosus	Sheep	Greece	G3
AJ237634	E. granulosus	Buffalo	India	G3
AJ237633	E. granulosus	Sheep	---	G2
AB208064	E. shiquicus	Ochotona curzoniae	China
AB235848	E. canadensis	---	Japan	G8
NC011121	E. canadensis	Camel	Kazakhstan	G6
AF297617	E. granulosus	---	China	G1
AJ237639	E. multilocularis	---	---
AJ237640	E. multilocularis	Rodents	Germany
AJ237642	E. oligarthrus	---	Panama
AJ237641	E. vogeli	---	---
EF558357	E. felidis	African lion	---
NC009938	T. saginata	---	---
AJ237635	E. equinus	Horse	India	G4
AJ237637	E. canadensis	Camel	---	G6
AB921105	E. canadensis	Camel	Egypt	G6

Amplification of act II, nad1, and cox1 genes

Fragments of approximately 450, 550, and 266 bp were amplified using PCR on sheep cyst DNA samples to target the COX1, NAD1, and ACT II genes, respectively. Of the 100 samples tested, 95%, 100%, and 52% were positive for these genes, respectively, but only 24% of samples were positive for all three genes.

Phylogenetic analysis

Targeting the COX1 gene, all the selected KSA hydatid cyst isolates from sheep (GenBank accession numbers OQ970593–OQ970597) showed high sequence similarity with E. granulosus s.s. G1 isolated from sheep and camels (AB921090 and AB921054, respectively) in Egypt, humans (HM636641) in Libya, and cattle in Turkey (HQ717150) (Fig. 1).

Fig. 1. Neighbor-joining phylogenetic tree of representative COX1 nucleotide sequences of E. granulosus isolates (OQ970593–OQ970602) and reference sequences. GenBank accession numbers are shown in parentheses.

On the contrary, all COX1 sequences of the Egyptian isolates from sheep (OQ970598–OQ970602) exhibited high similarity with E. canadensis genotype G6 isolated from camels in Africa (M84666), camels and cattle (HM636638) in Libya, and humans (KF612400) in Iran (Fig. 1).

Concerning the NAD1 gene, both the KSA hydatid cyst isolates (OQ844076–OQ844080) and the Egyptian isolates (OQ844081–OQ844085) showed high sequence similarity with E. granulosus s.s. genotype G1 isolated from sheep and camels (AB921125 and AB921091, respectively) in Egypt and sheep (DQ856470) in Greece (Fig. 2).

Fig. 2. Neighbor-joining phylogenetic tree of representative NAD1 nucleotide sequences of E. granulosus isolates (OQ844076–OQ844085) and reference sequences. GenBank accession numbers are shown in parentheses.

Regarding the ACT II gene, both the KSA hydatid cyst isolates (OQ791975–OQ791979) and the Egyptian isolates (OQ791980–OQ791984) showed high sequence similarity with E. granulosus s.s. genotype G1 isolated from sheep (AB921052 and DQ341545) in Egypt and Algeria, respectively (Fig. 3).

Fig. 3. Neighbor-joining phylogenetic tree of representative ACT II nucleotide sequences of E. granulosus isolates (OQ791975–OQ791984) and reference sequences. GenBank accession numbers are shown in parentheses.

Discussion

The inclusion of CE in the WHO’s strategy to battle neglected diseases reflects the significance of this disease for both public health and economic stability. According to Eckert et al. (2001) and Almalki et al. (2017), this zoonotic infection caused by Echinococcus granulosus, is a public health concern in many areas, especially among populations that keep sheep, like those in KSA. In intermediate hosts and humans, the illness is frequently asymptomatic for a long time (Alsulami, 2019).

Hydatid disease is endemic in KSA, with dogs having a significant role in the distribution and transmission of the disease, particularly in rural regions (Almalki et al., 2017). Studies conducted in KSA have emphasized the direct causes of human infection, such as the domestic slaughter of sheep and camels (Al-Malki and Degheidy, 2013; Toulah et al., 2017;). Similar circumstances exist in Egypt for the development of the dog–livestock cycle for the spread of species of the genus Echinococcus. Because dogs are frequently utilized as guard dogs on livestock farms, there is a high infection rate of Echinococcus among homeless dogs in Egypt and frequent animal–dog contact. Dogs can also access slaughterhouses and eat the offal of dead animals, leading to infection (Mazyad et al., 2007).

Meanwhile, Hayajneh et al. (2014) conducted an abattoir survey of sheep and goats in KSA and attributed the deviations in the prevalence of hydatidosis to variations in the sheep strain and differences in the quantity, age, and source of the tested sheep within and outside KSA, as well as cultural variations, community activities, and the availability of dogs.

In this study, we compared the genetic characteristics of hydatid cysts carried by sheep in KSA with those that were recovered from sheep in Egypt. Our results from PCR assays targeting the COX1, NAD1, and ACT II genes in hydatid cyst DNA samples from sheep in KSA and Egypt were congruent with the findings of Barazesh et al. (2019), who compared the genotypic diversity of E. granulosus isolates from livestock in Turkey and Iran.

Mitochondrial DNA (mtDNA) sequencing has been effective for the molecular characterization and identification of taeniid tapeworms, notably at the COX1 and NAD1 loci (Heidari et al., 2019). For phylogenetic research and the evolution of helminth parasites to detect intraspecific and/or interspecific variation, the COX1 gene represents the most prevalent mtDNA gene (Paoletti et al., 2019). The mitochondrial COX1 gene is ideal for identifying genetic variation because the evolutionary change rate of this gene is fast enough to differentiate between various species while remaining slow enough for the same species. Therefore, to create DNA barcodes and differentiate between different species of helminths in the current investigation, the mitochondrial COX1 gene was selected (Gunyakti Kilinc et al., 2020).

Through targeting the COX1 gene, all the KSA hydatid cyst isolates from sheep (GenBank accession numbers OQ970593–OQ970597) demonstrated high sequence similarity with the genotype G1 of E. granulosus s.s. isolated from sheep and camels (AB921090 and AB921054, respectively) in Egypt, humans (HM636641) in Libya, and cattle in Turkey (HQ717150). Moreover, our results show a substantial degree of resemblance for both sequences from KSA and Egypt with E. granulosus COX1 recovered from sheep in Taif, KSA (MZ345697) in a previous study by Al Malki and Hussien (2021). These authors, who also used the COX1 gene sequence for molecular characterization of E. granulosus isolated from hydatid cysts in sheep in Taif, KSA, found nucleotide diversity between their isolates and those in the GenBank database that was collected from other countries. BLAST analysis revealed that one of the Taif sheep isolates exhibited the highest sequence alignment identity with E. granulosus from Palestinian dog feces (95.67%) and lower sequence identities of 84%–85% with isolates from camels and humans in Egypt, cattle in Turkey, and camels, sheep, and goats in Iran.

Our findings are consistent with those of Metwally et al. (2018) in Riyadh (KSA), who reported that sequencing of the cox1 gene confirmed the presence of E. granulosus s.s. (genotypes G1–G3) in 16 out of 17 sheep cysts and 2 out of 27 camel cysts. Moreover, the findings of this study concur with those of Al-Mutairi et al. (2020) in Al-Madinah (KSA), who recognized the native sheep cysts as being caused by E. granulosus s.s. (G1–G3 complex) owing to their striking resemblance to human cases in Turkey and Iran. For example, the alignment of the KSA hydatid cyst isolate (OQ970593) in this study showed high identity with the isolate of E. granulosus (MN720282) in Al-Madinah (KSA). All E. granulosus s.s. isolates, including those from camels killed in abattoirs in Al-Ahsa (KSA) were related to the G1 cluster, despite the fact that the G3 genotype had previously been described from the Middle East by Al-Hizab et al. (2018). Accordingly, among animal isolates in KSA, the G1–G3 cryptic species are more common.

Similar trends with different G1 and G3 fractions have been described in other studies. For example, in a Tunisian study of 30 cysts from sheep, cattle, and humans, G1 constituted 93.3% of these CE cases and G3 constituted 6.7% of isolates (M'rad et al., 2010); in a Turkish study of 112 sheep and cattle, 95.5% and 4.5% of CE were G1 and G3, respectively (Vural et al., 2008); and in a study performed on animals in southeastern Iran, 73.7% and 13.2% of CE cases were G1 and G3, respectively (de la Rue et al., 2011).

G1 is also the common genotype in different hosts in Palestine (Adwan et al., 2013), Ethiopia (Hailemariam et al., 2012), India (Sharma et al., 2013), Tunisia (Farjallah et al., 2007), China (Yan et al., 2013), and Iran (Rostami Nejad et al., 2012; Pezeshki et al., 2013; Nikmanesh et al., 2014). Furthermore, in several Latin American and European nations, E. granulosus s.s. (G1–G3 complex) is the predominant genotype in humans, sheep, goats, and cattle (Beato et al., 2010; Piccoli et al., 2013).

No G6 isolates were found among the KSA isolates in our study; while the G6 genotype has been reported in different countries such as Egypt (Aaty et al., 2012), Sudan (Omer et al., 2010), Iran (Karamian et al., 2017; Mohaghegh et al., 2019), Turkey (Mehmood et al., 2020), and Argentina (Debiaggi et al., 2023). This finding was concordant with research conducted in KSA by Metwally et al. (2018). According to Omar et al. (2013), the one-humped camel performs a significant role in the epidemiology of Echinococcus and the camel genotype (G6) is the most dominant genotype of E. granulosus in Egypt. However, further research is necessary (Abdel-Aziz and El-Meghanawy, 2016). According to several studies, the G6 genotype is not thought to play a vital role in public health (Santivañez et al., 2008; Casulli et al., 2010), although it was recently reported that this genotype occurs more frequently than was indicated in earlier studies (M’Rad et al., 2005).

When DNA sequencing was used to target the Cox1 gene, all of the Egyptian sheep isolates in this study (OQ970598–OQ970602) revealed a high similarity with E. canadensis genotype G6 recovered from camels in Africa (M84666), camels and cattle in Libya (HM636638), and humans in Iran (KF612400). This finding is in line with those of Barghash et al. (2017), who confirmed the prevalence of E. canadensis G6 (camel strain) in sheep in Great Cairo, the West Delta, and Upper Egypt with the potential for human infection.

The prevalent genotype among humans, sheep, goats, cattle, and camels in Sudan is G6 (Ibrahim et al., 2011; Ahmed et al., 2013).

In summary, the results of this study suggest that humans and livestock animals may share the G6 genotype. This finding is congruent with those of Barghash et al. (2017), Azab et al. (2004), and Derbala (2004), who discovered that camel strain G6 was responsible for human instances of CE.

For nad1 sequencing, the KSA isolates (OQ844076–OQ844080) and the Egyptian isolates from hydatid cysts (OQ844081–OQ844085) revealed a high similarity with E. granulosus s.s. genotype G1 recovered from sheep and camels in Egypt (AB921125 and AB921091) and sheep in Greece (DQ856470). This agreed with the Cox1 gene sequencing studies stated above and the findings of Al-Hizab et al. (2018) in KSA, Abd El Baki et al. (2009), and Barghash et al. (2017) in Egypt, and Barazesh et al. (2019) in Iran, demonstrating that genotype G1 is widespread in humans, sheep, and camels.

G1 is the only genotype found exclusively in humans in Libya, with nearly no evidence of G1 in cattle (Abushhewa et al., 2010). Previous molecular studies in Iran on sequence variation in the nad1 and cox1 genes not only demonstrated the presence of G1 strains, but also G6 strains of E. granulosus in humans and several intermediate hosts such as sheep, camels, and cattle.

It is generally recognized that the E. granulosus sheep strain (G1) is the predominant species of the genus Echinococcus involved in human CE and that the camel strain (G6) also plays a role (Torgerson and Budke, 2003; Magambo et al., 2006). According to Barghash et al. (2017), the G1 strain of E. granulosus could infrequently infect sheep, goats, cattle, and occasionally camels in Upper Egypt and the West Delta, whereas the camel strain (G6) was dominant in the Great Cairo. Al-Hizab et al. (2018) reported work on native camels in the east of KSA targeting the nad1 gene sequence, and revealed that the mainstream belonged to E. granulosus s.s. and very few to E. canadensis G6/7. Our results demonstrate the high likelihood of movement of genotypes G1 and G6 between humans, camels, and sheep.

The act II gene sequences in the KSA hydatid cyst isolates (OQ791975–OQ791979) and the Egyptian isolates (OQ791980–OQ791984) revealed a significant degree of similarity with E. granulosus s.s. genotype G1 recovered from sheep in Egypt (AB921052) and Algeria (DQ341545), respectively.

Partial sequencing of the ACT II gene in sheep in KSA and Egypt has yielded limited data. Only Amer et al. (2015) in Egypt verified that three out of seven sheep cysts had the G6 genotype of E. canadensis, as demonstrated by direct sequencing of the ACT II gene; in contrast, four of seven cysts from sheep had the E. granulosus s.s. G1 genotype.

Conclusion

E. granulosus s.s. (G1) and E. canadensis (G6) were the genotypes with the greatest zoonotic significance in sheep in KSA and Egypt in this study. The determination of the precise genotypes present in sheep in our study provides vital data and paves the way for the implementation of effective preventive measures and therapeutic approaches in the many animal populations impacted by CE. The epidemiology of the isolates in KSA and Egypt can be determined with the use of further research, E. granulosus strain genotyping, and phylogeny. Having more data available will help public health authorities to better manage and prevent infection.

Conflict of interest

The authors declare no conflict of interest.

Funding

This work was supported by the Deanship of Scientific Research at Jouf University [grant number 39/825].

Data availability

The data of the current study are available.