Abstract
Background
Esculentin-1, initially discovered in the skin secretions of pool frogs (Pelophylax lessonae), has demonstrated broad-spectrum antimicrobial activity; however, its immunomodulatory properties have received little attention.
Results
In the present study, esculentin-1 cDNA was identified by analysing the skin transcriptome of the dark-spotted frog (Pelophylax nigromaculatus). Esculentin-1 from this species (esculentin-1PN) encompasses a signal peptide, an acidic spacer peptide, and a mature peptide. Sequence alignments with other amphibian esculentins-1 demonstrated conservation of the peptide, and phylogenetic tree analysis revealed its closest genetic affinity to esculentin-1P, derived from the Fukien gold-striped pond frog (Pelophylax fukienensis). Esculentin-1PN transcripts were observed in various tissues, with the skin exhibiting the highest mRNA levels. Synthetic esculentin-1PN demonstrated antibacterial activity against various pathogens, and esculentin-1PN exhibited bactericidal activity by disrupting cell membrane integrity and hydrolyzing genomic DNA. Esculentin-1PN did not stimulate chemotaxis in RAW264.7, a murine leukemic monocyte/macrophage cell line. However, it amplified the respiratory burst and augmented the pro-inflammatory cytokine gene (TNF-α and IL-1β) expression in RAW264.7 cells.
Conclusions
This novel finding highlights the immunomodulatory activity of esculentin-1PN on immune cells.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12917-024-04013-y.
Keywords: Antimicrobial peptides, Esculentin-1, Antibacterial activity, Immunoregulatory activity, Dark-spotted frog
Background
Antimicrobial peptides (AMPs) are a ubiquitous group of peptides found in diverse plant and animal species. They serve as crucial components of the immune response against a spectrum of pathogenic microorganisms, including bacteria, parasites, fungi, and viruses [1]. These peptides, which are characterised by their short length, cationic charge, and amphiphilic nature, confer host protection through direct interactions with bacterial membrane-associated proteins, resulting in membrane disruption and subsequent bacterial death [2, 3]. Besides their antimicrobial activity, recent studies have elucidated the immunomodulatory properties of AMPs [4].
The dermal glands of amphibians belong to the genus Rana, a widely distributed group in the Ranidae family. They contain an abundance of AMPs [5], which are synthesised by the serous dermal glands and stored within granules alongside various other pharmacologically active peptides. Upon experiencing stress or physical injury, these granules are released onto the skin surface via holocrine secretion [6–10]. Notably, each frog species produces its own distinct repertoire of AMPs [11]. Based on their structural similarities, amphibian AMPs are categorised into various families, such as magainins, brevinins, ranacyclins, and esculentins [12].
Esculentin-1 was initially discovered in the skin secretion of pool frogs (Pelophylax lessonae) [13]. It was subsequently isolated from closely related species, such as Yunnanfu frog (Odorrana grahami) [14], Ishikawa’s frog (Odorrana ishikawae) [15], Sahara frog (Pelophylax saharicus) [16], crawfish frog (Rana areolata) [17], Florida gopher frog (Lithobates capito) [18], and Warszewitsch’s Frog (Lithobates warszewitschii) [18]. Other esculentin-1 peptides were identified using cDNA libraries derived from frog skin [19, 20]. There are 46 amino acids in esculetin-1, which belongs to a peptide class with a highly conserved amino acid sequence. In these peptides, the C-terminal loop is stabilized by a disulfide bridge, forming a heptapeptide ring [21, 22].
Esculentin-1 has two homologous counterparts, esculentin-1a and esculentin-1b, which demonstrate a sole discrepancy in amino acid composition at position 11 within their respective sequences [21]. In recent years, Esc(1–21) and Esc(1–18), which correspond to the initial 20 and 18 amino acids of native esculentin-1a and -1b, respectively, have been synthesised and demonstrated to possess a broad range of bactericidal activities [23, 24] against various bacterial strains, including Staphylococcus aureus, Enterococcus faecalis, Escherichia coli, and Enterobacter cloacae [20, 25–32]. Despite the antimicrobial activity of esculentin-1, it also exhibits insulinotropic and β-cell protective activities [33]. However, the immunomodulatory activity of esculentin-1 remains under-studied and requires further research.
The dark-spotted frog (Pelophylax nigromaculatus), a semi-aquatic pond species indigenous to East Asia, was effectively propagated using an artificial diet. Consequently, dark-spotted frogs have been extensively cultivated for human consumption in China, with official government authorization. Regrettably, substantial economic losses were incurred owing to bacterial infections [34]. Acknowledging the significance of AMPs in the innate immune response, this study aimed to identify a counterpart of the dark-spotted frog esculentin-1 (esculentin-1PN) and explore the antibacterial and immunoregulatory activities of its mature peptide.
Results
Identification and characterisation of esculentin-1PN
The gene encoding the esculentin-1PN protein in dark-spotted frogs was successfully cloned, and its sequence was deposited in the GenBank Database (OR238914). The identified open reading frame within the esculentin-1PN gene spans 255 nucleotides and encodes 84 amino acids. The predicted molecular weight of this polypeptide is 9.16 kDa, with a theoretical isoelectric point (pI) of 8.84. The protein exhibits several characteristic structural features, including a putative signal peptide, an acidic spacer peptide, and a mature peptide. The signal peptide serves to guide the mature peptide to the extracellular compartment, while the acidic spacer peptide lacks a defined function. The mature peptide is predicted to have a molecular weight of 4.80 kDa, a pI of 9.63, and two conserved cysteine residues capable of forming a single pair of disulfide bonds (Fig. 1). The structure of the mature peptide is dominated by the alpha helices (Fig. 2).
Fig. 1.
Multiple alignment of esculentin-1PN’s amino acid sequences and homologs. The threshold for shading was 70%; similar residues are marked with a grey shadow, identical residues with a black shadow, and alignment gaps with “-.” The alignment was accompanied by labels indicating the signal peptide, acidic spacer peptide, and mature peptide. An arrow (↓) marks the predicted cleavage site for either the signal peptide or the mature peptide. The KR-propeptide convertase processing site is enclosed within a red box. The presence of two conserved cysteine residues in the mature peptide is indicated by an asterisk (“*”)
Fig. 2.
The structural model of esculentin-1PN. Molecular modelling was performed using SWISS-MODEL with the structure of esculentin-1b (PDB accession No. P84841.1.A) as the model. The disulfide bonds are denoted by the symbol -s–s-
Phylogenetic tree analysis revealed that esculentin-1PN belonged to the Pelophylax esculentin-1 cluster and was most closely related to esculentin-1P derived from the Fukien gold-striped pond frog (Pelophylax fukienensis) (Fig. 3).
Fig. 3.
Phylogenetic reconstruction of esculentin-1’s amino acid sequences based on the neighbour-joining method. The values displayed at the forks represent the percentage of trees in which this particular grouping was observed after bootstrapping (1000 replicates), with values shown only when they exceed 60%
Constitutive expression of the esculentin-1PN gene
Constitutive expression of the esculentin-1PN gene was identified in all the dark-spotted frog tissues examined. The skin exhibited the highest expression level, followed by muscle, while the remaining tissues displayed comparatively lower expression levels (Fig. 4).
Fig. 4.

Constitutive expression of esculentin-1PN in various tissues of a dark-spotted frog, evaluated using qPCR. Expression levels of esculentin-1PN transcripts were standardised against the PnGAPDH gene. Data are presented as mean ± SEM (n = 4). Letters indicate significant differences as determined by one-way ANOVA (P < 0.05)
Esculentin-1PN’s antibacterial activity
Esculentin-1PN exhibited varying levels of antibacterial activity, with the strongest antibacterial activity (minimal inhibitory concentration (MIC) = 6.25 μg/mL) observed against V. anguillarum, E. coli, and S. saprophyticus. The MIC of esculentin-1PN was 12.5 μg/mL against C. freundii, 25 μg/mL against V. harveyi, V. alginolyticus, and P. aeruginosa, and 50 μg/mL against S. flexneri and L. monocytogenes. The peptide did not exhibit any significant bactericidal activity against A. hydrophila, P. mirabilis, or S. warneri, as indicated in Table 1.
Table 1.
Minimal inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) values for esculentin-1PN against bacteria
| Bacteria | Isolate/strain | MIC (μg/mL) | MBC (μg/mL) |
|---|---|---|---|
| gram-negative | |||
| Vibrio harveyi | ATCC33866 | 25 | 200 |
| Vibrio alginolyticus | ATCC17749 | 25 | 50 |
| Vibrio anguillarum | ATCC19264 | 6.25 | 200 |
| Escherichia coli | K12 | 6.25 | 50 |
| Citrobacter freundii | ATCC43864 | 12.5 | 25 |
| Shigella flexneri | ATCC12022 | 50 | 100 |
| Pseudomonas aeruginosa | ATCC27853 | 25 | 100 |
| Aeromonas hydrophila | ATCC7966 | NT | NT |
| Proteus mirabilis | ATCC25933 | NT | NT |
| gram-positive | |||
| Staphylococcus saprophyticus | ATCC49907 | 6.25 | 25 |
| Staphylococcus warneri | ATCC49454 | NT | NT |
| Listeria monocytogenes | ATCC19115 | 50 | 100 |
NT no inhibition was detected at 100 μg/mL
Impact of esculentin-1PN on Escherichia coli cell membrane integrity and gDNA
The LDH assay demonstrated that esculentin-1PN had a deleterious effect on the integrity of the E. coli cell membrane. The most significant effect was observed at a concentration of 100 μg/mL, leading to a 3.53-fold increase in LDH release when compared to the control group (Fig. 5A). In Fig. 5B, it was observed through electrophoresis that there was a progressive decline in the intensity of gDNA bands, which was dependent on the concentration of esculentin-1PN.
Fig. 5.
Impact of esculentin-1PN on the integrity of Escherichia coli’s cell membrane and genomic DNA. A Impact of esculentin-1PN on the integrity of the E. coli cell membrane. BSA was employed as a negative control. The release of lactate dehydrogenase (LDH) was measured and expressed as the fold change compared with the negative control, which was assigned a value of 1. B The hydrolytic activity of esculentin-1PN on the bacterial genomic DNA was assessed through electrophoresis. BSA was employed as a negative control. The data presented here represent the mean ± SEM (n = 4). Statistical analysis was performed using a one-way ANOVA. *P value < 0.05
Effect of esculentin-1PN on RAW264.7 cell chemotaxis and respiratory burst
The chemotaxis assay revealed that the percentage of RAW264.7 cell migration in the esculentin-1PN treatment group did not differ significantly from that in the BSA treatment group. This suggests that esculentin-1PN failed to induce chemotaxis in RAW264.7 cells (Fig. 6A). The effect of esculentin-1PN on respiratory burst in RAW264.7 cells was also investigated. The OD620 values recorded in the 1.0 and 10.0 μg/mL esculentin-1PN groups were 0.70 ± 0.02 and 0.85 ± 0.03, respectively, while the OD620 value observed in the BSA group was 0.51 ± 0.03. These findings provide evidence that esculentin-1PN significantly enhanced respiratory burst in RAW264.7 cells (Fig. 6B).
Fig. 6.
Impact of esculentin-1PN on the chemotaxis and respiratory burst of RAW264.7 cells. A Effect of esculentin-1PN on the migration of RAW264.7 cells. B Effect of esculentin-1PN on RAW264.7 cell respiratory burst. The data is presented as the mean ± SEM (n = 4). *P value < 0.05
Effect of esculentin-1PN on inflammatory cytokine expression in RAW264.7 cells
To evaluate the regulatory impact of esculentin-1PN on the expression of inflammatory cytokines, RAW264.7 cells were stimulated with varying concentrations of esculentin-1PN. Subsequently, a notable increase in the expression levels of IL-1β and TNF-α was observed in RAW264.7 cells, particularly following treatment with 10.0 μg/mL of esculentin-1PN (Fig. 7A,B). Conversely, the expression of IL-10 and TGF-β remained unaltered after esculentin-1PN treatment (Fig. 7C,D).
Fig. 7.
Effect of esculentin-1PN on inflammatory cytokine expression in RAW264.7 cells. Expression levels of IL-1β (A), TNF-α (B), IL-10 (C), and TGF-β (D) transcripts were normalised to those of the 18S rRNA gene. BSA was used as a control. Data are expressed as mean ± SEM (n = 4). *P value < 0.05
Discussion
The conserved polypeptide esculentin-1, an amphibian AMP, was initially discovered in the skin secretions of pool frogs [13]. Extensive studies have been conducted on the antimicrobial properties of esculentin-1 in various amphibians [25–32]. However, knowledge of its immunoregulatory activity is limited. In this study, a cDNA encoding esculentin-1 was identified in the dark-spotted frogs, which comprises a signal peptide, an acidic spacer peptide, and a mature peptide. The C-terminal loop of the mature peptide is reinforced by a disulfide bridge, resulting in a heptapeptide ring. This structural characteristic is similar to that observed in other mature peptides of amphibian esculentin-1 [21, 22]. Both the esculentin-1PN precursor and the Fukien gold-striped pond frog esculentin-1P precursor were classified within the Pelophylax cluster. This identification offers crucial insights into the evolutionary connections between amphibian esculentin-1.
Esculentin-1 is constitutively expressed in the skin and other tissues of dark-spotted frogs. Amphibians have evolved various mechanisms to combat bacterial infections. One such mechanism involves the production of small compounds and peptides, such as esculentin-1, by the skin, which serve as a defence against pathogenic microorganisms [6, 35]. Previous studies have demonstrated that the mature esculentin-1 peptide, along with its two derivatives, Esc(1–21) and Esc(1–18), possess wide-ranging antimicrobial activity [20, 23–32]. Additionally, the combination of Esc(1–21) and colistin has been found to effectively inhibit growth and kill multidrug-resistant Acinetobacter baumannii strains [36]. Esculentin-1PN showed broad-spectrum antibacterial activities; it is most active against V. alginolyticus, V. anguillarum, and E. coli, as well as against V. harveyi, S. saprophyticus, P. aeruginosa, C. freundii, S. flexneri, and L. monocytogenes. Previous research has demonstrated that Esc(1–21) and Esc(1–18) possess the ability to disrupt the cell membranes of pathogenic bacteria [26, 27]. The findings from the LDH assay provide further evidence that esculentin-1PN can potentially impair bacterial cell membranes. Moreover, gDNA hydrolysis may play a role in its bactericidal mechanism, similar to other amphibian AMPs such as dark-spotted frog brevinin-2 [37], tiger frog (Hoplobatrachus rugulosus) cathelicidin [38], and Chong’an mustache toad (Leptobrachium liui) LEAP2 [39]. It is conceivable that the positively charged residues within esculentin-1PN facilitate the initial establishment of electrostatic interactions with the negatively charged DNA. Subsequently, there is a likelihood that a portion of esculentin-1PN gets inserted into the groove of the DNA molecule, thereby disrupting the double helix structure of bacterial gDNA and ultimately resulting in DNA strand breaks and degradation [40]. Nevertheless, the precise mechanism underlying DNA degradation remains to be further elucidated.
The immunomodulatory activity of esculentin-1 in amphibians requires further investigation. This study provides empirical evidence that esculentin-1PN does not exert any discernible influence on the chemotaxis of RAW264.7 cells. Nevertheless, it exerted a substantial dose-dependent enhancement of the respiratory burst of these cells. Leukocytes have been observed to effectively eliminate bacteria through phagocytosis, a process that involves the production of reactive oxygen species (ROS) and reactive nitrogen species (RNS). A respiratory burst, which signifies the oxygen-dependent eradication of bacteria, is a direct consequence of this phenomenon [41]. Notably, cathelicidin isolated from the tiger frog (Hoplobatrachus rugulosus) has been documented to exhibit immunomodulatory properties, notably augmenting the respiratory burst [38]. Upon activation by IFN-γ, murine macrophages exhibit heightened production of ROS and RNS, leading to the direct eradication of intracellular bacteria [42]. Furthermore, the increased levels of ROS and RNS in neutrophils serve as regulators, influencing the expression of essential cytokines and chemokines that significantly impact immune cell functions such as phagocytosis, bacterial clearance, and apoptosis [43]. The cytokine TNF-α is widely acknowledged as a key regulator in the control of ROS and RNS signaling, influencing the behavior of innate immune cells in both normal and inflammatory states [44]. Esculentin-1PN, due to its ability to stimulate respiratory burst, is hypothesised to impact ROS/RNS levels and thereby modulate the activities of RAW264.7 cells. Pro-inflammatory cytokines like TNF-α, IFN-γ, and IL-1β are crucial in initiating the innate immune response, with changes in their expression patterns in RAW264.7 cells serving as markers of cellular activation [45]. In the present study, treatment with esculentin-1PN enhanced TNF-α and IL-1β gene expression in RAW264.7 cells, indicating its potential role in stimulating monocytes/macrophages. Our results are consistent with previous findings that Chinese spiny frog β-defensin acts on RAW264.7 cells to upregulate the expression of TNF-α and IL-1β genes [46].
Conclusion
In this study, we characterised an amphibian esculentin-1 gene derived from a dark-spotted frog. The chemically synthesised mature peptide, esculentin-1PN, demonstrated antibacterial activity against multiple bacterial strains. Additionally, esculentin-1PN exhibited noteworthy immunomodulatory activities by augmenting the respiratory burst and inducing expression of TNF-α and IL-1β in RAW264.7 cells. Nevertheless, additional research is warranted to comprehensively elucidate the underlying mechanisms.
Methods
Animals
The collection of all samples was conducted with due permission in compliance with the local license. The methods employed were executed in adherence to the pertinent guidelines and regulations stipulated in the ethics approval and consent to participate section, as well as with the endorsement of the Ethics Committee of Lishui University (Permit No. AREC-LSU202302–008) and ARRIVE guidelines.
Dark-spotted frogs weighing 80–100 g were procured from a farm in Lishui, China. These frogs were housed in 100-L tanks maintained at a temperature range of 23–25 °C. Before being utilised in the study, they were subjected to a commercial diet twice daily and allowed to acclimatise to laboratory conditions for 2 weeks. Experimental animals were managed according to China’s Experimental Animal Management Law, and Lishui University’s Ethics Committee approved all experiments.
Esculentin-1PN cDNA sequencing analyses
The cDNA sequence of esculentin-1PN was obtained from the transcriptome data of the frog skin transcriptome. Specific primers were designed based on sequences in the 5’- and 3’-untranslated regions (UTR) and used for PCR amplification of the complete coding region using a mixed tissue cDNA s’ obtained with other known sequences was assessed via BLAST searches (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Molecular masses and theoretical isoelectric points were determined using ProtParam (https://web.expasy.org/protparam/). The presence of a signal peptide was assessed using SignalP-5.0 (https://services.healthtech.dtu.dk/services/SignalP-5.0/). Multiple sequence alignments were performed using ClustalW (http://clustalw.ddbj.nig.ac.jp/). Three-dimensional (3D) models were generated with Swiss-Model (https://swissmodel.expasy.org/). Phylogenetic and molecular evolutionary analyses were performed using MEGA X.
Sample collection and RT-qPCR
All frogs were anaesthetised with 0.1 g/L tricaine methanesulphonate (MS-222) prior to dissection. Tissues, including the liver, heart, muscle, skin, spleen, kidney, lung, and gut, were obtained from four healthy dark-spotted frogs to analyse the expression levels of esculentin-1PN in these specific tissues.
Total RNA was extracted from the tissues using Beyozol (Beyotime, Shanghai, China). Subsequently, the PrimeScript RT reagent Kit (TaKaRa, Dalian, China) was used to synthesise first-strand cDNA. Gene-specific primers were designed based on esculentin-1PN and PnGAPDH sequences (Table 2). A qPCR assay was performed using the CFX96 real-time PCR detection system (Bio-Rad, Hercules, USA) with TB Green Premix Ex Taq (TaKaRa). The reaction mixture was incubated at 95°C for 5 min, followed by 40 amplification cycles of 30 s at 95°C, 30 s at 60°C, and 30 s at 72°C. The threshold cycle (Ct) for esculentin-1PN was normalised to PnGAPDH using the 2−ΔΔCt method [47].
Table 2.
Oligonucleotide primers sequences
| Gene | Primers | Sequence (5’-3’) | Accession number |
|---|---|---|---|
| Esculentin-1PN | esculentin-1-t( +) | TGATGAAGAAGAGGGAAGCGA | OR238914 |
| esculentin-1-t(-) | CAACCGGCAATGTCTATCCC | ||
| PnGAPDH | GAPDH-t( +) | ATCCCTGCTCTGAACGGAAA | FJ617544 |
| GAPDH-t(-) | ATTCCCTTCAGTGGTCCCTG | ||
| MmIL-1β | IL-1β-t( +) | AGAAGCTGTGGCAGCTA | NM_008361 |
| IL-1β-t(-) | TGAGGTGCTGATGTACCA | ||
| MmTNF-α | TNF-α-t( +) | GAACTGGCAGAAGAGGCACT | NM_013693 |
| TNF-α-t(-) | GGTCTGGGCCATAGAACTGA | ||
| MmIL10 | IL10-t( +) | GGTTGCCAAGCCTTATCGGA | NM_010548 |
| IL10-t(-) | ACCTGCTCCACTGCCTTGCT | ||
| MmTGF-β | TGF-β-t( +) | TCGCTTTGTACAACAGCACC | NM_011577 |
| TGF-β-t(-) | ACTGCTTCCCGAATGTCTGA | ||
| Mm18S rRNA | 18S rRNA-t( +) | TTTGTTGGTTTTCGGAACTGA | NR_003278 |
| 18S rRNA-t(-) | CGTTTATGGTCGGAACTACGA |
Antibacterial assay
The esculentin-1PN mature peptide (GIFSKLAGKKIKNLLISGLKNVGKEVGMDVVRTGIDIAGCKIKGEC), comprising one disulfide bond, was chemically synthesised with a purity > 90% using SynPeptide and an actual molecular weight of 4.80 kDa. The mature peptide was used in subsequent experiments. The antibacterial activity of esculentin-1PN was evaluated against a variety of bacteria, including Vibrio anguillarum, E. coli, Vibrio alginolyticus, Staphylococcus saprophyticus, Vibrio harveyi, Pseudomonas aeruginosa, Citrobacter freundii, Shigella flexneri, Aeromonas hydrophila, Proteus mirabilis, Staphylococcus warneri, and Listeria monocytogenes, using a modified two-fold microdilution method, as previously described [48]. The bacterial sedimentation absorbance at 600 nm was used to evaluate the percentage inhibition of bacterial growth. The antibacterial activity was determined by the MIC, which is described here as the lowest concentration of peptide causing an OD600 less than 50% of the growth control (MIC50) [49]. The MBC was determined at the end of the experiment by taking 20 µl of the sample from the well with no visible growth, followed by serial dilution and plating.
Lactate dehydrogenase (LDH) release assay
To assess the impact of esculentin-1PN on the integrity of bacterial cell membranes, we used an LDH Release Assay Kit (Beyotime) per the manufacturer’s instructions. E. coli cells, at a concentration of 1 × 109 CFUs, were exposed to esculentin-1PN at concentrations of 25, 50, and 100 μg/mL and subsequently incubated at a temperature of 37 °C for a duration of 2 h. Following centrifugation, the resulting supernatant was transferred to a 96-well plate. Each well received 60 μL of the LDH detection working solution and was then incubated at 25 °C for a period of 30 min. The absorbance was subsequently measured at a wavelength of 490 nm.
DNA degradation assay
The hydrolysis of E. coli (K12) genomic DNA (gDNA) by esculentin-1PN was assessed using established protocols [39]. First, gDNA was isolated and quantified from E. coli. The gDNA was then exposed to different esculentin-1PN concentrations (25, 50, and 100 μg/mL) and incubated for 30 min at 25 °C. Analyses were performed using a 1.0% agarose gel. gDNA was stained with 4S Green Plus Nucleic Acid Stain (Sangon, Shanghai, China), according to the instructions of the product.
Chemotaxis assay
Per previously established protocols, a chemotaxis assay was conducted in a 24-well transwell chamber (Corning, NY, USA) [50]. Briefly, esculentin-1PN was diluted in DMEM to concentrations of 0.1, 1.0, and 10.0 μg/mL. Subsequently, 600 μl of each diluted peptide was added to the transwell chamber, which was covered with a nitrocellulose filter membrane. Next, RAW264.7 cells, a mouse leukemic monocyte/macrophage cell line, were introduced into the upper chamber and incubated at 37 °C for 4 h. The migrated cells that reached the lower chamber were stained and quantified under a magnification of 40 × 10.
Respiratory burst assay
In RAW264.7 cells, the respiratory burst was determined by quantifying intracellular O2− levels using nitro blue tetrazolium (NBT) reduction tests [51]. Before experimentation, RAW264.7 cells were subjected to pretreatment with esculentin-1PN (0.1, 1.0, or 10.0 μg/mL) for a duration of 12 h. Subsequently, the cells were washed with PBS and exposed to 0.1 μg/mL PMA. NBT was introduced to each plate and incubated at a temperature of 24 °C for a period of 1 h. Methanol was added to stop the reaction, and the cells were then thoroughly washed and dried. A wavelength of 620 nm was used to measure the optical density of the dissolved formazan.
Inflammatory cytokine gene expression analysis in RAW264.7 cells
RAW264.7 cells were subjected to treatment with esculentin-1PN (0.1, 1.0, or 10.0 μg/mL) for a duration of 12 h. The cells were then collected, and their total RNA was extracted. The extracted RNA was then subjected to qPCR analysis following the methodology outlined in Sect. 2.3. Expression levels of IL-1β, TNF-α, TGF-β, and IL-10 were normalised to those of 18S rRNA.
Statistical analysis
The data are presented as mean ± SEM, except for the antibacterial assay. Statistical analysis was performed using SPSS version 13.0 (SPSS Inc., Chicago, USA) with a one-way ANOVA. Statistical significance was set at a P value < 0.05.
Supplementary Information
Acknowledgements
Not Applicable.
Abbreviations
- AMP
Antimicrobial peptide
- pI
Isoelectric point
- MIC
Minimal inhibitory concentration
- MBC
Minimum bactericidal concentration
- ROS
Reactive oxygen species
- RNS
Reactive nitrogen species
- UTR
Untranslated regions
- MS-222
Tricaine methanesulphonate
- Ct
Threshold cycle
- LDH
Lactate dehydrogenase
- gDNA
Genomic DNA
- NBT
Nitro blue tetrazolium
Authors’ contributions
J.C. and L.M.: conceptualization. J.C. and C.G.Y.: methodology. M.M.Z. and H.L.S.: software. J.C., G.J.Z., and G.H.D.: validation. L.W.: formal analysis. J.C. and L.M.: investigation. L.M. and Z.H.L.: resources. J.C.: data curation. J.C.: writing—original draft preparation. J.C., C.G.Y., M.M.Z., H.L.S., G.J.Z., G.H.D., L.W., Z.H.L., and L.M.: writing—review and editing. J.C. and L.W.: visualization. L.M.: supervision. L.M.: project administration. L.M. and Z.H.L.: funding acquisition. All authors contributed to the article and approved the submitted version.
Funding
This research was funded by the Key Research and Development Project of Lishui City (2021ZDYF09, 2020ZDYF07); the National Natural Science Foundation of China (32001243); the Scientific Research Project of Baishanzu National Park (2021KFLY01); and the Science and Technology Plan Project of Lishui City (2022SJZC006).
Availability of data and materials
The esculentin-1PN cDNA sequence was submitted to GenBank under accession number OR238914. The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
The collection of all samples was conducted with due permission in compliance with the local license. The methods employed were executed in adherence to the pertinent guidelines and regulations stipulated in the ethics approval and consent to participate section, as well as with the endorsement of the Ethics Committee of Lishui University and ARRIVE guidelines.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Jie Chen and Ci-Gang Yu contributed equally to this work.
References
- 1.Bin Hafeez A, Jiang X, Bergen PJ, Zhu Y. Antimicrobial Peptides: An Update on Classifications and Databases. Int J Mol Sci. 2021;22(21):11691. doi: 10.3390/ijms222111691. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Brogden KA. Antimicrobial peptides: pore formers or metabolic inhibitors in bacteria? Nat Rev Microbiol. 2005;3(3):238–250. doi: 10.1038/nrmicro1098. [DOI] [PubMed] [Google Scholar]
- 3.Hale JD, Hancock RE. Alternative mechanisms of action of cationic antimicrobial peptides on bacteria. Expert Rev Anti Infect Ther. 2007;5(6):951–959. doi: 10.1586/14787210.5.6.951. [DOI] [PubMed] [Google Scholar]
- 4.Drayton M, Deisinger JP, Ludwig KC, Raheem N, Müller A, Schneider T, Straus SK. Host Defense Peptides: Dual Antimicrobial and Immunomodulatory Action. Int J Mol Sci. 2021;22(20):11172. doi: 10.3390/ijms222011172. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Haslam IS, Roubos EW, Mangoni ML, Yoshizato K, Vaudry H, Kloepper JE, Pattwell DM, Maderson PF, Paus R. From frog integument to human skin: dermatological perspectives from frog skin biology. Biol Rev Camb Philos Soc. 2014;89(3):618–655. doi: 10.1111/brv.12072. [DOI] [PubMed] [Google Scholar]
- 6.Bevins CL, Zasloff M. Peptides from frog skin. Annu Rev Biochem. 1990;59(1):395–414. doi: 10.1146/annurev.bi.59.070190.002143. [DOI] [PubMed] [Google Scholar]
- 7.Mangoni ML, Miele R, Renda TG, Barra D, Simmaco M. The synthesis of antimicrobial peptides in the skin of Rana esculenta is stimulated by microorganisms. FASEB J. 2001;15(8):1431–1432. doi: 10.1096/fj.00-0695fje. [DOI] [PubMed] [Google Scholar]
- 8.Mangoni ML, Saugar JM, Dellisanti M, Barra D, Simmaco M, Rivas L. Temporins, small antimicrobial peptides with leishmanicidal activity. J Biol Chem. 2005;280(2):984–990. doi: 10.1074/jbc.M410795200. [DOI] [PubMed] [Google Scholar]
- 9.Simmaco M, Mignogna G, Barra D. Antimicrobial peptides from amphibian skin: what do they tell us? Biopolymers. 1998;47(6):435–450. doi: 10.1002/(SICI)1097-0282(1998)47:6<435::AID-BIP3>3.0.CO;2-8. [DOI] [PubMed] [Google Scholar]
- 10.Zasloff M. Mysteries that still remain. Biochim Biophys Acta. 2009;1788(8):1693–1694. doi: 10.1016/j.bbamem.2009.04.011. [DOI] [PubMed] [Google Scholar]
- 11.Tennessen JA, Blouin MS. Selection for antimicrobial peptide diversity in frogs leads to gene duplication and low allelic variation. J Mol Evol. 2007;65(5):605–615. doi: 10.1007/s00239-007-9045-5. [DOI] [PubMed] [Google Scholar]
- 12.Patocka J, Nepovimova E, Klimova B, Wu Q, Kuca K. Antimicrobial Peptides: Amphibian Host Defense Peptides. Curr Med Chem. 2019;26(32):5924–5946. doi: 10.2174/0929867325666180713125314. [DOI] [PubMed] [Google Scholar]
- 13.Conlon JM. Reflections on a systematic nomenclature for antimicrobial peptides from the skins of frogs of the family Ranidae. Peptides. 2008;29(10):1815–1819. doi: 10.1016/j.peptides.2008.05.029. [DOI] [PubMed] [Google Scholar]
- 14.Li J, Xu X, Xu C, Zhou W, Zhang K, Yu H, Zhang Y, Zheng Y, Rees HH, Lai R, et al. Anti-infection peptidomics of amphibian skin. Mol Cell Proteomics. 2007;6(5):882–894. doi: 10.1074/mcp.M600334-MCP200. [DOI] [PubMed] [Google Scholar]
- 15.Iwakoshi-Ukena E, Ukena K, Okimoto A, Soga M, Okada G, Sano N, Fujii T, Sugawara Y, Sumida M. Identification and characterization of antimicrobial peptides from the skin of the endangered frog Odorrana ishikawae. Peptides. 2011;32(4):670–676. doi: 10.1016/j.peptides.2010.12.013. [DOI] [PubMed] [Google Scholar]
- 16.Marenah L, Flatt PR, Orr DF, Shaw C, Abdel-Wahab YH. Skin secretions of Rana saharica frogs reveal antimicrobial peptides esculentins-1 and -1B and brevinins-1E and -2EC with novel insulin releasing activity. J Endocrinol. 2006;188(1):1–9. doi: 10.1677/joe.1.06293. [DOI] [PubMed] [Google Scholar]
- 17.Ali MF, Lips KR, Knoop FC, Fritzsch B, Miller C, Conlon JM. Antimicrobial peptides and protease inhibitors in the skin secretions of the crawfish frog. Rana areolata Biochim Biophys Acta. 2002;1601(1):55–63. doi: 10.1016/S1570-9639(02)00432-6. [DOI] [PubMed] [Google Scholar]
- 18.Conlon JM, Meetani MA, Coquet L, Jouenne T, Leprince J, Vaudry H, Kolodziejek J, Nowotny N, King JD. Antimicrobial peptides from the skin secretions of the New World frogs Lithobates capito and Lithobates warszewitschii (Ranidae) Peptides. 2009;30(10):1775–1781. doi: 10.1016/j.peptides.2009.07.011. [DOI] [PubMed] [Google Scholar]
- 19.Wang H, Yu Z, Hu Y, Yu H, Ran R, Xia J, Wang D, Yang S, Yang X, Liu J. Molecular cloning and characterization of antimicrobial peptides from skin of the broad-folded frog. Hylarana latouchii Biochimie. 2012;94(6):1317–1326. doi: 10.1016/j.biochi.2012.02.032. [DOI] [PubMed] [Google Scholar]
- 20.Wang Y, Zhang Y, Lee WH, Yang X, Zhang Y. Novel Peptides from Skins of Amphibians Showed Broad-Spectrum Antimicrobial Activities. Chem Biol Drug Des. 2016;87(3):419–424. doi: 10.1111/cbdd.12672. [DOI] [PubMed] [Google Scholar]
- 21.Simmaco M, Mignogna G, Barra D D, Bossa F. Antimicrobial peptides from skin secretions of Rana esculenta Molecular cloning of cDNAs encoding esculentin and brevinins and isolation of new active peptides. The Journal of Biological Chemistry. 1994;269(16):11956–11961. doi: 10.1016/S0021-9258(17)32666-2. [DOI] [PubMed] [Google Scholar]
- 22.Conlon JM, Kolodziejek J, Mechkarska M, Coquet L, Leprince J, Jouenne T, Vaudry H, Nielsen PF, Nowotny N, King JD. Host defense peptides from Lithobates forreri, Hylarana luctuosa, and Hylarana signata (Ranidae): phylogenetic relationships inferred from primary structures of ranatuerin-2 and brevinin-2 peptides. Comp Biochem Physiol D: Genomics Proteomics. 2014;9:49–57. doi: 10.1016/j.cbd.2014.01.002. [DOI] [PubMed] [Google Scholar]
- 23.Mangoni ML, Luca V, McDermott AM. Fighting microbial infections: A lesson from amphibian skin-derived esculentin-1 peptides. Peptides. 2015;71:286–295. doi: 10.1016/j.peptides.2015.04.018. [DOI] [PubMed] [Google Scholar]
- 24.Casciaro B, Cappiello F, Loffredo MR, Ghirga F, Mangoni ML. The Potential of Frog Skin Peptides for Anti-Infective Therapies: The Case of Esculentin-1a(1–21)NH2. Curr Med Chem. 2020;27(9):1405–1419. doi: 10.2174/0929867326666190722095408. [DOI] [PubMed] [Google Scholar]
- 25.Islas-Rodrìguez AE, Marcellini L, Orioni B, Barra D, Stella L, Mangoni ML. Esculentin 1–21: a linear antimicrobial peptide from frog skin with inhibitory effect on bovine mastitis-causing bacteria. J Pept Sci. 2009;15(9):607–614. doi: 10.1002/psc.1148. [DOI] [PubMed] [Google Scholar]
- 26.Marcellini L, Borro M, Gentile G, Rinaldi AC, Stella L, Aimola P, Barra D, Mangoni ML. Esculentin-1b(1–18)–a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli. FEBS J. 2009;276(19):5647–5664. doi: 10.1111/j.1742-4658.2009.07257.x. [DOI] [PubMed] [Google Scholar]
- 27.Luca V, Stringaro A, Colone M, Pini A, Mangoni ML. Esculentin(1–21), an amphibian skin membrane-active peptide with potent activity on both planktonic and biofilm cells of the bacterial pathogen Pseudomonas aeruginosa. Cell Mol Life Sci. 2013;70(15):2773–2786. doi: 10.1007/s00018-013-1291-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Casciaro B, Lin Q, Afonin S, Loffredo MR, de Turris V, Middel V, Ulrich AS, Di YP, Mangoni ML. Inhibition of Pseudomonas aeruginosa biofilm formation and expression of virulence genes by selective epimerization in the peptide Esculentin-1a(1–21)NH(2) FEBS J. 2019;286(19):3874–3891. doi: 10.1111/febs.14940. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Luca V, Olivi M, Di Grazia A, Palleschi C, Uccelletti D, Mangoni ML. Anti-Candida activity of 1–18 fragment of the frog skin peptide esculentin-1b: in vitro and in vivo studies in a Caenorhabditis elegans infection model. Cell Mol Life Sci. 2014;71(13):2535–2546. doi: 10.1007/s00018-013-1500-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Casciaro B, Loffredo MR, Cappiello F, Verrusio W, Corleto VD, Mangoni ML. Frog Skin-Derived Peptides Against Corynebacterium jeikeium: Correlation between Antibacterial and Cytotoxic Activities. Antibiotics. 2020;9(8):448. doi: 10.3390/antibiotics9080448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Scotti R, Casciaro B, Stringaro A, Morgia F, Mangoni ML, Gabbianelli R. Derivatives of Esculentin-1 Peptides as Promising Candidates for Fighting Infections from Escherichia coli O157:H7. Antibiotics. 2022;11(5):656. doi: 10.3390/antibiotics11050656. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Di Grazia A, Cappiello F, Cohen H, Casciaro B, Luca V, Pini A, Di YP, Shai Y, Mangoni ML. D-Amino acids incorporation in the frog skin-derived peptide esculentin-1a(1–21)NH2 is beneficial for its multiple functions. Amino Acids. 2015;47(12):2505–2519. doi: 10.1007/s00726-015-2041-y. [DOI] [PubMed] [Google Scholar]
- 33.Musale V, Abdel-Wahab YHA, Flatt PR, Conlon JM, Mangoni ML. Insulinotropic, glucose-lowering, and beta-cell anti-apoptotic actions of peptides related to esculentin-1a(1–21).NH(2) Amino Acids. 2018;50(6):723–734. doi: 10.1007/s00726-018-2551-5. [DOI] [PubMed] [Google Scholar]
- 34.Hu R, Yuan J, Meng Y, Wang Z, Gu Z. Pathogenic Elizabethkingia miricola Infection in Cultured Black-Spotted Frogs, China, 2016. Emerg Infect Dis. 2017;23(12):2055–2059. doi: 10.3201/eid2312.170942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Wu J, Liu H, Yang H, Yu H, You D, Ma Y, Ye H, Lai R. Proteomic analysis of skin defensive factors of tree frog Hyla simplex. J Proteome Res. 2011;10(9):4230–4240. doi: 10.1021/pr200393t. [DOI] [PubMed] [Google Scholar]
- 36.Sacco F, Bitossi C, Casciaro B, Loffredo MR, Fabiano G, Torrini L, Raponi F, Raponi G, Mangoni ML. The Antimicrobial Peptide Esc(1–21) Synergizes with Colistin in Inhibiting the Growth and in Killing Multidrug Resistant Acinetobacter baumannii Strains. Antibiotics. 2022;11(2):234. doi: 10.3390/antibiotics11020234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Fan XL, Yu SS, Zhao JL, Li Y, Zhan DJ, Xu F, Lin ZH, Chen J. Brevinin-2PN, an antimicrobial peptide identified from dark-spotted frog (Pelophylax nigromaculatus), exhibits wound-healing activity. Dev Comp Immunol. 2022;137:104519. doi: 10.1016/j.dci.2022.104519. [DOI] [PubMed] [Google Scholar]
- 38.Chen J, Lin YF, Chen JH, Chen X, Lin ZH. Molecular characterization of cathelicidin in tiger frog (Hoplobatrachus rugulosus): Antimicrobial activity and immunomodulatory activity. Comparative Biochemistry and Physiology Toxicology & Pharmacology. 2021;247:109072. doi: 10.1016/j.cbpc.2021.109072. [DOI] [PubMed] [Google Scholar]
- 39.Chen J, Zhang CY, Chen JY, Seah RWX, Zhang L, Ma L, Ding GH. Host defence peptide LEAP2 contributes to antimicrobial activity in a mustache toad (Leptobrachium liui) BMC Vet Res. 2023;19(1):47. doi: 10.1186/s12917-023-03606-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Hong J, Hu J, Wang F, Chen L, Wang Z. Molecular mechanisms of tachyplesin I role on genomic DNA and RNA of Escherichia coli. J Agric Sci Technol. 2013;15(1):71–75. [Google Scholar]
- 41.West AP, Brodsky IE, Rahner C, Woo DK, Erdjument-Bromage H, Tempst P, Walsh MC, Choi Y, Shadel GS, Ghosh S. TLR signalling augments macrophage bactericidal activity through mitochondrial ROS. Nature. 2011;472(7344):476–480. doi: 10.1038/nature09973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Subbian S, Mehta PK, Cirillo SL, Bermudez LE, Cirillo JD. A Mycobacterium marinum mel2 mutant is defective for growth in macrophages that produce reactive oxygen and reactive nitrogen species. Infect Immun. 2007;75(1):127–134. doi: 10.1128/IAI.01000-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Fialkow L, Wang Y, Downey GP. Reactive oxygen and nitrogen species as signaling molecules regulating neutrophil function. Free Radical Biol Med. 2007;42(2):153–164. doi: 10.1016/j.freeradbiomed.2006.09.030. [DOI] [PubMed] [Google Scholar]
- 44.Blaser H, Dostert C, Mak TW, Brenner D. TNF and ROS Crosstalk in Inflammation. Trends Cell Biol. 2016;26(4):249–261. doi: 10.1016/j.tcb.2015.12.002. [DOI] [PubMed] [Google Scholar]
- 45.Akdis M, Aab A, Altunbulakli C, Azkur K, Costa RA, Crameri R, Duan S, Eiwegger T, Eljaszewicz A, Ferstl R, et al. Interleukins (from IL-1 to IL-38), interferons, transforming growth factor β, and TNF-α: Receptors, functions, and roles in diseases. J Allergy Clin Immunol. 2016;138(4):984–1010. doi: 10.1016/j.jaci.2016.06.033. [DOI] [PubMed] [Google Scholar]
- 46.Yu SS, Zhao ZH, Gong XF, Fan XL, Lin ZH, Chen J. Antimicrobial and immunomodulatory activity of beta-defensin from the Chinese spiny frog (Quasipaa spinosa) Dev Comp Immunol. 2022;126:104264. doi: 10.1016/j.dci.2021.104264. [DOI] [PubMed] [Google Scholar]
- 47.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 48.Zhu QY, Chen RY, Yu J, Ding GH, Seah RWX, Chen J. Antimicrobial peptide hepcidin contributes to restoration of the intestinal flora after Aeromonas hydrophila infection in Acrossocheilus fasciatus. Comparative Biochemistry and Physiology Toxicology & pharmacology. 2023;263:109486. doi: 10.1016/j.cbpc.2022.109486. [DOI] [PubMed] [Google Scholar]
- 49.Chai LQ, Li WW, Wang XW. Identification and characterization of two arasin-like peptides in red swamp crayfish Procambarus clarkii. Fish Shellfish Immunol. 2017;70:673–681. doi: 10.1016/j.fsi.2017.09.059. [DOI] [PubMed] [Google Scholar]
- 50.Jiang W, Chen J, Guo ZP, Zhang L, Chen GP. Molecular characterization of a MOSPD2 homolog in the barbel steed (Hemibarbus labeo) and its involvement in monocyte/macrophage and neutrophil migration. Mol Immunol. 2020;119:8–17. doi: 10.1016/j.molimm.2020.01.002. [DOI] [PubMed] [Google Scholar]
- 51.Chen J, Lv YP, Dai QM, Hu ZH, Liu ZM, Li JH. Host defense peptide LEAP-2 contributes to monocyte/macrophage polarization in barbel steed (Hemibarbus labeo) Fish Shellfish Immunol. 2019;87:184–192. doi: 10.1016/j.fsi.2019.01.015. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The esculentin-1PN cDNA sequence was submitted to GenBank under accession number OR238914. The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.






