In vitro evaluation of inhibitory effect of Lactobacillus reuteri supernatant on the replication of herpes simplex virus type 1 and expression of UL54, UL52 and UL27 genes

Abstract

Background and Objectives:

Human herpes virus type 1 (HSV-1) is a neurotropic pathogen that is infected more than 70% of the world population. The increasing of viral resistance to antiviral drugs and the emergence of side effects has motivated researchers to study the use of probiotics as new antiviral agents. The aim of the present study was to study for the first time the potential antiviral activity of Lactobacillus reuteri (L. reuteri) supernatant against HSV-1.

Materials and Methods:

After measuring the cytotoxicity of L. reuteri supernatant by MTT assay, 1:16 dilution of it was added to HeLa cells before and after HSV-1 infection, after 1.5 hours incubation with HSV-1, and simultaneously with HSV-1 infection. After 48 hours of incubation at 37°C, the viral titer and expression levels of UL54, UL52 and UL27 genes were measured by tissue culture infectious dose 50 (TCID₅₀ ) and Real-Time PCR methods, respectively.

Results:

HSV-1 titer in the treatment conditions before infection, incubation with HSV-1, simultaneously with infection and after infection was reduced by 0.42, 3.42, 1.83, and 0.83 log 10 TCID₅₀/ml, respectively. When the bacterial supernatant was first incubated with the virus and then added to the cell, or when it was added simultaneously with the virus, the expression of the UL27, UL52, and UL54 genes decreased significantly (p<0.05). When the bacterial supernatant is added to the cell before or after virus infection, the expression of UL52 and UL54 genes does not change significantly (P>0.05).

Conclusion:

The study findings indicated that the supernatant of L. reuteri has a potent anti-HSV-1 effect especially if it is incubated with the virus before inoculation into the cell. Its possible antiviral mechanism is to inhibit the virus by binding to it or changing the surface structure of the virus. Metabolites of L. reuteri can be considered as a novel inhibitor of HSV-1 infection.

INTRODUCTION

The herpes simplex virus (HSV) is a double-stranded DNA virus that belongs to the Alphaherpesvirine subfamily of the Herpesviridae family. This virus enters the host through mucosal membranes and hides in nerve ganglia after the initial infection (1). Due to internal and external stimuli, herpes simplex virus can lead to recurring infections. HSV-1 and HSV-2 are the main serotypes of the virus. HSV-1 is an important cause of eye diseases such as conjunctivitis, acute retinal necrosis, and keratitis. It can cause encephalitis and meningitis. The prevalence of HSV-1 is 42% in Iran, 52% in Finland, 57% in Netherlands, 58% in America, 84% in Bulgaria, 68% in Brazil, 67% in Belgium, and 81% in Czech Republic (2).

In order to treat herpes infections, nucleoside analogue antivirals such as acyclovir, vidarabine, famciclovir, valaciclovir, and penciclovir are typically used (3). However, in recent years, drug resistance has developed due to mutations in the DNA polymerase and thymidine kinase of the virus, which has resulted in a significant decline in their efficacy (4). Although foscarnet and cidofovir are also used to treat herpes virus infections, use of them has been constrained due to side effects such as toxicity and renal impairment (5). In recent years, researchers have tried to find a suitable alternative for nucleoside analogue drugs by using plant extracts, siRNA, probiotics and other new treatment methods (6–8).

Probiotics are defined as live microorganisms that help the host's health. Probiotic microorganisms with beneficial properties include Lactobacillus spp., Bifidobacterium spp., Saccharomyces spp., Streptococcus spp., and Bacillus spp (9). Lactobacillus spp. are one of the most popular probiotics that can be found in a wide range of food products throughout the world. The genus Lactobacillus is a group of Gram-positive, nonsporulating, facultative anaerobic bacteria which include species L. acidophilus, L. bulgaricus, L. casei, L. reuteri, and L. rhamnosus (10).

Several studies have been conducted to assess the antiviral properties of L. reuteri. There is evidence that the supernatant of L. reuteri has antiviral effects on pneumoviruses, circoviruses, rotaviruses, coxsackieviruses, and papillomaviruses (11). It has been proposed that L. reuteri reduces viral infection by modulating the microbiota and secreting antiviral compounds. In recent years, the effect of L. rhamnosus on HSV-1 replication and the effect of L. crispatus and L. gasseri on HSV-2 replication have been studied, and satisfactory results have been obtained (12–14). To date, no study has been published on the anti-herpes effect of L. reuteri.

Herpes virus genes are expressed in a cascade manner, with the immediate early (IE) genes being transcribed first, followed by the early (E) genes, and finally the late (L) genes. Product of UL54 immediate early gene is involve in all steps of viral mRNA biogenesis, including transcription, RNA processing, and nuclear egress (15). UL52 early gene produces primase protein that has a role in unwinding viral dsDNA (16). UL27 late gene produces viral envelope glycoprotein B that is involved in the entry of HSV to host cell (17). To date, no study has been published that evaluated the effect of probiotics on the expression of the three important genes mentioned. Therefore, the present study was aimed to evaluate inhibitory effect of L. reuteri supernatant on the replication of herpes simplex virus type 1 and expression of UL54, UL52 and UL27 genes.

MATERIALS AND METHODS

Ethical approval. This study was approved by the Ethics Committee of Kashan University of Medical Sciences (IR.KAUMS.MEDNT.REC.1401.091).

Growth bacteria and preparation of cell free supernatant. L. reuteri was re-activated from freeze-dried ampoule purchased from Persian Type Culture Collection (PTCC 1655, Iran). L. reuteri was grown in de man, rogosa and sharpe (MRS) broth or on de man, rogosa and sharpe (MRS) agar (Ibresco, Iran) at 37°C and incubated under microaerobic condition. Ten milliliters of liquid MRS medium were inoculated with 100 ul of L. reuteri overnight culture (1×10⁸ CFU/mL) and incubated at 37°C for 24 hours. The cell-free culture supernatant was collected from the culture suspension through centrifugation at 8,000 rpm for 15 min. Subsequently, bacterial cells were removed from the supernatant by a 0.22 μm syringe filter. The prepared cell free supernatant was neutralized (pH: 7.2) and stored at −20°C.

Preparation of cell line and culture of HSV. HeLa cells were taken from the Pasteur Institute of Iran and were grown under the following conditions: Dulbecco's Modified Eagles Medium (DMEM, Gibco, Germany) supplemented with 5% fetal bovine serum (Bioidea, Iran) and 1% penicillin (100 U/mL)/streptomycin (100 μg/mL) (Bioidea, Iran) at 37°C with 5% CO₂. HSV-1, a gift from the Virology Department of Tarbiat Modares University (Tehran, Iran), was cultured in the HeLa cells. The virus was collected 4 days after infection by releasing from cells due to three freeze-thaw cycles.

Cytotoxicity assay of the L. reuteri supernatant. The dimethyl thiazolyl-diphenyl tetrazolium bromide (MTT) assay was used to measure cytotoxicity of the L. reuteri supernatant on cell culture. HeLa cells were seeded into a 96-well plate at a density of 2 × 10⁴ cells/well and incubated for 24 hours at 37°C with 5% CO₂. Serial dilutions of bacterial supernatant in DMEM were prepared (up to 1/128). One hundred milliliter of each dilution was added to cell monolayer of each well. Six wells containing DMEM (without bacterial supernatant) were used as a negative control. The 96-well plate was incubated 24 hours at 37°C with 5% CO₂. Then, cells were washed with PBS. Finaly, 90 uL of fresh DMEM and 10 uL of MTT (BIO-IDEA, Iran) were added to each well, and the plate was incubated at 37°C for 4 hours. The formazan products were analyzed spectrophotometrically after dissolution in DMSO (Bioidea, Iran). Absorbance was measured at 570 nm using the enzyme-linked immunosorbent assay (ELISA) microplate reader. The percentage of cell viability was calculated using the following formula: (A treatment/A control) × 100%.

HSV-1 titration. In the present study, titer of HSV-1 was calculated by the 50 percent tissue culture infective dose (TCID₅₀ ) assay as described previously (2). Briefly, the cells were seeded at the density of 10⁴ cells/well to 96-well plates and allowed to grow and reach about 80% confluency. Serial dilutions (10⁻¹ to 10⁻⁹) of the viral stocks in DMEM were prepared, and 100 ul of each dilution was added to each well of the 96-well plate (four replicates for each dilution). Six wells of each microplate were used as cell controls with DMEM without virus dilutions. The 96-well plates were incubated at 37°C with 5% CO₂ for 7 days, and the cytopathic effect (CPE) of HSV-1 was observed daily using an inverted microscope. The 50% tissue culture infectious dose (TCID₅₀ ) was calculated using the Karber formula (18).

Evaluation of antiviral activity of the bacterial supernatant. Firstly, HeLa cells were seeded at the density of 0.3 × 10⁴ cells/well to 6-well plates and incubated at 37°C with 5% CO₂ for 24 hours to reach a confluent monolayer. Medium of each well was removed and the bacterial supernatant was added to the cells in four different ways as follows:

1. before infection: HeLa cells were incubated with the bacterial supernatant for 1.5 hours at 37°C and 5% CO₂ in triplicate. cells were washed twice with PBS, infected with the virus (MOI=0.1) and incubated for 1.5 hours at 37 °C. After washing the cells with PBS, DMEM containing 2% FBS added to the cells and incubated at 37 °C for 48 hours.

2. Incubation with HSV: The virus (MOI=0.1) was mixed with the bacterial supernatant and co-incubated at 4°C for 1.5 hours, then the mixture was added to the cells and incubated at 37 °C for 1.5 hours. After washing the cells with PBS, DMEM containing 2% FBS added to the cells and incubated at 37°C for 48 hours.

3. Simultaneously with infection: The virus (MOI=0.1) and the bacterial supernatant were added into the cells simultaneously. Following 1.5 hours incubation at 37°C, the cells were washed with PBS and DMEM containing 2% FBS was added and incubated at 37°C for 48 hours.

4. After infection: The cells were infected with HSV-1 (MOI=0.1) and incubated for 1.5 hours at 37°C and 5% CO₂. The cells were washed twice with PBS and incubated with the bacterial supernatant at 37°C for 1.5 hours. After washing the cells with PBS, DMEM containing 2% FBS added to the cells and incubated at 37°C for 48 hours.

After adding the bacterial supernatant under the four conditions mentioned above, the cells were washed with PBS. For all conditions, MRS medium without supernatant was considered as control.

The cell lysate containing HSV-1 were collected after 3 Freeze-thaw cycles and stored at −70°C. Virus titer was calculated by TCID₅₀ method and relative expression of the UL54, UL52 and UL27 genes was measured by Real-Time PCR method.

Measuring the relative expression of UL54, UL52 and UL27 transcripts by Real-Time PCR. RNA was extracted from cell lysate containing HSV-1 using the AmpliSens® RIBO-prep nucleic acid extraction kit (AmpliSens, Russia) according to the manufacturer’s instructions and its quantity and quality was evaluated by the NanoDrop. One microgram of RNA was reverse transcribed using the AddScript cDNA Synthesis Kit (AddBio, South Korea). Real-time PCR analysis was performed using a RealQ Plus 2x Master Mix Green (Ampliqon, Denmark) with ABI StepOne-Plus™ instrument (ABI, USA). The primer sequences targeting human β-globin, UL54, UL52 and UL27 genes were used (Table 1) to perform Real-time PCR. Each reaction mixture contained 12.5 μL of master mix green (Ampliqon, Denmark), 0.5 μL(10 μmol) of each primer, 2 μL of cDNA, and 9.5 μL of distilled water. Amplifications were performed with the following thermal cycling: a 8-minute pre-denaturation step at 95°C, followed by 40cycles of 20-second denaturation at 95°C, 30-second annealing at 60°C, and 30-second elongation at 72°C. The 2^−ΔΔCT method (19) was used to determine the relative expression of UL54, UL52 and UL27 genes after adjusting to the expression of human β-globin gene.

Table 1.

Primers used for measuring the relative expression of HSV-1 genes by Real-Time PCR method

Gene	Sequence (5→3)	Primer concentration (nM)	Product Size (bp)	Reference
UL54	Forward: TGGCGGACATTAAGGACATTG	300	222	(25)
	Reverse: TGGCCGTCAACTCGCAGA	300
UL52	Forward: GACCGACGGGTGCGTTATT	300	193	(25)
	Reverse: GAAGGAGTCGCCATTTAGCC	300
UL27	Forward: GCCTTCTTCGCCTTTCGC	300	238	(25)
	Reverse: CGCTCGTGCCCTTCTTCTT	300
β-Actin	Forward: CAACTTCATCCACGTTCACC	300	219	(26)
	Reverse: GAAGAGCCAAGGACAGGTAC	300

Statistical analysis. TCID₅₀ and real-time PCR data were analyzed by t student test using GraphPad Prism version 10.0. P value lessen than 0.05 was considered as statistically significant. All experiments were replicated three times, and the results were reported as mean standard deviation (SD).

RESULTS

Cytotoxicity assay and cell viability. The impact of L. reuteri supernatant on the viability of Hela cells is shown in Fig. 1. The results of MTT assay showed that when the cells were incubated with the 1/16, 1/32, 1/64, and 1/128 dilutions of the bacterial supernatant, more than 80% of cells were viable. dilutions 1/2, 1/4, and 1/8 of the bacterial supernatant had more than 20% cytotoxicity (Fig. 1). Therefore, the dilution of 1/16 used to evaluate the antiviral activity of the bacterial supernatant in all subsequent assays.

Fig. 1.

Result of the cell viability determined using MTT assay. HeLa cells were treated with different concentrations of L. reuteri supernatant (up to 1/128) and the cell viability evaluated after 48 h.

Evaluation of virus titer reduction by TCID₅₀ method in the HeLa cells treated with the bacterial supernatant. After treatment of the L. reuteri supernatant with the cells in different conditions, the titer of HSV-1 in each condition was compared with the titer of HSV-1 in the control condition using the t-student statistical test and data were summarized in Table 2. HSV-1 titer in the treatment conditions before infection, incubation with HSV-1, simultaneously with infection and after infection was reduced by 0.42, 3.42, 1.83, and 0.83 Log₁₀ TCID₅₀/ml, respectively, compared to the control. HSV-1 titer was significantly decreased when the bacterial supernatant was incubated with the virus and then added to the cell or when the supernatant was added to the cell simultaneously with the virus (P value < 0.0001). When the L. reuteri supernatant was added to the cell before infection with HSV-1, the virus titer did not decrease significantly compared to the control (P value=0.0668), but when the bacterial supernatant was added to the cell after the virus infection, the virus replication decreased (P value=0.0194, Table 2).

Table 2.

Result of HSV-1 titration using TCID₅₀ method in the various condition of treatment with L. reuteri supernatant

Treatment conditions of L. reuteri supernatant	Mean of HSV-1 titer (Log10 TCID50/ml ± SD)		P-Value
	Sample	Control
before infection	5.83 ± 0.14	6.25 ± 0.25	0.0668
Incubation with HSV-1	2.75 ± 0.25	6.17 ± 0.14	<0.0001
Simultaneously with infection	4.25 ± 0.25	6.08 ± 0.14	0.0001
After infection	5.50 ± 0.25	6.33 ± 0.28	0.0194

Relative expression of UL54, UL52 and UL27 genes of HSV-1 in different conditions of treatment with L. reuteri supernatant. The relative expression of UL54, UL52 and UL27 genes of HSV-1 in different conditions of treatment with L. reuteri supernatant was evaluated by Real Time PCR (Fig. 2). The results showed that when the bacterial supernatant is added to the cell before infection with HSV-1, UL27 gene expression does not change significantly compared to the control (Fig. 2, P=0.616). When the bacterial supernatant was first incubated with the virus and then added to the cell, or when the supernatant was added to the cell at the same time as the virus, the expression of the UL27, UL52, and UL54 genes decreased significantly. Obtaining similar results in the TCID₅₀ test shows that the bacterial supernatant has directly inhibited the virus, so the virus titer has decreased and the relative expression of all three viral genes has decreased significantly. When the supernatant was added to the cells after virus infection, the expression of the UL27 gene decreased slightly (0.85 compared to the control, P=0.004). Considering that a similar result was obtained in the TCID₅₀ test, there is a possibility that after the virus entered the cell, the compounds in the bacterial supernatant penetrated the cell and caused a decrease in the virus replication through the effect on the expression of the UL27 gene. When the bacterial supernatant is added to the cell before or after virus infection, the expression of UL52 and UL54 genes does not change significantly compared to the control (P>0.05).

Fig. 2.

Relative expression of UL54, UL52 and UL27 genes of HSV-1 in different experimental conditions of treatment with L. reuteri supernatant. *P value<0.05; **P value < 0.01.

DISCUSSION

Lactobacillus is one of the most common probiotic bacteria. In recent years, the antiviral effect of various Lactobacillus species has been a research interest (10). In the present study, the antiviral effect of L. reuteri supernatant was evaluated when it was added to the cells in the following conditions: before infection with HSV-1, incubation with HSV-1, simultaneously with HSV-1, after infection with HSV-1. Results showed that the maximum decrease in the HSV-1 replication occurred when the supernatant of L. reuteri and HSV-1 were incubated for 1.5 hours and then added to the cells (reduction of virus titer equal to 3.42 Log₁₀ TCID₅₀/ml). This finding suggests that L. reuteri possess a potent antiviral capacity, potentially through the production of bacteriocins or other substances that can directly neutralize the virus. The pH of bacterial supernatant used in the present study was neutral. This means that the antiviral effect of L. reuteri was not through the production of oxygen and the release of H+ ions. It was known that the production of these products inhibits the virus replication (20).

Based on the results obtained from recent studies, Lactobacillus spp. has an antiviral effect through one of the following three possible mechanisms: 1) direct interaction between the bacteria and viruses, 2) production of antiviral compounds, 3) induction of interferon production (21). The antiviral ability of L. reuteri was first recognized by Shornikova et al. when they introduced this probiotic as a therapeutic agent for acute rotavirus diarrhea (11). Several previous studies have shown the antiviral effect of L. reuteri through the direct binding of bacterial particles with viruses. In study of Ang et al., L. reuteri shows a significant antiviral activity against Coxsackievirus type A strain 6 and Enterovirus 71 through direct interaction between bacteria and virus (22). Several studies demonstrated the antiviral effect of bacterial supernatant. Botić et al. shown that the secreted antiviral substances during growth of L. reuteri decreased infectivity of the vesicular stomatitis virus (VSV) by 68% (23). Fakhri et al. investigated the antiviral activity of the L. reuteri supernatant against foot and mouth disease (FMD) virus serotype O. They reported that the bacterial supernatant with dilution of 1/16 had about 60% antiviral activity when it was incubated with the virus and then added to the cell, or when it was added to the cell simultaneously (24). Similar results were obtained in our study, the supernatant was able to significantly reduce virus replication when it entered the cells after incubation with the virus or at the same time. Therefore, the secondary metabolites of the L. reuteri may have inhibited the replication of HSV-1 by directly binding to the virus. Fakhri et al. concluded that if bacterial metabolites enter the cell after virus infection, they cannot inhibit FMD virus replication by inducing intracellular processes (24). This finding is inconsistent with the results of our study, that the addition of the L. reuteri supernatant after virus infection could slightly reduce virus replication. The relative expression of the UL27 gene of HSV-1 has been significantly reduced in this treatment; therefore, the penetration of bacterial metabolites into the cell after the entry of the virus has reduced the expression of the UL27 gene and has inhibited the viral replication.

In the present study and Faghri et al. study, when L. reuteri supernatant was added to the cell before virus inoculation, it did not have a significant effect in reducing virus replication, so it can be concluded that bacterial metabolites do not have a significant effect on the cell surface viral receptors. It is hypothesized that the bacteria metabolites can prevent the virus from binding to the cell receptor and entering the cell by changing the structure of the surface proteins of the virus.

Vilhelmova-Ilieva et al. showed that the cell free supernatant of L. fermentum had a potent antiviral effect when it was in contact with HSV-1 for one hour (25). Elebeedy et al. demonstrated a significant decrease in HSV-1 titer (1.25 log₁₀ TCID₅₀/ml) using the L. acidophilus supernatant (26). Similarly, in the present study, the metabolites of L. reuteri reduced HSV-1 titer by 1.83 Log₁₀ TCID₅₀/ml; therefore the supernatant of L. reuteri, like other mentioned Lactobacilli, contains anti-herpes virus compounds.

The anti-HSV-2 ability of the L. rhamnosus supernatant has been reported (14). In previous studies, the supernatant of some Lactobacillus spp. including L. crispatus, L. gasseri CMUL57, L. acidophilus CMUL67 and L. plantarum CMUL140 had not anti-HSV-2 activity (12, 14). According to the findings of the present study, which shows the presence of anti-herpes virus substances, it is suggested to evaluate the ability of L. reuteri supernatant against HSV-2.

CONCLUSION

The results of the study showed that the L. reuteri supernatant has a strong anti-HSV-1 effect, particularly when it incubates with the virus before cell inoculation. Its possible antiviral mechanism is to inhibit the virus by binding to it or changing the surface structure of the virus. Metabolites of L. reuteri can be considered as a novel inhibitor of HSV-1 infection with potential of therapeutics, however, more studies are needed to clarify which substance in the L. reuteri supernatant is anti-herpes virus.