Skip to main content
NCBI home page
Iranian Journal of Microbiology logoLink to Iranian Journal of Microbiology
. 2024 Feb;16(1):68–78. doi: 10.18502/ijm.v16i1.14873

Investigating the therapeutic potential of Bifidobacterium breve and Lactobacillus rhamnosus postbiotics through apoptosis induction in colorectal HT-29 cancer cells

Nafiseh Erfanian 1, Hossein Safarpour 2, Tahmineh Tavakoli 3, Mohammad Ali Mahdiabadi 3, Saeed Nasseri 2,*, Mohammad Hassan Namaei 4,*
PMCID: PMC11055435  PMID: 38682058

Abstract

Background and Objectives:

Colorectal cancer (CRC) is a prevalent form of cancer worldwide. Recent studies suggest that postbiotics derived from probiotic bacteria have the potential as an adjunct therapy for CRC. This study investigates the anti-cancer effects of Bifidobacterium breve (B. breve) and Lactobacillus rhamnosus (L. rhamnosus) postbiotics on the HT-29 cell line.

Materials and Methods:

Through MTT and scratch assay, we investigated the anti-proliferation and anti-migration effects of B. breve and L. rhamnosus postbiotics on HT-29 cells. Furthermore, postbiotic-mediated apoptosis was assessed by analyzing the expression of Bax, Bcl-2, and caspase-3. We also investigated the effects of B. breve postbiotics on the expression of three important genes involved in metastasis, including RSPO2, NGF, and MMP7. Consequently, we validated the expression of selected genes in twelve adenocarcinoma tissues.

Results:

The results demonstrated the significant impact of postbiotics on HT-29 cells, highlighting their ability to induce anti-proliferation, anti-migration, and apoptosis-related effects. Notably, these effects were more pronounced using B. breve postbiotics than L. rhamnosus. Additionally, B. breve postbiotics could inhibit metastasis through upregulation of RSPO2 while downregulating NGF and MMP7 expression in HT-29 cells.

Conclusion:

Our research suggests that postbiotic metabolites may be effective biological products for the prevention and treatment of cancer.

Keywords: Apoptosis, Bifidobacterium breve, Colorectal cancer, Lactobacillus rhamnosus, Postbiotics, Probiotics

INTRODUCTION

Colorectal cancer (CRC) ranks as the third most common cancer globally, characterized by the abnormal growth of cells in the colon or rectum (1). According to the International Agency for Research on Cancer’s global statistics, CRC accounted for approximately 1.9 million new cases and 0.9 million deaths worldwide in 2020. Projections suggest that the global incidence of new CRC cases is anticipated to increase to 3.2 million by 2040. Notably, CRC incidence rates are higher in highly developed nations but are also rising in middle- and low-income countries due to the influence of Westernization (2). In recent years, the role of gut microbiota in CRC has gained significant attention as researchers have increasingly recognized the intricate relationship between the composition of the gut microbiota and the development of this prevalent form of cancer. The gut microbiota, a complex ecosystem of microorganisms residing in the gastrointestinal tract, plays a crucial role in maintaining gut health, digestion, immune function, and protection against pathogens.

Consequently an imbalance or dysbiosis in the gut microbiota has been associated with various diseases, including CRC (3, 4). In light of the potential impact of gut microbiota on CRC, researchers have explored the use of probiotics as a preventive and therapeutic strategy. Probiotics are live microorganisms that confer health benefits to the host when consumed in appropriate quantities. These beneficial bacteria aid in restoring microbial balance and promoting a healthy gut environment (5–7). More recently, a novel category of microbial-based products, known as postbiotics, has garnered substantial interest. The International Scientific Association of Probiotics and Prebiotics (ISAPP) defines postbiotics as “preparations of inanimate microorganisms and/or their components that provide health benefits to the host” (8). Postbiotics can encompass a variety of components, including metabolites, short-chain fatty acids (SCFAs), microbial cell fractions, functional proteins, extracellular polysaccharides (EPS), cell lysates, teichoic acid, peptidoglycan-derived muropeptides, and pili-type structures (9, 10). Extensive research has demonstrated the biological activities of postbiotics, which play a crucial role in promoting overall health and protecting against various diseases (11). Postbiotics offer several notable advantages over probiotics. Unlike probiotics, postbiotics can exert their biological effects by reaching various host surfaces through diverse routes, including the oral cavity, gut, skin, urogenital tract, and nasopharynx (12, 13). Moreover, they allow for a more straight-forward assessment of their molecular mechanisms and their impact on disease outcomes. Nevertheless, our understanding of the significance of postbiotics in maintaining gut homeostasis is still in its nascent stages (14). Whether derived from probiotics or other microorganisms, postbiotics can be naturally synthesized or directly administered to host surfaces, enhancing human gut health. This application of postbiotics can significantly improve the prevention and treatment of gastrointestinal cancers, including CRC (8, 15, 16). Numerous strains of probiotics have been investigated for their potential effects on CRC, with species like Bifidobacterium breve (B. breve) and Lactobacillus rhamnosus (L. rhamnosus) being among the most commonly studied. These probiotics have demonstrated promise in preclinical and clinical studies by reducing inflammation, inhibiting the growth of cancer cells, and improving overall gut health. In this investigation, we compared the anti-proliferation, anti-migration, and apoptotic effects of two postbiotic extracts from B. breve and L. rhamnosus.

Consequently, the expression of crucial metastasis-related genes, RSPO2, NGF, and MMP7, within the HT-29 cellular context was evaluated. Importantly, our study extends into clinical validation through the analysis of tissue samples from adenocarcinoma patients. This comprehensive approach advances our understanding of genus-dependent postbiotics therapeutic potential and offers a unique perspective on their modulation of pivotal genes in CRC.

MATERIALS AND METHODS

This research study was conducted in compliance with ethical guidelines. The Birjand University of Medical Science ethics committee in Iran issued the approved ethics ID IR.BUMS.REC.1400.332.

Bacterial culture. The B. breve (ATCC 15700) and L. rhamnosus (ATCC 7469) strains utilized in this study were obtained from the Persian-type culture collection (Iranian Research Organization for Science and Technology, Tehran, Iran). B. breve and L. rhamnosus were cultivated in de Man, Rogosa, and Sharpe (MRS) broth enriched with cysteine medium (Merck, Germany) and standard MRS broth (Merck, Germany), respectively, with a 1% (v/v) inoculum. Both strains were incubated for 48 hours at 30°C under anaerobic conditions. Before each experiment, they underwent two subcultures, propagating for an additional 24 hours at 30°C under anaerobic conditions. Stock cultures were maintained at −80°C in MRS broth, supplemented with 20% (v/v) sterile glycerol (Merck, Germany).

Cell culture and maintenance. The human colorectal cancer cell line HT-29 (ATCC HTB-38) and human dermal fibroblast (HDF) (ATCC PCS-201-041) used in this study were provided by the National Cell Bank of Iran (Pasteur Institute, Tehran, Iran). The cells were cultured and maintained in a controlled environment at a temperature of 37°C in a 5% CO2 atmosphere using DMEM medium (high glucose with GlutaMAX) (Bioidea, Iran). The medium was supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) (GIBCO® Invitrogen Corporation, CA, USA) and 100 IU/ml penicillin-streptomycin (Bioidea, Iran) to support cell growth and viability (17).

Preparation of postbiotics. To prepare the postbiotics, the B. breve and L. rhamnosus starter cultures were separately inoculated into 100 ml of MRS broth rich-cysteine and MRS broth, respectively. Subsequently, 1 ml of each bacterial starter culture at a concentration of 108 CFU/mL was inoculated into 9 mL of the respective medium. The cultures were then incubated at 37°C for 24 h without agitation, allowing both bacteria to reach the late-exponential growth phase. To obtain the postbiotics metabolite, the live B. breve and L. rhamnosus cells were separated from the culture supernatant through centrifugation at 10,000 g for 15 min at 4°C, and the resulting supernatant, containing postbiotics, was carefully collected. To ensure the quality and purity of the postbiotics, the supernatant was adjusted to a physiological pH range of 7.2–7.4. This adjustment helps maintain the stability and functionality of the postbiotics. Furthermore, the postbiotics were filtered through a 0.22 μm polyether sulfone membrane syringe filter (Millipore, USA) to remove any remaining cellular debris or contaminants (18).

Anti-proliferation effect of postbiotics on HT-29 and normal cells. HT-29 cells (6 × 103 cells per well, 100 μl per well) and HDF cells (1 × 104 cells per well, 100 μl per well) were seeded into 96-well microplates and incubated at 37°C in a 5% CO2 incubator for the MTT assay. After a 24-hour incubation period, different postbiotic concentrations ranging from 0.62% to 40% (v/v) were introduced into a complete growth medium. Following respective time intervals of 24, 48, and 72 h, the cells were treated with a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (Sigma–Aldrich, USA) at a concentration of 5 mg/ml for four hours. A 10% dimethyl sulfoxide (DMSO) reagent (Sigma–Aldrich, USA) was added to dissolve the resulting blue formazan crystals. The absorbance of the formazan dye was measured at a wavelength of 570 nm with a reference wavelength of 630 nm. Each experiment was performed three times, with triplicate samples in each repetition. The percentage of cell viability was calculated using the following equation: (A570 nm sample - A570 nm blank) / (A570 nm control - A570 nm blank) × 100%, where A570 nm represents the maximum absorbance of the cells at 570 nm. To determine the concentration at which cell growth was inhibited by 50% (IC50 ), a plot was generated by plotting the postbiotics concentration against the percentage of cell viability (19).

Anti-migration effect of postbiotics on HT-29 cells. The scratch test was employed to evaluate the efficacy of B. breve and L. rhamnosus postbiotics in inhibiting cell migration. HT-29 cells were seeded in 12-well plates at a density of 4 × 105 cells per well. After 24h treatment with a 25% IC50 concentration of each postbiotic, a straight scratch was created using a 200 μL yellow pipette tip. Cell migration was observed through microscopy at intervals from 0 to 72 h following treatment. Photographs were captured to document the boundary areas of the scratches at different time points. The ImageJ software (version 1.52) was utilized for analyzing the scratch area. Specifically, the ratio between the initial open space at 0 h and the remaining space after 72 h was calculated. This analysis facilitated a comparison of the migratory capacity of the cells treated with B. breve and L. rhamnosus postbiotics (20).

Study the expression of genes in adenocarcinoma tissues by RT-qPCR. Histopathological samples were collected from twelve patients diagnosed with adenocarcinoma cancer and their adjacent normal tissues to investigate the expression of three important genes related to metastasis in CRC tissues. The samples were obtained from the Biobank of Shahid Beheshti University of Medical Sciences. Total RNA was extracted from the tissue samples using an RNA extraction kit (Parstous, Iran). Subsequently, the RNA was reverse-transcribed into complementary DNA (cDNA) using the cDNA Synthesis Kit (Parstous, Iran), following the manufacturer’s guidelines. Real-time quantitative PCR (RT-qPCR) was then conducted. The expression levels were normalized using GAPDH as an endogenous control, and the relative expression levels were calculated using the 2−ΔΔCT method [ABI Step One™ Real-Time PCR System (Applied Biosystems, CA)].

Study the effects of postbiotics on gene expresion of HT-29 cell line. The HT-29 cells (15 × 105 cells per well) were treated with 25% IC50 concentration of B. breve postbiotics for 24h. After this incubation period, total RNA was extracted from the cells using a total RNA extraction kit (Parstous, Iran). Subsequently, cDNA synthesis was done using a general cDNA Synthesis Kit (Parstous, Iran). Quantitative RT-qPCR was conducted to evaluate the expression levels of the Bax, Bcl-2, caspase-3, RSPO2, NGF, and MMP7, utilizing the QuantiTect™ SYBR Green PCR Master Mix (Amplicon, Denmark). Specific primers targeting the appropriate genomic regions were employed for amplification (Tabel 1). Gene amplification was performed, and the expression levels of the target genes were normalized to the reference gene GAPDH. The relative expression levels were calculated using the 2−ΔΔCT method.

Table 1.

Primer sequences

Primer Sequence References
Bax F: TGGAGCTGCAGAGGATGATTG (21)
R: GAAGTTGCCGTCAGAAAACATG
Bcl2 F: TGCACCTGACGCCCTTCACC (21)
R: CACATGACCCCACCGAACTCAAAGA
caspase-3 F: ATTCATAGTGGCACCAAATC (22)
R: TAAATCAAATCCGATGTTCC
RSPO2 F: CTTGTAGCAGAAATAATCGCACATGT
R: TGCCTCATTGTCATCTTGCATC
NGF F: GAGCAAGCGGTCATCATCCCA
R: TCCATGGTCAGCGCCTTGA
MMP7 F: GAATGTTAAACTCCCGCGTC
R: CGATCCACTGTAATATGCGGTA
GAPDH F: GTGATGCTGGTGCTGA (22)
R: GCTAAGCAGTTGGTGG
Open in a new tab

Statistical analysis. The cytotoxicity and anti-proliferative effects were analyzed using analysis of variance (ANOVA), followed by pairwise multiple comparison procedures (Tukey test). The obtained results are presented as the mean ± standard error of the mean (SEM). The statistical analysis was conducted using Minitab Statistical Software, with a significance level set at p-value < 0.05. This threshold was used to determine the statistical significance of the observed differences between the experimental groups.

RESULTS

Postbiotics have anti-proliferation effects on HT-29 cells. The results of the MTT assay illustrated that both B. breve and L. rhamnosus postbiotics effectively reduced the viability of HT-29 cells in a time- and dose-dependent manner within the treatment groups (Fig. 1A for B. breve postbiotics and Fig. 1B for L. rhamnosus postbiotics). Subsequently, IC50 values were calculated for each group. It was noted that the IC50 values exhibited a significant reduction across different time intervals (24–72 h) when B. breve and L. rhamnosus postbiotics were administered. This decrease in IC50 values was particularly pronounced in cancer cells treated with B. breve postbiotics (IC50 values = 20.15 ± 0.16) as compared to those treated with L. rhamnosus postbiotics (IC50 values = 40 ± 0.9), indicating a more potent cytotoxic effect for B. breve postbiotics. However, the cytotoxic effects of postbiotics on HDF cells were less significant, with only limited cytotoxicity observed after 72 h of treatment, amounting to 40% for B. breve postbiotics and 26% for L. rhamnosus postbiotics (Fig. 1C for B. breve postbiotics and Fig. 1D for L. rhamnosus postbiotics).

Fig. 1.

Fig. 1

Open in a new tab

MTT assay showing the effect of B. breve (A) and L. rhamnosus (B) postbiotics on reducing the viability of the HT-29 cells. HT-29 cells were treated with various postbiotic concentrations for 24h, 48h, and 72h. MTT analysis indicates that postbiotics had significant anti-proliferation effects on the viability of the HT-29 cells compared to the untreated group, with the IC50 value of 20.15 ± 0.16 v/v for B. breve in 24h and 40 ± 0.9 v/v for L. rhamnosus in 24h. The effects of postbiotics on HDF cells showed only limited cytotoxicity of 40% for B. breve (C) and 26% for L. rhamnosus (D) postbiotic after 72 h of treatment. (p <0.05, p <0.01 and p <0.001 respectively *, **, ***).

Postbiotics have anti-migration effects on HT-29 cells. The scratch test assessed the anti-migration effects of postbiotics on HT-29 cells. As indicated by the data presented in Fig. 2, a significant decrease in cell migration was observed within the 0–72 hour time frame in the groups treated with B. breve (Fig. 2B) and L. rhamnosus postbiotics (Fig. 2C) when compared to the control group (Fig. 2A). Additionally, no noticeable difference in the effectiveness of these two postbiotics in preventing migration was observed (Fig. 2D).

Fig. 2.

Fig. 2

Open in a new tab

Scratch test showing the control group (A), and also the effects of B. breve (B) and L. rhamnosus (C) postbiotics on reducing the migration of the HT-29 cell line. Under 80% confluence, a scratch was made on wells using a sterile yellow-colored pipette tip. Subsequently, 25% IC50 concentrations of postbiotics were added to the cells. Pictures were taken at 0–72 hour time frame, and the amount of migration was calculated (D) (p <0.05, p <0.01 and p <0.001 respectively *, **, ***).

Postbiotics induce apoptosis in HT-29 cells. To explore the anti-apoptotic effects of B. breve and L. rhamnosus postbiotics, we analyzed their impact on the expression of the Bax, Bcl-2, and caspase-3 genes in HT-29 cells subjected to postbiotic treatment. The results consistently revealed substantial changes in gene expression patterns. When HT-29 cancer cells were treated with B. breve postbiotics (Fig. 3A), we observed a significant upregulation of Bax (7.94-fold increase, p-value < 0.001) and caspase-3 (4.6-fold increase, p-value < 0.01), along with a downregulation of Bcl-2 (2.3-fold decrease, p-value < 0.05). Likewise, when the cancer cells were treated with L. rhamnosus postbiotics (Fig. 3B), we observed an upregulation of Bax (2.7-fold increase, p-value < 0.01) and caspase-3 (3.05-fold increase, p-value < 0.01), and a downregulation of Bcl-2 (1.57-fold decrease, p-value < 0.05). Remarkably, the data highlights that B. breve postbiotics induced a remarkable increase in the Bax/Bcl-2 mRNA ratio by 18.2-fold in treated cancer cells, while L. rhamnosus postbiotics also exhibited a similar effect, elevating the ratio by 4.4-fold (Fig. 3C). This ratio increase indicates both postbiotics potential to modulate key apoptotic genes, influencing the Bax/Bcl-2 balance in a manner conducive to anti-apoptotic effects.

Fig. 3.

Fig. 3

Open in a new tab

Bax, Bcl-2, and caspase-3 gene expression levels in HT-29 cell line in response to B. breve (A) and L. rhamnosus (B) extracted postbiotic treatment. The Bax/Bcl-2 ratio in the cells treated by B. breve postbiotic compared with cells treated by L. rhamnosus postbiotic (C). The Y-axis represents the fold change in the expression of the target gene compared with the untreated group. *: significant difference compared with the untreate cells (2(−ΔΔct) = 1 in untreated group). (p <0.05, p <0.01, p <0.001 and p <0.0001 respectively *, **, ***, **).

Evaluating the expression of selected genes in patient tissues by RT-qPCR. The expression level of the RSPO2, NGF, and MMP7 was evaluated in colorectal samples using RT-qPCR. The results showed that the expression of RSPO2 (0.14-fold down, p-value < 0.01) in CRC samples exhibited a substantial decrease compared to the adjacent normal tissues. However, the expression of MMP7 (2.57-fold up, p-value < 0.05) and NGF (5.8-fold up, p-value < 0.05) had upregulated in the CRC samples (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Expression of RSPO2, NGF, and MMP7 genes in colorectal cancer vs. normal adjacent tissues. Data (mean ± SE) are representative results derived from a minimum of three independent experiments. (p <0.05 and p <0.01, respectively *, **).

Bifidobacterium breve postbiotics regulate the metastasis process in HT-29 cell line. RT-qPCR data demonstrated that treating the HT-29 cells with postbiotics effectively increased the expression levels of RSPO2 (1.82-fold up, p-value < 0.01 while decreasing the expression of NGF (1.48-fold down, p-value < 0.05) and MMP7 (1.9-fold down, p-value < 0.01) compared to untreated cells (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

Gene expression levels of RSPO2, NGF, and MMP7 in HT-29 cell line in response to B. breve postbiotics treatment. The Y-axis represents the fold change in the expression of the target gene compared with the untreated group. (p <0.01 and p <0.05 respectively **, *).

DISCUSSION

Recent research shows intestinal microbiota composition can significantly impact cancer development and treatment. Probiotics are nonpathogenic microorganisms that can provide health benefits to the host and prevent cancer through various mechanisms (23). Many studies have shown that probiotic bacteria can effectively protect against cancer by producing postbiotic metabolites that induce apoptosis (24–30). Consistent with other studies, our investigation confirmed the anti-proliferative and anti-migration properties of two postbiotics obtained from B. breve and L. rhamnosus on HT-29 cell lines. The results revealed significant inhibition of cell growth in a dose- and time-dependent manner for both post-biotics. However, the IC50 of B. breve postbiotics was notably lower than that of L. rhamnosus postbiotics, indicating that probiotic anti-cancer ability could be genus-dependent. Similar to our study, Ardestani et al. reported that probiotic bacteria have anti-proliferative and anti-cancer properties, but the effectiveness varies depending on the specific genus and strain. For instance, they have shown that Lactobacillus brevis is more effective than Lactobacillus paracasei in inhibiting the growth of HT-29 cells and inducing apoptosis (31).

Moreover, we compared the IC50 values between HT-29 and HDF cells. We confirmed that the post-biotic concentrations required to elicit anti-proliferative and cytotoxic effects were considerably higher for normal cells than for the HT-29 cell line. Relative expression assays for Bax, Bcl-2, and caspase-3 revealed an increased expression of Bax and caspase-3 and a decreased expression of Bcl-2, which indicates that the postbiotics could exert their anti-cancer effects through the induction of apoptosis on the HT-29 cell line. Notably, the Bax/Bcl-2 ratio in B. breve-treated cells was 4.1-fold higher than in L. rhamnosus-treated cells. This discrepancy suggests that postbiotics derived from B. breve may possess greater apoptotic effects on HT-29 cells than those from L. rhamnosus. The process of programmed cell death, known as apoptosis, is a natural occurrence in multicellular organisms. It involves regulating proteins such as Bax, Bcl-2, and caspase-3. Bax is a protein that supports apoptosis by encouraging the release of cytochrome c from mitochondria.

On the other hand, Bcl-2 is an anti-apoptotic protein that inhibits apoptosis by preventing the release of cytochrome c from mitochondria. Caspase-3 is a protease that breaks down many cellular proteins and is responsible for the changes in appearance associated with apoptosis. The induction of apoptosis through Bax, Bcl-2, and caspase-3 can occur through various stimuli, including postbiotics (32, 33).

As part of our investigation, we conducted RT-qP-CR experiments on tissue samples from twelve Iranian adenocarcinoma patients and their normal adjacent tissues to evaluate the expression of three key genes involved in colorectal cancer metastasis. The results showed that the expression of RSPO2 was decreased while NGF and MMP7 were increased in colorectal cancer tissues. Metastasis is the lethal feature of cancer and has been suggested to be associated with poor survival of patients with CRC (34). RSPO2 is a member of the R-spondin family that inhibits Wnt/β-catenin signaling in the CRC cells (35, 36). Many studies have demonstrated that RSPO2 inhibits CRC cell migration, invasion, and metastasis in vitro and in vivo, so reduced RSPO2 expression is associated with tumor metastasis and poor survival in CRC patients (37–39). Nerve growth factor (NGF) is the founding member of the neurotrophins, responsible for the growth and developmental plasticity of neuronal populations (40, 41). NGF released by cancer cells can be a driver of tumor neurogenesis, and nerves infiltrated in TME release neurotransmitters, which might stimulate the growth and sustainment of tumor cells. It is reported that high expression of NGF is related to high incidence of metastasis in CRC because the binding of NGF to TrkA, phosphorylated TrkA, which activated MAPK/Erk signaling pathway increasing the expression NGAL to enhance the activity of MMP2, MMP9, and MMP7, promoted colorectal cancer metastasis (42–44). MMP7, also known as matrix metalloproteinase-7, is an enzyme that degrades extracellular matrix (ECM) proteins. It is highly expressed by epithelial tumor cells in invasive CRC compared to normal cells and is associated with distant metastasis (45). We also studied the expression of selected genes in the HT-29 cells treated with B. breve postbiotics as a potent anti-cancer metabolite. Our results demonstrated that B. breve postbiotics could increase the expression of RSPO2 while decreasing the expression of NGF and MMP7.

Along with our investigation, various studies have shown that postbiotics have numerous physiological health benefits for their host. These benefits are achieved through various mechanisms such as apoptosis, anti-proliferative, anti-inflammatory, and anti-migration properties (46–49). In this way, several studies have validated the anti-apoptotic and anti-proliferative effects of B. breve and L. rhamnosus on different cancer cell lines and animal models. For instance, L. rhamnosus has been shown to effectively inhibit HT-29 cell growth through apoptosis induction, involving the release of cytochrome c and activation of the mitochondrial pathway (50). In another study by Gamallat et al. they investigated the impact of L. rhamnosus on CRC development. They revealed that treatment with this postbiotic decreases the expression of β-catenin and inflammatory mediators such as NFκB-p65, COX-2, and TNF-α. It also suppresses the anti-apoptotic protein Bcl-2 while enhancing the expression of pro-apoptotic factors, including Bax, caspase-3, and p53, compared to control cells (51). Li et al. also demonstrated that B. breve can induce apoptosis in tumors and impede tumor growth in mice. This effect is attributed to the recruitment of intestinal dendritic cells (DCs) and the upregulation of IL-12, which promotes the recruitment of T cells to the tumor microenvironment. Their research further suggests that manipulating the gut microbiota by introducing exogenous B. breve may enhance its anti-tumor efficacy (52).

This study provides compelling evidence for anti-cancer properties of probiotics, highlighting their potential as therapeutic interventions in CRC and other cancer types. However, it is important to acknowledge that although our in vitro experiments with B. breve and L. rhamnosus postbiotics have shown potential anti-cancer effects on the HT-29 cell line, it is crucial to recognize that the behavior of CRC cells can vary widely. Therefore, the effects observed in this study may not necessarily extend to all types of CRC cells. Additionally, further research is needed to explore additional signaling pathways that contribute to the development of the cancer phenotype.

CONCLUSION

In this study, we confirmed the anti-proliferation and anti-migration effects of B. breve and L. rhamnosus postbiotics on HT-29 cell lines in a dose- and time-dependent manner. We concluded that these postbiotics have the ability to induce apoptosis by upregulating the expression of Bax and caspase-3 while simultaneously downregulating the expression of Bcl-2. Intriguingly, a comparative analysis between B. breve and L. rhamnosus postbiotics unveiled the superior anti-cancer properties of B. breve. It exhibited a more pronounced ability to inhibit the growth of HT-29 cells and induce apoptosis compared to L. rhamnosus. Moreover, our RT-qPCR results on tissue samples showed decreased expression of RSPO2 genes and increased expression of MMP7 and NGF in adenocarcinoma tissue samples compared to normal adjacent tissues. However, treating cells through B. breve postbiotics could upregulate the expression of RSPO2 while downregulating the NGF and MMP7 expression. These findings contribute valuable knowledge to exploring postbiotics from probiotic bacteria as potential agents against cancer growth and migration.

REFERENCES

  • 1.Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin 2019; 69: 7–34. [DOI] [PubMed] [Google Scholar]
  • 2.Xi Y, Xu P. Global colorectal cancer burden in 2020 and projections to 2040. Transl Oncol 2021; 14: 101174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Pandey H, Tang DWT, Wong SH, Lal D. Gut microbiota in colorectal cancer: biological role and therapeutic opportunities. Cancers (Basel) 2023; 15: 866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gu M, Yin W, Zhang J, Yin J, Tang X, Ling J, et al. Role of gut microbiota and bacterial metabolites in mucins of colorectal cancer. Front Cell Infect Microbiol 2023; 13: 1119992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lamaudière MTF, Arasaradnam R, Weedall GD, Morozov IY. The Colorectal cancer microbiota alter their transcriptome to adapt to the acidity, reactive oxygen species, and metabolite availability of gut microenvironments. mSphere 2023; 8(2): e0062722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Huang F, Li S, Chen W, Han Y, Yao Y, Yang L, et al. Postoperative probiotics administration attenuates gastrointestinal complications and gut microbiota dysbiosis caused by chemotherapy in colorectal cancer patients. Nutrients 2023; 15: 356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wang L, Yu K-C, Hou Y-Q, Guo M, Yao F, Chen Z-X. Gut microbiome in tumorigenesis and therapy of colorectal cancer. J Cell Physiol 2023; 238: 94–108. [DOI] [PubMed] [Google Scholar]
  • 8.Song D, Wang X, Ma Y, Liu N-N, Wang H. Beneficial insights into postbiotics against colorectal cancer. Front Nutr 2023; 10: 1111872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mayorgas A, Dotti I, Salas A. Microbial metabolites, postbiotics, and intestinal epithelial function. Mol Nutr Food Res 2021; 65(5): e2000188. [DOI] [PubMed] [Google Scholar]
  • 10.Mehta JP, Ayakar S, Singhal RS. The potential of para-probiotics and postbiotics to modulate the immune system: A Review. Microbiol Res 2023; 275: 127449. [DOI] [PubMed] [Google Scholar]
  • 11.Bourebaba Y, Marycz K, Mularczyk M, Bourebaba L. Postbiotics as potential new therapeutic agents for metabolic disorders management. Biomed Pharmacother 2022; 153: 113138. [DOI] [PubMed] [Google Scholar]
  • 12.Vinderola G, Sanders ME, Salminen S. The concept of postbiotics. Foods 2022; 11: 1077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Salminen S, Collado MC, Endo A, Hill C, Lebeer S, Quigley EMM, et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat Rev Gastroenterol Hepatol 2021; 18: 649–667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Feizi H, Plotnikov A, Rezaee MA, Ganbarov K, Kamounah FS, Nikitin S, et al. Postbiotics versus probiotics in early-onset colorectal cancer. Crit Rev Food Sci Nutr 2024; 64:3573–3582. [DOI] [PubMed] [Google Scholar]
  • 15.Nataraj BH, Ali SA, Behare PV, Yadav H. Postbiotics-parabiotics: The new horizons in microbial biotherapy and functional foods. Microb Cell Fact 2020; 19: 168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Fan S, Xing J, Jiang Z, Zhang Z, Zhang H, Wang D, et al. Effects of long non-coding RNAs induced by the gut microbiome on regulating the development of Colorectal cancer. Cancers (Basel) 2022; 14: 5813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kim Y, Kim HJ, Ji K. The proliferation inhibitory effect of postbiotics prepared from probiotics with antioxidant activity against HT-29 Cells. Appl Sci 2022; 12: 12519. [Google Scholar]
  • 18.Salemi R, Vivarelli S, Ricci D, Scillato M, Santagati M, Gattuso G, et al. Lactobacillus rhamnosus GG cell-free supernatant as a novel anti-cancer adjuvant. J Transl Med 2023; 21: 195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Pourbaferani M, Modiri S, Norouzy A, Maleki H, Heidari M, Alidoust L, et al. A newly characterized potentially probiotic strain, Lactobacillus brevis MK05, and the toxicity effects of its secretory proteins against MCF-7 breast cancer cells. Probiotics Antimicrob Proteins 2021; 13: 982–992. [DOI] [PubMed] [Google Scholar]
  • 20.Memari F, Mirzavi F, Jalili-Nik M, Afshari AR, Ghorbani A, Soukhtanloo M. Tumor-inhibitory effects of zerumbone against HT-29 human colorectal cancer cells. Int J Toxicol 2022; 41: 402–411. [DOI] [PubMed] [Google Scholar]
  • 21.Karimaei S, Namazi Shabestari A, Mirzaei A, Fatahip B. Aoptosis, cytotoxicity and expression of metastatic suppressor genes increased in human bladder and renal carcinoma cells by Nisin. Transl Res Urol 2022; 4: 83–88. [Google Scholar]
  • 22.Lee GW, Kim MS. Water extract of samultang reduces apoptotic cell death by h(2)o(2)-induced oxidative injury in SK-N-MC cells. Korean J Physiol Pharmacol 2009; 13: 139–145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Singh S, Singh M, Gaur S. Probiotics as multifaceted oral vaccines against colon cancer: A review. Front Immunol 2022; 13: 1002674. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.An J, Kim H, Yang KM. An aqueous extract of a Bifidobacterium species induces apoptosis and inhibits invasiveness of non-small cell lung cancer cells. J Microbiol Biotechnol 2020; 30: 885–893. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Dashtbanei S, Keshtmand Z. A mixture of multi-strain probiotics (Lactobacillus Rhamnosus, Lactobacillus Helveticus, and Lactobacillus Casei) had anti-inflammatory, anti-apoptotic, and anti-oxidative effects in oxidative injuries induced by cadmium in small intestine and lung. Probiotics Antimicrob Proteins 2023; 15: 226–238. [DOI] [PubMed] [Google Scholar]
  • 26.Khailova L, Mount Patrick SK, Arganbright KM, Halpern MD, Kinouchi T, Dvorak B. Bifidobacterium bifidum reduces apoptosis in the intestinal epithelium in necrotizing enterocolitis. Am J Physiol Gastrointest Liver Physiol 2010; 299: G1118–1127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mohammadi G, Dargahi L, Naserpour T, Mirzanejad Y, Alizadeh SA, Peymani A, et al. Probiotic mixture of Lactobacillus helveticus R0052 and Bifidobacterium longum R0175 attenuates hippocampal apoptosis induced by lipopolysaccharide in rats. Int Microbiol 2019; 22: 317–323. [DOI] [PubMed] [Google Scholar]
  • 28.Hughes KR, Harnisch LC, Alcon-Giner C, Mitra S, Wright CJ, Ketskemety J, et al. Bifidobacterium breve reduces apoptotic epithelial cell shedding in an exopolysaccharide and MyD88-dependent manner. Open Biol 2017; 7: 160155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Baldwin C, Millette M, Oth D, Ruiz MT, Luquet FM, Lacroix M. Probiotic Lactobacillus acidophilus and L. casei mix sensitize colorectal tumoral cells to 5-fluoro-uracil-induced apoptosis. Nutr Cancer 2010; 62: 371–378. [DOI] [PubMed] [Google Scholar]
  • 30.Iyer C, Kosters A, Sethi G, Kunnumakkara AB, Aggarwal BB, Versalovic J. Probiotic Lactobacillus reuteri promotes TNF-induced apoptosis in human myeloid leukemia-derived cells by modulation of NF-κB and MAPK signalling. Cell Microbiol 2008; 10: 1442–1452. [DOI] [PubMed] [Google Scholar]
  • 31.Karimi Ardestani S, Tafvizi F, Tajabadi Ebrahimi M. Heat-killed probiotic bacteria induce apoptosis of HT-29 human colon adenocarcinoma cell line via the regulation of Bax/Bcl2 Bifidobacterium breve reduces apoptotic epithelial cell shedding in an exopolysaccharide and MyD88-dependent manner. Open Biol and caspases pathway. Hum Exp Toxicol 2019; 38: 1069–1081. [DOI] [PubMed] [Google Scholar]
  • 32.Qian Y, Shi CH, Cheng CH, Liao D, Liu J, Chen G-T. Ginger polysaccharide UGP1 suppressed human colon cancer growth via p53, Bax/Bcl-2, caspase-3 pathways and immunomodulation. Food Sci Hum Wellness 2023; 12: 467–476. [Google Scholar]
  • 33.Yu Z, Li W. Induction of apoptosis by puerarin in colon cancer HT-29 cells. Cancer Lett 2006; 238: 53–60. [DOI] [PubMed] [Google Scholar]
  • 34.Biller LH, Schrag D. Diagnosis and treatment of metastatic colorectal cancer: a review. JAMA 2021; 325: 669–685. [DOI] [PubMed] [Google Scholar]
  • 35.Wu C, Qiu S, Lu L, Zou J, Li W-F, Wang O, et al. RSPO2–LGR5 signaling has tumour-suppressive activity in colorectal cancer. Nat Commun 2014; 5: 3149. [DOI] [PubMed] [Google Scholar]
  • 36.Ter Steege EJ, Bakker ERM. The role of R-spondin proteins in cancer biology. Oncogene 2021; 40: 6469–6478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Park S, Cui J, Yu W, Wu L, Carmon KS, Liu QJ. Differential activities and mechanisms of the four R-spondins in potentiating Wnt/β-catenin signaling. J Biol Chem 2018; 293: 9759–9769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Szenker-Ravi E, Altunoglu U, Leushacke M, Bosso-Lefèvre C, Khatoo M, Thi Tran H, et al. RSPO2 inhibition of RNF43 and ZNRF3 governs limb development independently of LGR4/5/6. Nature 2018; 557: 564–569. [DOI] [PubMed] [Google Scholar]
  • 39.Dong X, Liao W, Zhang L, Tu X, Hu J, Chen T, et al. RSPO2 suppresses colorectal cancer metastasis by counteracting the Wnt5a/Fzd7-driven noncanonical Wnt pathway. Cancer Lett 2017; 402: 153–165. [DOI] [PubMed] [Google Scholar]
  • 40.Bruno F, Arcuri D, Vozzo F, Malvaso A, Montesanto A, Maletta R. Expression and signaling pathways of Nerve Growth Factor (NGF) and pro-NGF in breast cancer: a systematic review. Curr Oncol 2022; 29: 8103–8120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sims S-K, Wilken-Resman B, Smith CJ, Mitchell A, McGonegal L, Sims-Robinson C. Brain-Derived Neurotrophic Factor and Nerve Growth Factor therapeutics for brain injury: The current translational challenges in preclinical and clinical research. Neural Plast 2022; 2022: 3889300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Molloy NH, Read DE, Gorman AM. Nerve growth factor in cancer cell death and survival. Cancers (Basel) 2011; 3: 510–530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Di Donato M, Giovannelli P, Migliaccio A, Castoria G. The nerve growth factor-delivered signals in prostate cancer and its associated microenvironment: When the dialogue replaces the monologue. Cell Biosci 2023; 13: 60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Aloe L, Rocco ML, Balzamino BO, Micera A. Nerve growth factor: role in growth, differentiation and controlling cancer cell development. J Exp Clin Cancer Res 2016; 35: 116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Yao H, Ren D, Wang Y, Wu L, Wu Y, Wang W, et al. KCTD9 inhibits the Wnt/β-catenin pathway by decreasing the level of β-catenin in colorectal cancer. Cell Death Dis 2022; 13: 761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wong CC, Yu J. Gut microbiota in colorectal cancer development and therapy. Nat Rev Clin Oncol 2023; 20: 429–452. [DOI] [PubMed] [Google Scholar]
  • 47.de Vos WM, Tilg H, Van Hul M, Cani PD. Gut micro-biome and health: mechanistic insights. Gut 2022; 71: 1020–1032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Hertli S, Zimmermann P. Molecular interactions between the intestinal microbiota and the host. Mol Microbiol 2022; 117: 1297–1307. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kim S, Kim G-H, Cho H. Postbiotics for cancer prevention and treatment. Korean J Microbiol 2021; 57: 142–153. [Google Scholar]
  • 50.Dehghani N, Tafvizi F, Jafari P. Cell cycle arrest and anti-cancer potential of probiotic Lactobacillus rhamnosus against HT-29 cancer cells. Bioimpacts 2021; 11: 245–252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Gamallat Y, Meyiah A, Kuugbee ED, Hago AM, Chiwala G, Awadasseid A, et al. Lactobacillus rhamnosus induced epithelial cell apoptosis, ameliorates inflammation and prevents colon cancer development in an animal model. Biomed Pharmacother 2016; 83: 536–541. [DOI] [PubMed] [Google Scholar]
  • 52.Li Q, Li Y, Wang Y, Xu L, Guo Y, Wang Y, et al. Oral administration of Bifidobacterium breve promotes antitumor efficacy via dendritic cells-derived interleukin 12. Oncoimmunology 2021; 10: 1868122. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Iranian Journal of Microbiology are provided here courtesy of Tehran University of Medical Sciences

RESOURCES