Boosting titers of engineered triketide and tetraketide synthases to record levels through T7 promoter tuning

Abstract

Modular polyketide synthases (PKS’s) are promising platforms for the rational engineering of designer polyketides and commodity chemicals, yet their low productivities are a barrier to the practical biosynthesis of these compounds. Previously, we engineered triketide lactone synthases such as Pik167 using the recently updated module definition and showed they generate hundreds of milligrams of product per liter of Escherichia coli K207-3 shake flask culture. As the molar ratio between the 2 polypeptides of Pik167 is highly skewed, we sought to attenuate the strength of the T7 promoter controlling the production of the smaller, better-expressing polypeptide and thereby increase production of the first polypeptide under the control of an unoptimized T7 promoter. Through this strategy, a 1.8-fold boost in titer was obtained. After a further 1.5-fold boost obtained by increasing the propionate concentration in the media from 20 to 80 mM, a record titer of 791 mg L⁻¹ (627 mg L⁻¹ isolated) was achieved, a 2.6-fold increase overall. Spurred on by this result, the tetraketide synthase Pik1567 was engineered and the T7 promoter attenuation strategy was applied to its second and third genes. A 5-fold boost, from 20 mg L⁻¹ to 100 mg L⁻¹, in the titer of its tetraketide product was achieved.

1. Introduction

Modular polyketide synthases (PKS’s) are enzymatic assembly lines that form carbon-carbon bonds and set stereocenters during the environmentally-friendly synthesis of complex polyketides(Keatinge--Clay, 2017b; Nivina et al., 2019). The modules in these synthases house at least 3 domains - an acyltransferase (AT) that selects extender units, an acyl carrier protein (ACP) that shuttles these extender units and growing polyketide intermediates between enzymatic domains, and a ketosynthase (KS) that fuses extender units with polyketide intermediates (Fig. 1a).(Keatinge-Clay, 2012) Modules can also house ketoreductase (KR), dehydratase (DH), and enoylreductase (ER) domains that help set the chemistries of the α- and β-positions of intermediates. A thioesterase (TE) domain in the terminal module usually controls the cyclization or hydrolysis of the full-length polyketide chain (Horsman et al., 2016).

Fig. 1.

Natural and engineered modular PKS’s. a) The Pikromyein PKS, colored both with the updated and traditional module boundary, biosynthesizes the Pikromycin precursor Narbonolide. Unlabeled circles and half-circles represent acyl carrier protein (ACP) domains and docking domain (DD) motifs, respectively, b) The engineered synthases Pik127 and Pik167, each comprised of 2 polypeptides, produce their anticipated triketide lactones(Miyazawa et al., 2021). The PikAIII/PikAIV DD motifs are present in both engineered synthases.

Although more than three decades have passed since the first modular PKS was sequenced, scientists are still learning how to rationally engineer them to generate products for industrial and pharmaceutical applications(Barajas et al., 2017; Cortes et al., 1990; Donadio et al., 1991; Kao et al., 1994; Klaus and Grininger, 2018; Su et al., 2022). The field has been aided by engineered strains of Escherichia coli such as E. coli K207-3 that can produce preparative quantities of products like the Erythromycin precursor, 6-deoxyerythronolide B (6-dEB)(Lau et al., 2004; Murli et al., 2003; Pfeifer et al., 2001). This strain harbors the promiscuous Bacillus subtilis Surfactin phosphopantetheinyl transferase, Sfp, to activate ACP domains of expressed PKS’s as well as Streptomyces coelicolor propionyl-CoA ligase and propionyl-CoA carboxylase (PCC) to convert propionate supplied to the media into the extender unit (2S)-methylmalonyl-CoA. By expressing these genome-encoded genes as well as plasmid-encoded PKS genes under the control of the strong T7 promoter, 200 mg of 6-dEB can be produced per liter of shake flask culture(Lau et al., 2004). However, engineered PKS’s have produced orders of magnitude less polyketide in this platform(Menzella et al., 2005).

Recently, the PKS module boundary was updated as downstream rather than upstream of KS to reflect how domains collaborate and evolutionarily co-migrate(Keatinge-Clay, 2017a; Miyazawa et al., 2020; Zhang et al., 2017). Our lab used this boundary to construct the triketide lactone synthases, Pik127 and Pik167, from modules of the Pikromycin PKS (Fig. 1b) (Miyazawa et al., 2021). These engineered synthases, which serve as representatives of PKS’s programmed to access designer polyketides, are highly functional, generating preparative quantities of their expected enantiomeric products from E. coli K207-3 grown in shake flasks. In these studies, the 2-polypeptide version of Pik127 produced 20-fold more triketide lactone compared to the 1-polypeptide version. This was hypothesized to be due to the better expression of its shorter polypeptides. However, the expression of multiple polypeptides presents the new challenge of tuning their stoichiometry.

We sought to employ attenuated versions of the T7 promoter to decrease the expression of highly-expressed, smaller PKS polypeptides in order to tune polypeptide stoichiometry and boost polyketide production. Since mutations to the T7 promoter and their effects on T7 RNA polymerase activity have been reported, we could use these mutations to optimize the production of the 2-polypeptide Pik167 (Fig. 2a-c). (Imburgio et al., 2000) A C-to-T swap at the –12 position resulted in a 1.8-fold increase in titer. A further 1.5-fold increase in production was obtained by increasing the concentration of propionate in the media from 20 to 80 mM. We also constructed the 3-polypeptide tetraketide synthase Pik1567 and optimized its activity by varying the strengths of the T7 promoters controlling the expression of its 2 shorter polypeptides. Tetraketide production was boosted 5-fold (to 100 mg L⁻¹) through a C-to-G swap at the –5 position of the promoter controlling production of the smallest polypeptide.

Fig. 2.

The 2-polypeptide Pik167 triketide lactone synthase, a) The Pik167 polypeptides, 16^N and ^C67, are encoded by pTM4 and pTM5, respectively, b) An SDS-PAGE gel shows polypeptide levels in the soluble lysate from E. coli K207-3 transformed with pTM4 and pTM5 from the 6th day of polyketide production, c) The sequence of the T7 promoter regulating the expression of 16^N and ^C67 is shown, d) A time course of triketide lactone production by Pik167 reveals that levels plateau on the 6th day (30 mL scale with 20 mM propionate), e) An anti-His₆ Western blot of soluble lysate from E. coli K207-3 transformed with pTM4 (Lane 1), with empty vectors (Lane 2), and with pTM5 (diluted 80-fold) (Lane 3) shows the levels of 16^N and ^C67.

2. Materials and methods

2.1. Cloning and mutagenesis

The Pik167 expression plasmids, pTM4 and pTM5, were previously constructed(Miyazawa et al., 2021). To construct Pik1567, amplicons were obtained by polymerase chain reaction (PCR) with KOD DNA polymerase (Toyobo, Osaka, Japan) or the KAPA High Fidelity PCR System (Roche Diagnostics, USA) using Streptomyces venezuelae ATCC 15439 gDNA as a template (Table S1).(Xue et al., 1998) They were fused with vectors through Gibson assembly (New England Biolabs) to construct pRB1 and pRB2, the first 2 expression plasmids of Pik1567 (the 3rd plasmid being pTM5). The employed module boundary is located after the 10th residue following the conserved KS motif GTNAH (Table S2). (Miyazawa et al., 2020) Site-directed mutagenesis of the T7 promoters of pTM5 and pRB2 was performed via PCR using synthetic oligonucleotides (Millipore-Sigma, Table S3).

2.2. Polyketide production

Transformed E. coli K207-3 cells were shaken at 240 rpm in 5 mL LB media containing the appropriate antibiotics (50 mg L⁻¹ kanamycin for pTM5, 50 mg L⁻¹ streptomycin for pTM4 and pRB1, and 30 mg L⁻¹ chloramphenicol for pRB2) in 10 mL culture tubes at 37 °C overnight. These precultures were used to inoculate (0.3 mL for 30 mL scale, 3 mL for 300 mL scale) polyketide producing media (5 g L⁻¹, yeast extract, 10 g L⁻¹ casein, 15 g L⁻¹ glycerol, 10 g L⁻¹ NaC1, 100 mM potassium phosphate, pH 7.6) containing the appropriate antibiotics in a non-baffled Fernbach flask (250 mL for 30 mL scale, 2.8 L for 300 mL scale) covered with a milk filter disk (PBS Animal Health). Cells were shaken at 240 rpm at 37 °C until OD5₆₀₀ = 0.6, cooled to 19 °C, supplied with a final concentration of 0.1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and 20–100 mM sodium propionate and cultured (6 d for 30 mL scale, 10 d for 300 mL scale) at 19 °C. To monitor polyketide production of Pik167 and Pik1567, 500 μL of culture was mixed with the same volume of acetone and centrifuged for 10 min before analyzing the supernatant by HPLC [Waters 1525 HPLC system equipped with a Microsorb-MV 300-5 C₁₈ column (4.6 × 250 mm) (solvent A, water with 0.1% formic acid; solvent B, acetonitrile with 0.1% formic acid. 5–100% B for 15 min, 100% B for 3 min, flow rate: 1 mL min⁻¹)]. For accurate measurements of cultures at 300 mL scale, water was added to return culture volume to 300 mL before samples were taken (70 mL evaporates over 10 d).

2.3. SDS-PAGE gels and Western blots

To evaluate the protein expression levels of the Pik167 polypeptides, 16^N (275 kDa) and ^C67 (143 kDa), as well as the Pik1567 polypeptides, 15^N (342 kDa), ^C56^N (164 kDa), and ^C67 (143 kDa), 1.8 mL of culture broth was collected on the 6th day. After centrifugation (15,000 rpm, 1 min, 4 °C), the pellet was resuspended in lysis buffer (50 mM HEPES, 300 mM NaCl, and 1 mM TCEP, pH 7.5) and sonicated. After centrifugation (15,000 rpm × 50 min), 7.5 μL supernatant from each sample was applied to an SDS-PAGE gel. Pellets were washed twice with lysis buffer. Data analysis was performed with a Bio-Rad Gel Doc XR + Imaging System.

For Western blotting, proteins on SDS-PAGE gel were transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad, USA). The membrane was blocked in 10% nonfat milk powder in Tris-buffered saline-Tween 20 (TBST) for 1 h at 25 °C and incubated with the 6 × His tag primary antibody (Bio-Rad) (1:3000) overnight at 4 °C. After washing with TBST, the membrane was incubated with the horseradish peroxidase-conjugated secondary antibody (Bio-Rad) (1:20,000) for 1 h at 25 °C and imaged using ChemiDoc MP Imaging System (Bio-Rad).

2.4. LC/MS detection of polyketides

After 6 d incubation, 500 μL of culture broth was acidified with 10 μL concentrated perchloric acid and extracted [2 × 500 μL ethyl acetate (EtOAc)]. The extract was concentrated under vacuum, redissolved in 500 μL of 50:50% (v/v) methanol:water, and centrifuged (15,000 rpm, 10 min). LC/MS analysis was conducted using a ZORBAX Eclipse Plus C₁₈ column (2.1 × 50 mm) on an Agilent 6120 system (solvent A, water with 0.1% formic acid; solvent B, acetonitrile with 0.1% formic acid. 5–100% B over 12 min, flow rate: 0.8 mL min⁻¹). 5 μL of sample was injected. The triketide lactone, tetraketide lactone, and triketide pyrone were detected in positive mode, while the diketide was detected in negative mode.

2.5. Purification of the triketide and tetraketide lactones

Culture broths were adjusted to pH 3 with concentrated HCl and extracted twice with the same volume of EtOAc. Emulsions were separated through centrifugation (4000×g, 20 min, polypropylene bottles). Extracts were dried with MgSO₄, filtered, and concentrated in vacuo. Propionic acid was removed with a silica gel plug (3 × 5 cm, EtOAc: hexanes = 30:70), and purification was performed with a silica gel column (3 × 15 cm, EtOAc:hexanes = 35:65 for the triketide lactone and 3 × 15 cm, EtOAc:hexanes = 25:75 for the tetraketide lactone). The tetraketide was 89% pure based on the subsequent purification step. 3 mg of the powder containing the tetraketide was dissolved in 200 μL of methanol and injected onto a semi-preparative HPLC [Waters 1525 HPLC system equipped with a Microsorb 300-5 C₁₈ Dynamax column (250 × 10.0 mm) with a flow rate of 4 mL min⁻¹ (solvent A, water with 0.1% formic acid; solvent B, acetonitrile with 0.1% formic acid. 30–100% B for 15 min) to obtain 2.67 mg of pure tetraketide lactone for NMR characterization.

3. Results

3.1. Optimization of triketide lactone production

E. coli K207-3 cells transformed with pTM4 and T7-promoter variants of pTM5 were evaluated in 30 mL cultures (in 250 mL non-baffled shake flasks) over 6 d (Table 1).(Miyazawa et al., 2021) HPLC analysis showed that the area of the peak from the triketide product (λ = 247 nm) plateaued on the 6th day (Fig. 2d). The Pik167 variant with the 40% strength promoter yielded the optimal titer, 1.8-fold that of unoptimized Pik167 (Fig. 3, Data S1). The Pik167 variant with the 6% strength promoter was the only variant that showed decreased triketide production.

Table 1.

Measured strengths of mutated T7 promoters employed in this study(Imburgio et al., 2000).

Ί7 promoter variants	Relative promoter strength	Sequence
Wild type	100%	TAATACGACTCACTATAGGGGAA
–1T	33%	TAATACGACTCACTATTGGGGAA
–3T	27%	TAATACGACTCACTTTAGGGGAA
–3C	29%	TAATACGACTCACTCTAGGGGAA
–3G	21%	TAATACGACTCACTGTAGGGGAA
–4G	23%	TAATACGACTCACGATAGGGGAA
–5A	6%	TAATACGACTCAATATAGGGGAA
–5G	37%	TAATACGACTCAGTATAGGGGAA
–10C	31%	TAATACGCCTCACTATAGGGGAA
–12T	40%	TAATATGACTCACTATAGGGGAA
–12G	48%	TAATAGGACTCACTATAGGGGAA
–13T	57%	TAATTCGACTCACTATAGGGGAA
–15T	71%	TATTACGACTCACTATAGGGGAA
–16G	14%	TGATACGACTCACTATAGGGGAA

Fig. 3.

Optimizing Pik167 titers through T7 promoter attenuation. Triketide lactone production and polypeptide expression levels for the Pik167 variants are shown (30 mL scale with 20 mM propionate). Each variant contains a different mutation to the T7 promoter (measured strengths in parentheses, see Table 1) controlling the expression of the smaller polypeptide, ^C67. Measurements of polyketide production were obtained from biological triplicates (Data S1, error bars show standard deviation), and the corresponding SDS-PAGE gels were also analyzed in triplicate (Data S2).

Measurements of the expression levels of the Pik167 polypeptides from SDS-PAGE gels show that decreases in promoter strength are correlated with decreased ^C67 expression and increased 16^N expression (Fig. 3). These measurements were possible since the levels of the degradation products of 16^N are insignificant compared to ^C67 (Fig. 2e and S1a). Measurements could not be made as accurately from Western blots due to high background from the relatively high expression levels of ^C67 (Fig. S1b). Analysis of SDS-PAGE gels containing serial dilutions of unmutated Pik167, Pik167 employing the 40% strength promoter (–12T), and Pik167 employing the 14% strength promoter (–16G) show their 16^N:^C67 stoichiometries to be 1:40-70, 1:16-20, and 1:3-7, respectively (pellets from centrifuging the lysates contain negligible quantities of the 2 polypeptides) (Figs. S1a and S2, Data S2).

The Pik167 variant with the 40% strength promoter was observed to produce 1.5-fold more triketide when the concentration of sodium propionate was increased from 20 mM to 80 mM (Fig. 4a, Data S1). Curiously, yields from unoptimized Pik167 did not increase under the same conditions (Fig. 4b). Each Pik167 variant generated diketide and triketide byproducts, with the 6% strength variant generating a larger proportion of diketide (Fig. S3) (Hughes et al., 2012; Miyazawa et al., 2021).

Fig. 4.

The effect of propionate concentration on triketide lactone titers, a) The concentration of propionate in the media (30 mL scale) affects the productivity of optimized Pik167 (with 40% strength promoter), b) Production by unoptimized Pik167 slightly decreases with increasing concentrations of propionate (30 mL scale), c) A time course of production by unoptimized Pik167 in media containing 20 mM propionate (300 mL scale) shows that levels plateau on the 10th day. d) The productivities of unoptimized and optimized Pik167 with either 20 or 80 mM propionate are shown (300 mL scale). Triplicate measurements were made, and error bars show standard deviations (Data S1).

To scale up production, culture volumes were increased to 300 mL in 2.8 L non-baffled shake flasks (Fig. 4c). Cells were shaken for 10 d, as triketide production does not plateau until then at this scale. The 40% strength variant produced 791 mg L⁻¹, a 2.6-fold increase compared to unoptimized Pik167 (Fig. 4d, S4, and S5a). Silica gel chromatography afforded 627 mg of pure triketide lactone (79% isolated yield) (Fig. S6).

3.2. Construction of a tetraketide synthase and optimization of its polyketide production

To test the T7 promoter tuning strategy on a more complex engineered PKS, we constructed the tetraketide synthase Pik1567 from the 1st, 5th, 6th, and 7th modules of the Pikromycin PKS (F 5a–b). To construct the plasmid expressing the first polypeptide, 15^N, the updated module boundary was employed such that the 10th residue following the PikKS1 GTNAH motif was connected with the 11th residue following the PikKS4 GTNAH motif. This engineered PKS produces the expected tetraketide lactone, as confirmed by high resolution mass spectrometry (HRMS) of the E. coli K207-3 culture broth extract (observed: m/z = 213.1479 [M + H]⁺, calculated m/z = 213.1485 [M + H]⁺; −2.81 ppm) (Fig. S7) and NMR spectroscopy of the purified compound (Figs. S5b-c and S8-S10).

The expression level of each polypeptide (15^N, ^C56^N, and ^C67) was assessed through SDS-PAGE gel analysis (Fig. 5c and S11, Data S2). Partially due to the higher copy number of pET28b compared to pACYCDuet-1, ^C67 expresses at a level 15–19 times higher than ^C56^N. The 1st polypeptide, 15^N (342 kDa), is expressed at a lower level (3–5 times less than ^C56^N, 66–79 times less than ^C67). After 6 d incubation in a 30 mL volume, the tetraketide titer from E. coli K207-3 harboring Pik1567 is 20 mg L⁻¹ (Data S1). Examining several variations of the T7 promoter regulating ^C67, the 37% strength promoter was shown to be optimal, yielding a 5-fold boost in tetraketide production compared to the unoptimized Pik1567 (Fig. 5c). Further SDS-PAGE analysis of the Pik1567 variants showed that the higher producers have similar levels of ^C56^N and ^C67 (1:1.2–1.8 for the 37% strength promoter), although 15^N still expresses at a lower level (14–29 times less than ^C56^N, 23–10 times less than ^C67) (Fig. S11). Interestingly, 2-plasmid combinations yielding 15^N + ^C56^N, 15^N + ^C67, or ^C56^N + ^C67 indicated that shunt products such as triketide lactone and pyrone can be produced by 15^N + ^C67 and ^C56^N + ^C67 through extender unit decarboxylation and domain-skipping (Figs. S12 and S13). We also mutated the T7 promoter regulating expression of ^C56^N while keeping ^C67 expression under the control of the 37% strength promoter (Fig. 5d). However, decreases in the strength of this promoter led to decreases in tetraketide titers.

Fig. 5.

Promoter optimization for the 3-polypeptide Pik1567. a) The 15^N, ^C56^N, and ^C67 polypeptides are encoded by pRB1, pRB2, and pTM5, respectively, b) A schematic shows tetraketide lactone synthesis by Pik1567. c) The tetraketide lactone titers and protein expression levels of the 3 Pik1567 polypeptides resulting from mutations of the T7 promoter regulating the expression of ^C67 are compared (30 mL scale with 80 mM propionate), d) The tetraketide lactone titers of Pik1567 variants in which the 37% strength promoter controls the expression of ^C67 and the strength of the promoter controlling the expression of ^C56^N is varied are compared (30 mL scale with 80 mM sodium propionate), e) The tetraketide lactone titers of unoptimized and optimized Pik1567 (37% strength promoter controlling ^C67 expression) are compared (300 mL scale with 80 mM propionate). Triplicate measurements were made. Error bars show standard deviations (Data S1).

As with the 30 mL scale, tetraketide production at the 300 mL scale showed a 5-fold boost in titer for Pik1567 with the 37% strength promoter controlling ^C67 expression compared to unoptimized Pik1567 (100 vs. 20 mg L⁻¹) (Fig. 5e and S5b). Silica gel chromatography from extract obtained from a 1 L growth yielded 75.5 mg of powder containing 89% pure tetraketide lactone (Fig. S6).

4. Discussion

Much remains to be learned about how PKS’s can be rationally engineered(Kushnir et al., 2012; Massicard et al., 2020). To produce a desired polyketide in good yield, the design must take into account many factors, not the least of which are the constraints imposed by the host(Park et al., 2020). While E. coli K207-3 is one of the most practical hosts, little is known about the processes that occur to convert long stretches of often GC-rich DNA into functional polyketide assembly lines or which of these processes present the biggest obstacles to good titers (Murli et al., 2003). The processes that cause some degradation of 16^N but not ^C67 must also be better understood. The general correlation between longer genes and lower polypeptide expression is suggestive that better yields are attainable through dividing engineered PKS’s into as many polypeptides as possible (Gokhale et al., 1999; Lowry et al., 2013; Miyazawa et al., 2021).

Our lab was surprised to observe that E. coli K207-3 cells expressing Pik167 and producing hundreds of milligrams of triketide lactone per liter of culture possess a highly skewed 16^N:^C67 ratio of 1:40-70, as measured by SDS-PAGE analysis. We were further surprised that when the strength of the promoter regulating ^C67 expression was optimized that the molar ratio was still highly skewed at 1:16-20. Perhaps ^C67 (PikAIV) does not dock as well with 16^N as it does its natural partner, ^C56^N (PikAIII). Thus, one motivation for engineering the tetraketide lactone synthase Pik1567, composed of 15^N, ^C56^N, and ^C67, was that at least ^C56^N (PikAIII) and ^C67 (PikAIV) might more naturally dock with one another.

Unoptimized Pik1567 yields its anticipated tetraketide at a titer of 20 mg L⁻¹. As with Pik167, SDS-PAGE analysis revealed that ^C67 expresses at a higher level than the other polypeptides in the synthase. That it expresses 15–19 times better than ^C56^N, which has a molecular weight only 14% greater than ^C67, may be due to the higher copy number of pET28b relative to pACYCDuet-1. Variations in the T7 promoter regulating ^C67 expression revealed that the 37% strength promoter elicited the optimal boost in production. SDS-PAGE analysis of this Pik1567 variant showed similar levels of expression for ^C56^N and ^C67 (1:1.2–1.8). Perhaps this indicates that these native polypeptides dock with one another in Pik1567 equivalent to how they dock with one another in the natural Pikromycin PKS. That the overall titer is still only 100 mg L⁻¹ could indicate that ^C56^N does not dock with 15^N as well as it naturally does with ^C345^N (PikAII). The titers of 791 mg L⁻¹ and 100 mg L⁻¹ are the highest reported for engineered triketide and tetraketide synthases, respectively. However, if the polypeptides of Pik167 or Pik1567 were engineered to interact as they do within the Pikromycin PKS, tuning their expression to equivalent levels may result in higher titers still.

When Menzella and coworkers combined 14 modules with the traditional boundary into 154 engineered PKS’s and expressed them in E. coli K207-3, the 15 triketide lactones observed were produced at relatively low titers (0.01–10 mg L⁻¹)(Menzella et al., 2005). Our lab has now developed a platform to combinatorially construct PKS’s using modules with the updated boundary (manuscript in preparation). Many of the engineered PKS’s produce their anticipated triketides, tetraketides, and pentaketides. As the expression of each polypeptide in these synthases is regulated by the T7 promoter, the attenuation strategy described here will be employed to optimize their stoichiometries and thus the titers of their polyketide products. Through the better design of PKS’s, increased understanding of E. coli K207-3 as a host, and promoter optimization techniques, the dream of producing high titers of designer polyketides is becoming reality.

Data availability

Data will be made available on request.