Paternal preconception alcohol consumption increased Angiotensin II‐mediated vasoconstriction in male offspring cerebral arteries via oxidative stress‐AT1R pathway

Abstract

Alcohol consumption is popular worldwidely and closely associated with cardiovascular diseases. Influences of paternal preconception alcohol consumption on offspring cerebral arteries are largely unknown. Male rats were randomly given alcohol or water before being mated with alcohol‐naive females to produce alcohol‐ and control‐sired offspring. Middle cerebral artery (MCA) was tested with a Danish Myo Technology wire myograph, patch‐clamp, IONOPTIX, immunofluorescence and quantitative PCR. Alcohol consumption enhanced angiotensin II (AngII)‐mediated constriction in male offspring MCA mainly via AT1R. PD123,319 only augmented AngII‐induced constriction in control offspring. AngII and Bay K8644 induced stronger intracellular calcium transient in vascular smooth muscle cells (VSMCs) from MCA of alcohol offspring. L‐type voltage‐dependent calcium channel (L‐Ca²⁺) current at baseline and after AngII‐stimulation was higher in VSMCs. Influence of large‐conductance calcium‐activated potassium channel (BK_{C a}) was lower. Caffeine induced stronger constriction and intracellular calcium release in alcohol offspring. Superoxide anion was higher in alcohol MCA than control. Tempol and thenoyltrifluoroacetone alleviated AngII‐mediated contractions, while inhibition was significantly higher in alcohol group. The mitochondria were swollen in alcohol MCA. Despite lower Kcnma1 and Prkce expression, many genes expressions were higher in alcohol group. Hypoxia induced reactive oxygen species production and increased AT1R expression in control MCA and rat aorta smooth muscle cell line. In conclusion, this study firstly demonstrated paternal preconception alcohol potentiated AngII‐mediated vasoconstriction in offspring MCA via ROS‐AT1R. Alcohol consumption increased intracellular calcium via L‐Ca²⁺ channel and endoplasmic reticulum and decreased BK_Ca function. The present study provided new information for male reproductive health and developmental origin of cerebrovascular diseases.

Paternal preconception alcohol consumption increased angiotensin II (Ang II)‐mediated middle cerebral artery constriction in male offspring via oxidative stress‐AT1R pathway. Paternal preconception alcohol consumption increased the function of L‐type calcium channel and the content of endoplasmic reticulum calcium and decreased the function of large‐conductance calcium‐activated potassium channel (BKCa), which resulted in the increased constriction in the cerebral artery from alcohol offspring. Paternal preconception alcohol consumption affected growth and metabolism in offspring.

1. INTRODUCTION

The WHO indicates that more than half of people consume alcohol in the world. ¹ It is well‐known that alcohol consumption could increase risks of cardiovascular diseases. ² Increasing trends in stroke incidence have been noted among younger adults. ³ During the past two decades, developmental origin of cardiovascular diseases has attracted much attention. Not only maternal alcohol during pregnancy augmented the prevalence of cardiovascular diseases in offspring but also paternal alcohol during pregnancy and postnatal life potentiated cardiovascular risks. ⁴ , ⁵ Previous studies demonstrated that paternal preconception alcohol consumption could affect cognition systems and the development of brain in offspring; however, effects of paternal preconception alcohol consumption on central circulation system in offspring are largely unknown. ⁶

Alcohol drinking can increase risks of cerebrovascular diseases in adults. ⁷ Maternal alcohol consumption decreased vasodilation but did not change vasoconstriction in offspring cerebral arteries, which resulted in poor brain oxygenation. ⁸ , ⁹ Whether paternal preconception alcohol consumption may affect offspring cerebral arteries is unknown.

Ion channels, such as L‐type voltage‐dependent calcium channels (L‐Ca²⁺), large‐conductance calcium‐activated potassium channels (BK_Ca) and protein kinase C (PKC), play an important role in regulating cerebral vessel tone. ¹⁰ Calcium release from endoplasmic reticulum via IP₃ receptors and ryanodine receptors participates in the regulation of cerebrovascular tone. ¹⁰ Alcohol consumption could affect L‐Ca²⁺, BK_Ca and PKC in the cerebral arteries in adults. ¹¹ , ¹² Maternal alcohol consumption in pregnancy impairs activities of BK_Ca in offspring cerebral artery. ¹³ In our preliminary and initial testing, altered vascular tone was noted in the central arteries of paternal preconception alcohol offspring. Thus, the present study determined underlying mechanisms related to L‐Ca²⁺, BK_Ca and PKC in offspring cerebral arteries.

Renin‐angiotensin system (RAS) existing in cerebral vasculature regulates blood flow. ¹⁰ , ¹⁴ Alteration inRAS is strongly associated with vascular diseases. ¹⁵ RAS overactivation causes hypertension and significantly increases the risk of stroke. ¹⁶ , ¹⁷ Angiotensin II (AngII), the most important component, can easily pass through blood–brain barrier. ¹⁸ Alcohol consumption could increase concentrations of AngII and RAS functions. ¹⁹ , ²⁰ Some reports showed that maternal alcohol consumption during pregnancy increased activities of RAS in the offspring renal vasculature but did not influence responses to AngII in cerebral arteries. ⁸ , ²¹ This study would detect influence of paternal preconception alcohol consumption on AngII‐mediated vasoconstriction in the offspring middle cerebral arteries (MCAs).

Additionally, oxidative stress could not be ignored in cerebrovascular diseases and in the injury caused by alcohol consumption. ²² , ²³ Paternal alcohol consumption caused oxidative stress and damage in father reproduction systems as well as in the offspring hippocampus. ²⁴ , ²⁵ Mitochondria is a major source of oxidative stress. ²⁶ This study hypothesised that paternal preconception alcohol consumption might affect offspring cerebral blood vessels via oxidative stress. The data gained would provide new information on male reproductive health and developmental origins of cerebrovascular diseases.

2. METHODS

2.1. Animals

Two‐month‐old male Sprague–Dawley rats were randomly and intragastrically given 0.67 g/kg alcohol (equal to 40 g of pure alcohol per day for a 60‐kg man, n = 15) or distilled water (n = 15) daily for 2 months. Then the males were allowed to breed with untreated female rats (12 weeks of old). The presence of a copulation plug was presumed to indicate mating. Pregnant rats were free access to distilled water and gave birth naturally. The offspring exposed to paternal preconception alcohol was signed as the alcohol group and others were as the control group. At 4 weeks old, the male offspring was weighed and food consumption was recorded weekly. Three‐month‐old offspring were sacrificed under anaesthesia (sodium pentobarbital, 40 mg/kg, intraperitoneally), and the brain and body weight were measured, and cerebral arteries were collected. The experimental procedure was approved by Institutional Animal Care Committee of Soochow University and met the criteria of the Guide for the Care and Use of Laboratory Animals.

2.2. Measurement of blood pressure

Blood pressure was measured via CODA™ noninvasive blood pressure system. An occlusion tail cuff is inflated to momentarily impede blood flow at 250 mmHg and deflated slowly by 8 mmHg/s. As the blood returns to the tail, the volume pressure recording (VPR) cuff measures the tail swelling that results from arterial pulsations from the blood flow. Systolic blood pressure was measured automatically at the first appearance of tail swelling, and diastolic blood pressure was measured when the rate of swelling stops. Mean arterial pressure is equal to one‐third systolic blood pressure plus two‐thirds diastolic blood measure.

2.3. Measurement of lactic acid and AngII

Blood was collected from the abdominal aorta of anaesthetised rats and centrifuged immediately in a centrifuge (3600 rpm for 15 min). The supernatant was collected, snap frozen in liquid nitrogen and stored at −80°C. Assays were performed using the lactic acid assay kit and the AngII assay kit (R21655, Yuanye Inc, Shanghai, China; MM‐0211R2, Grennleaf Inc, Suzhou, China).

2.4. Measurement of vascular tone

The MCAs were isolated gently under a stereomicroscope in pre‐oxygenated HEPES‐PSS solution (mmol/L: NaCl 141.85, KCl 4.70, MgSO₄·7H₂O 1.70, EDTA 0.51, CaCl₂·2H₂O 2.79, KH₂PO₄ 1.17, glucose 5.00, HEPES 10.00, pH = 7.40 with NaOH). The 2‐mm‐long ring was fixed in DMT (Danish Myo Technology A/S) chamber using two 40‐μm stainless wires. Potassium chloride solution (KCl, 120 mmol/L) was used to measure optimal resting tension, and this tension value was used as a reference value before the drug response. After 30‐min stabilisation, different reagents were added to test the vessel tone. The reagents included AngII (10⁻¹⁵–10⁻⁶ mol/L), losartan (los, AT1 receptor antagonist, 10⁻⁵ mol/L), PD123,319 (AT2 receptor antagonist, 10⁻⁵ mol/L), Bay K8644 (L‐Ca²⁺ channel agonist, 10⁻⁶ mol/L), nifedipine (nife, L‐type voltage‐dependent calcium channel blocker, 10⁻⁵ mol/L), IbTX (BK_Ca channel inhibitor, 10⁻⁷ mol/L), phorbol 12,13‐dibutylate (PDBu, PKC activator, 10⁻¹³‐10⁻⁶ mol/L), GF 109203X (GF, pan PKC antagonist, 10⁻⁶ mol/L), 2‐aminoethyl diphenylborinate (2‐APB, IP3R inhibitor, 10⁻⁵ mol/L), ryanodine (ryr, ryanodine receptor inhibitor, 10⁻⁵ mol/L), thapsigargin (TG, sarcoendoplasmic Ca²⁺‐ATPase inhibitor,10⁻⁶ mol/L), 4‐hydroxy‐2,2,6,6‐tetramethylpiperidine‐1‐oxyl (tempol, superoxide dismutase mimic, 10⁻⁶ mol/L), 2‐tenoyltrifluoroacetone (TTFA, electronic transmission chain complex II inhibitor, 10⁻⁵ mol/L) and caffeine (ryanodine receptor agonist, 10 mmol/L). All reagents were purchased from Sigma or Selleck.

2.5. Isolation of single vascular smooth muscle cell (VSMC)

MCAs were obtained under a stereomicroscope in PSS (mmol/L: NaCl 120.9, NaHCO₃ 25.0, KCl 4.6, KH₂PO₄ 1.2, K₂HPO₄ 1.2, MgCl₂ 1.2, CaCl₂ 2.8 and glucose 5.0, pH = 7.40 with NaOH). The chopped rings were digested in PSS solution containing papain (4 mg/mL), ABV (2 mg/mL), and DTT (1 mg/mL) at 37°C for 25 min. Tissue was triturated using a wide‐bore glass pipette to release single VSMC. Separated smooth muscle cells were stored at 4°C and used within 6 h.

2.6. Whole‐cell calcium channel current recording

Following adherence, cells with elongated morphology and good refractive index were selected for the experiments. The isolated smooth cells were continuously superfused with a bath solution (mmol/L: BaCl₂20, EGTA 10, glucose 10, MgCl₂1.0, choline‐Cl 124; pH 7.3 with TEA‐OH). The pipette (3 to 5 MΩ) was filled with a pipette solution (mmol/L: caesium glutamate 130, MgCl₂1.5, HEPES 10, EGTA 10, glucose 10, Na₂ATP 3, Na₂GTP 0.1 and MgGTP 0.5; pH 7.3 with CsOH). Whole‐cell Ca²⁺ channel currents were recorded in conventional whole‐cell configuration voltage‐clamp mode using an Axon Multiclamp 700B with Clampex 10.1 and normalised to cell capacitance as picoampere per picofarad. Voltage‐dependent Ca²⁺ channel current densities were assessed using standard pulse protocols and a patch‐clamp station. AngII (10⁻⁶ mol/L) was added when measuring changes in calcium channel currents.

2.7. Whole‐cell potassium channel current recording

Cells with elongated morphology and good refractive index were selected for the experiments. The PSS solution was replaced with bath solution (mmol/L: NaCl 135, KCl 5, MgCl₂ 1, CaCl₂ 1.8, glucose 10, and HEPES 10, pH = 7.4 with NaOH). An electrode (resistance 3–5 MΩ) filled with pipette internal solution (mmol/L: K‐Asp 110, KCl 30, EGTA 1, Na₂ATP₃, CaCl₂ 0.85, glucose 10 and HEPES 10; pH = 7.2 with KOH) was sealed tightly with the cell membrane. Whole‐cell potassium channel currents were obtained by series of 500 ms depolarizing voltage steps (from −60 mV to +70 mV, gradient 10 mV) using an Axon Multiclamp 700B with Clampex 10.2. IbTX (BK_Ca inhibitor, 10⁻⁷ mol/L) was also added to the same cells, and the amplitude differences with or without IbTX were considered as BK_Ca channel currents.

2.8. Calcium imaging

Single smooth muscle cells were placed in a glass dish and allowed to adhere to the bottom of dish. After adherence, the cells were incubated with calcium indicator fura‐2 AM (2 mmol/L) for 30 min. The excess indicator solution was then washed twice using PSS solution. The calcium‐free PSS solution was replaced prior to measurement, and the fluorescence values of fura‐2AM at 340 and 380 nm were recorded continuously before and after the addition of caffeine (10 mmol/L) using IONOPTIX.

2.9. Total internal reflection fluorescence microscopy (TIRFM)

Following adherence of single smooth cells, the cells were stained with intracellular calcium indicator fluo‐3 AM (2 mmol/L) at room temperature for 30 min, then the cells were washed three times by PSS and replaced with Tyrode's solution (mmol/L: KCl 4.0, CaCl₂ 2.0, NaCl 135, MgCl₂ 1.0, HEPES 10.0, NaH₂PO₄·2H₂O 1.2 and glucose 10.0, pH = 7.4 with KOH). Representative single‐cell images, traces of Ca²⁺ responses to AngII (10⁻⁶ mol/L) and Bay K8644 were recorded with a TIRFM electron‐multiplying charge‐coupled device imaging system.

2.10. Transmission electron microscopy

The MCA was cut into 2‐mm sections and incubated in 2.5% glutaraldehyde solution at 4°C overnight. The sections were soaked into osmium acid for an hour and then dehydrated by each gradient pyruvate (from 30%, 50%, 70%, 80%, 90% and 100% in order) for 15 min. After dehydrated completed, the sections were infiltrated with encapsulant for 2 h and the fixed was baked in oven for 1 week. The fixed was cut into 90 nm and placed on bress mesh in the ultra‐thin slice. The slices were dyed by lead nitrate and observed in electron microscope.

2.11. Detection of superoxide anion (O₂ ⁻) in MCA

The MCA rings embedded in Tissue‐Tek OCT compound were frozen in −80°C for 2 h, then cut into 7‐μm‐thick sections with a cryostat at −20°C and placed on glass slides. Dihydroethidium (DHE) was stained to each slice for 30 min in the dark and then washed by PBS. The 4,6‐diamino‐2‐phenylindole probe (DAPI) was used to evaluate the nuclei distribution. A fluorescent laser scanning microscope was used to detect and record the fluorescence between the control group and the alcohol group.

2.12. Immunofluorescence

The MCA slices obtained above were incubated with AT1R antibody at 4°C overnight. The corresponding secondary antibody rabbit antigoat IgG(H + L) was incubated for an hour in dark. The slices were visualised using a fluorescent laser scanning microscope. The DAPI was used to evaluate the nuclei distribution. The AT1R fluorescence is compared between the control and alcohol group, as well as between the vessels exposed to 1% and 21% O₂ for 72 h.

2.13. Cell culture

The rat aorta smooth muscle cell line (A7R5) was maintained in the A7R5 medium (CM‐0316, Pricella Inc, Wuhan, China) at 37°C in a humidified incubator filled with 5% CO₂. While the cells pull with the petri dish (≥90%), the cells were subcultured in different petri dish. Cells were randomly cultured in the 1% O₂ (the hypoxic cells) or in the 21% O₂ (the control cells) for 48 h to detect the expression of mRNA. The cells also were randomly cultured in the PBS, AngII (10⁻⁶ mol/L) and AngII (10⁻⁶ mol/L) with losartan (10⁻⁵ mol/l) for 48 h to detect the related expression of mRNA and for 72 h to detect the related expression of protein.

2.14. Quantitative PCR

Total RNA was extracted from cerebral arteries with Plus TRIzol (TaKaRa, Japan). The purity and integrity of RNA were confirmed by NanoDrop (Thermo) and agarose gel. The template RNA was reversed transcribed by using the first strand cDNA synthesis kits (Takara, Cat#6210A). All gene sequences were referenced to the UCSC Genome Browser, and primer sequences were shown in Table 1. Quantitative polymerase chain reactions were performed on a Bio‐Rad MyiQ2 Thermal Cycler Q‐PCR machine. Interest gene expression levels were firstly normalised against Gapdh as internal control and calibrated with the normal cDNA. The ratio of relative mRNA expression was calculated using the 2^−ΔΔCt method.

TABLE 1.

Gene primer sequences.

Gene	Forward primer	Reverse primer
Gapdh	GACATGCCGCCTGAGAAAC	AGCCCAGGATGCCCTTTAGT
Hk1	GACGAACCTGGACTGTGGAATCTTG	TCCTCTTCACCGCATCCCTCA
Pfkm1	CGCACACTCTTACCGCCTAT	CTCCTCGGCTGTGATCTTCC
Pkm	GTGCCGCCTGGACATTGACTC	ATTCAGCCGAGCCACATTCATCC
Pdha1	GGACGAAGAGGAGGTTGTGCTAAAG	AACGATGCCATTGCCTCCATAGAAG
Agtr1a	CTTCTCAATCTCGCCTTGGC	AAGGAACACATGGCGTAGA
Agtr1b	GGTTCAAAGCCTGCAAGTGA	CGGTTAACAGTGGCTTTGCT
Agtr2	TGGCTTCCCTTCCATGTTCT	TCTCTCTCTTGCCTTGGAGC
Cacna1c	CTTCAAACGTGGCCACAGAC	GCCCGAACTATTGTGACTCC
Cacnb2	ATGGCCATCTCATTCGAGG	ATGCTGTAGCCTCATGTTCTCTAG
Cacnb3	CTGGATGAGAACCAGCTGGAC	TCATCCGAGGGCATCAAACTG
Cacna1h	CTACCTTATGACGACAACAATGC	GCATTGTAGACAGCAAGTACTT
Kcnma1	GCTGACTGCAGCTGGATTCAT	CTGTAGACATTGTGACCATGAG
Kcnmb	CTAAATGACTGTTGCCTCCTG	AGGATGTAGTAAGTGATGGCGG
Prkca	AATTCATCGCCCGCTTCTTC	CACAGAAGGTAGGGCTTCCA
Prkcb	GGGCATCATTTACCGTGACC	GGGGCAATGTAGTCTGGAGT
Prkcd	CCACCTTCTGTTCTGTGTGC	CCTTGAATCGGTGAGGCATG
Prkce	AGCCTCGTCGTCTACTGATG	ATCCTTACCCTTGAGCTCGG
Prkcq	GCTAATGGCTGAAGCGCTAGC	TCCACCATCGTGCACTCGAC
Itpr1	CCTGTTGACCTAGACAGCCA	AGAACATCCACGAGCACAGA
Itpr2	GCAACAACTACCGGATAGTC	AGGAAGGTGTGGGCTAAGTC
Itpr3	CTGACAGAGGAGACCAAGCA	GCCCACTGCCAGGTTGAAGG
Ryr1	GTGACTCCATTTCTGACAGCTC	AGGACTCAAAGACACCCTGC
Ryr2	CCGGTCTTCAACTGATAAGCTG	GCTTAGAGGCAGGGTGTATGG
Ryr3	GAGGATATTCTACGAAGCTGGG	TCCACTCTCCAAAGAGACCTG
Atp2a1	GCAGATCATCAAACTCACGGC	TCAAGATTGCTGTAGCCTTGG
Atp2a2	GGAGTATGAACCTGAAATGGGC	CCAGACTGCAATGCAAATGAG
Atp2a3	GTGGGTCATCAACATCGGA	AACAGCGTGTGATACAGGCA
Sdha	AACACTGGAGGAAGCACACC	GCAACTCGAGTCCCTCACAT
Sdhb	GGAGGGCAAGCAACAGTATC	TGCAATTGCTTTTCCTGGAT
Sdhc	TTGGTTCTTGCAGTGCTGTC	CAAGAAGCAGCACAAAGCTG
Sdhd	CACATCCACCTGTCACCAAG	AAGTAGCAAAGCCCAGCAAA

2.15. Data analysis

All data were presented as mean ± S.D. and analysed by GraphPad Prism 8. Normal distribution was assessed by Kolmogorov–Smirnov tests. Two‐sided unpaired t‐test was performed for comparisons between two different groups. Dose‐dependent response curves were analysed with two‐way ANOVA, with repeated measures followed by Bonferroni post hoc tests. P < 0.05 was considered statistically significance.

3. RESULTS

3.1. Growth and metabolism

Figure 1A shows that brain weight in alcohol offspring was lower than that in control offspring (control 2.202 ± 0.200 g, alcohol 2.066 ± 0.104 g, P < 0.05). Body weight of paternal alcohol offspring was significantly lower since 8 weeks old after birth compared with the control (Figure 1B). The ratio of brain to body weight was increased in alcohol group (Figure 1C). These results indicate that paternal preconception changed the growth and development in the offspring. There was no significant difference in food consumption between the two groups (Figure 1D). The mRNA expression of Pkm was increased, which was associated with glycolysis (Figure 1E). The plasma concentration of lactic acid was significantly increased in alcohol group compared to the control (control 2.571 ± 0.343 mmol/L, alcohol 3.092 ± 0.266 mmol/L, P < 0.05). These results suggest that abnormal growth in paternal alcohol offspring was associated with altered metabolism, especially glycolysis and lactic acid.

FIGURE 1.

Physical characteristics and metabolism indexes in male offspring. (A) Brain weight (N = 10–14 from 4 litters each group). (B) Body weight (N = 16–21 from 4 litters each group). (C) he ratio of brain to body weight (N = 9–13 from 3 litters each group). (D) Weekly food consumption per animal (number = 2–3 litters each group). (E) The mRNA expressions of glycolysis‐related genes (N = 8 from 4 litters each group). (F) The concentration of lactic acid in plasma (N = 6–7 from 3 litters each group). N, the number of male offspring. Data were presented as means ± S.D. and analysed by t‐test or two‐way ANOVA. *P˂0.05, ***P˂0.001. Control: the offspring exposed to paternal preconception water consumption. Alcohol: the offspring exposed to paternal preconception alcohol consumption.

3.2. Role of AngII and the receptors in regulating MCA tone

Figure 2A shows blood pressure was similar between control and alcohol group. KCl‐mediated maximal resting tension was comparable in the two groups (Figure 2B). The concentration of plasma AngII was higher in alcohol group than in control group (control 48.23 ± 14.42 ng/mL vs. alcohol 67.29 ± 15.70 ng/mL, P < 0.05) (Figure 2C). Figure 2D shows that concentration–response curves of AngII‐induced MCA constriction were left‐shifted in alcohol male offspring (Emax: control 52.34% ± 8.16%, alcohol 88.80% ± 21.32%, P < 0.05). Losartan blocked AngII‐mediated constriction in both groups. The decreased AngII‐mediated constriction by losartan was significantly higher in alcohol group compared with the control (Figure 2D). However, AT2 receptor inhibitor, PD123,319, enhanced AngII‐mediated constriction in control group rather than in alcohol group (Figure 2E). mRNA expressions of Agtr1a and Agtr2 were higher in the alcohol group, which might increase AngII‐mediated constriction (Figure 2F).

FIGURE 2.

Blood pressure and role of angiotensin II in male offspring. (A) The indexes of blood pressure (N = 8–9 from 4 litters each group). (B) KCl‐mediated constriction in the MCA (N = 14–15 from 4 litters each group). (C) The concentration of AngII in plasma (N = 6–7 from 3 litters each group). (D, E) AngII‐mediated constriction curve with or without losartan and PD 123,319 (N = 4–17 from 5 litters each group). (F) mRNA expression of AngII receptors (n = 4–11 with 4–7 mixtures of cerebral arteries from 12 offspring). N, the number of male offspring. n, the number of repeated measures using the mixtures. Data were presented as means ± S.D. and analysed by t‐test or two‐way ANOVA. *P˂0.05, **P˂0.01, ***P˂0.001. AngII, angiotensin II; MCA, middle cerebral artery.

3.3. Roles of ion channels and PKC in AngII‐mediated constriction

Incubation with nifedipine, a specific L‐Ca²⁺ inhibitor, could significantly diminish AngII‐mediated constriction in MCA from both groups, while the inhibition was significantly higher in alcohol group (Figure 3A). Figure 3A shows that AngII‐mediated intracellular calcium change was significantly stronger in alcohol group. In single smooth muscle cells, nifedipine blocked AngII‐mediated intracellular calcium changes and AngII‐mediated intracellular calcium levels in the presence of nifedipine were similar between control and alcohol group. Figure 3B shows that Bay K8644‐mediated intracellular calcium change was significantly higher in single smooth muscle cells from alcohol group.

FIGURE 3.

Role of L‐Ca²⁺ channels in regulating MCA vessel tone. (A) Cumulative concentration AngII‐mediated response curve (N = 4–17 from 5 litters each group) and AngII‐mediated intracellular calcium change in smooth muscle cells (VSMC) with or without nifedipine (number = 6–20 cells from 4 offspring each group). (B) BayK8644‐mediated calcium content in VSMC (number = 38–43 cells from 4–5 offspring). (C) Real‐time calcium current recordings with or without AngII. (D) Calcium channel current amplitude and the amplitudes at +20 mV of voltage‐dependent calcium channel currents with or without AngII (number = 5–9 cells from 4 offspring). (E) The protocol of the calcium recording. (F) mRNA expression of L‐Ca²⁺ (n = 4–8 with 4 mixtures of cerebral arteries from 12 offspring). N, the number of male offspring. n, the number of repeated measures using the mixtures. Data were presented as means ± S.D. and analysed by t‐test or two‐way ANOVA. *P˂0.05, **P˂0.01, ***P˂0.001. AngII, angiotensin II; MCA, middle cerebral artery; nife, nifedipine.

When comparing with the control, whole‐cell voltage‐dependent calcium channel currents in VSMC were much higher at the baseline in alcohol group. AngII‐mediated voltage‐dependent calcium channel currents were higher in alcohol group (Figure 3C). Figure 3D shows real‐time recordings of voltage‐dependent calcium channel currents at the baseline with or without AngII, as well as the amplitudes of voltage‐dependent calcium channel currents at +20 mV in both groups. Figure 3E shows the protocol of voltage‐dependent calcium channel currents. mRNA expressions of Cacna1c, Cacnb2 and Cacnb3 were increased in MCA of the alcohol group (Figure 3F). These results demonstrate that L‐Ca²⁺ plays an important role in the regulation of MCA vessel tone, and AngII‐increased constriction in the MCA of alcohol group was closely associated with L‐Ca²⁺.

IbTX, a BK_Ca (large‐conductance calcium‐activated potassium channels) inhibitor, enhanced AngII‐mediated constriction in both groups, indicating that BK_Ca plays a diastolic role in AngII‐mediated constriction (Figure 4A). Whole‐cell potassium channel current amplitude at the baseline was lower in alcohol group. IbTX could significantly inhibit potassium channel currents in both groups, and potassium channel currents with IbTX were similar between both groups (Figure 4A). mRNA expressions of Kcnma1 were lower, while Kcnmb was increased in alcohol offspring cerebral arteries (Figure 4B). The decreased vascular functions and expression of Kcnma1 might contribute to the potentiated AngII‐mediated constriction in the MCA of alcohol offspring.

FIGURE 4.

Role of BK_Ca and PKC in regulating MCA vessel tone. (A) Cumulative concentration AngII‐mediated response curve with or without IbTX (N = 4–17 from 4 litters each group) and potassium channel current with or without IbTX (number = 4–5 cells from 4 offspring). (B) Real‐time recordings of whole‐cell potassium channel current with or without IbTX. (C) The mRNA expression of BK_Ca subtypes α and β (n = 6–7 mixtures of cerebral arteries from 12 offspring). (D) Cumulative concentration AngII‐mediated response curve with or without GF109203X (N = 4–17 from 4 litters each group), PDBu‐mediated constriction curve (N = 8–16 from 4 litters each group), and mRNA expression of PKC subtypes (n = 8 with 4 mixtures of cerebral arteries from 12 offspring). N, the number of male offspring. n, the number of repeated measures using the mixtures. Data were presented as means ± S.D. and analysed by t‐test or two‐way ANOVA. *P˂0.05, **P˂0.01, ***P˂0.001. PDBu: phorbol 12,13‐dibutylate. AngII, angiotensin II; MCA, middle cerebral artery; PDBu, phorbol 12,13‐dibutylate; PKC, protein kinase C.

GF 109203X, a pan PKC inhibitor, could block AngII‐mediated contraction in both groups. There was no significant difference in PDBu‐mediated constrictions and in the inhibition effects by GF 109203X between two groups. Additionally, except Prkce, mRNA expressions of PKC subtypes α, β, δ and θ in offspring cerebral arteries were similar between both groups. These clarified that increased AngII‐mediated constriction in paternal preconception alcohol offspring MCA might not be via PKC.

3.4. Role of IP₃R, ryanodine receptor and Ca²⁺‐ATPase in AngII‐mediated constriction

Caffeine‐mediated MCA constriction and calcium transient in VSMC was significantly increased in alcohol group, demonstrating that intracellular calcium in endoplasmic reticulum was significantly higher in alcohol group (Figure 5A). 2‐APB (an IP₃ receptor inhibitor) and ryanodine (ryr, ryanodine receptor inhibitor) restrained AngII‐mediated constriction in both groups, and the inhibition effects were significantly stronger in alcohol group (Figure 5B). mRNA expressions of Itpr1 and Ryr2 were increased in alcohol offspring, while other subtypes were not significantly changed (Figure 5C). Increased intracellular calcium in endoplasmic reticulum might augment AngII‐mediated constriction.

FIGURE 5.

Role of intracellular calcium release from endoplasmic reticulum in regulating MCA vessel tone. (A) Caffeine‐mediated vascular tension (N = 12–15 from 4 litters each group) and calcium transient (including peak, peak height, Ca²⁺ rise velocity, and Ca²⁺ decay velocity) (number = 12–24 cells from 12 offspring). (B, C) Cumulative concentration AngII‐mediated response curve with or without 2‐APB, ryr, TG (N = 4–17 from 4 litters each group) and mRNA expressions of Itpr, Ryr, Atp2a (n = 4–7 with 4 mixtures from 12 offspring), respectively. N, the number of male offspring. n, the number of repeated measures using the mixtures. Data were presented as means ± S.D. and analysed by t‐test or two‐way ANOVA. *P˂0.05, **P˂0.01, ***P˂0.001. AngII, angiotensin II; 2‐APB: 2‐aminoethyl diphenylborinate; MCA, middle cerebral artery; ryr: ryanodine; TG: thapsigargin.

Thapsigargin, a specific Ca²⁺‐ATPase inhibitor, could significantly diminish AngII‐mediated constriction in MCA from both groups, while the inhibition was significantly stronger in alcohol group (Figure 5B). mRNA expressions of Atp2a2 and Atp2a3 were increased (Figure 5C). These results demonstrate that calcium in endoplasmic reticulum might be more abundant in alcohol group.

3.5. Role of reactive oxygen species (ROS) and mitochondria

There was more ROS in the MCA of alcohol offspring (Figure 6A). Incubation with tempol, a synthetic antioxidant, could significantly diminish AngII‐mediated constriction in MCA from both groups, while the inhibition was significantly higher in alcohol group (Figure 6B). Due to ROS is derived from electron transfer chain on mitochondria membrane, the mitochondria was less in number and appeared swollen, and mitochondrial cristae was missing in the alcohol offspring viewed by transmission electron microscope (Figure 6C). TTFA, a complex II inhibitor, reduced AngII‐mediated constriction in both groups and the inhibition effects were significantly stronger in alcohol offspring (Figure 6D). mRNA expression of Sdha was increased in the alcohol offspring. Together, damage from oxidative stress in MCA might be originated from the damaged mitochondrial structures and functions, especially complex II in electron transfer chain.

FIGURE 6.

Role of oxidative stress in regulating MCA vessel tone. (A) Dihydroethidium staining in offspring MCA from both groups (N = 4 from 4 litters each group). (B) Cumulative concentration AngII‐mediated response curve with or without tempol (N = 6–17 from 4 litters each group). (C) Mitochondria structure in vascular smooth muscle cells form offspring MCA and white arrows indicate the mitochondria. (D, E) Cumulative concentration AngII‐mediated response curve with or without TTFA (N = 4–17 from 4 litters) and mRNA expression of complex II subtypes a, b, c and d (n = 4–13 with 4 mixtures of cerebral arteries from 12 offspring). N, the number of male offspring. n, the number of repeated measures using the mixtures. Data were presented as means ± S.D. and analysed by t‐test or two‐way ANOVA. *P˂0.05, **P˂0.01, ***P˂0.001. ROS: reactive oxygen species. AngII, angiotensin II; MCA, middle cerebral artery; TTFA, thenoyltrifluoroacetone.

3.6. Effects of hypoxia on AT1R expression

There was more ROS in hypoxic MCA (1% O₂) (Figure 7A). After exposure to 1% O₂, the fluorescence of AT1R in the MCA was increased. In A7R5 cell line, mRNA expression of Agtr1a was enhanced by hypoxia (1% O₂). These indicated ROS potentiated AT1R expression in MCA (Figure 7B).

FIGURE 7.

Role of oxidative stress on Agtr1a expression. (A) Dihydroethidium staining of control offspring MCA exposed to 1% or 21% for 72 h (N = 4–5). (B) mRNA expression of AngII receptor in the vessel exposed to 1% or 21% for 72 h (N = 6) and mRNA expression of Agtr1a in A7R5 after exposure to 1% or 21% for 48 h (number = 4 dishes of cells). N, the number of male offspring. Data were presented as means ± S.D. and analysed by t‐test or two‐way ANOVA. *P˂0.05, **P˂0.01. AngII, angiotensin II; MCA, middle cerebral artery; ROS, reactive oxygen species.

4. DISCUSSION

A large number of studies have shown adverse factors during developmental periods could impact on health and diseases in later life. ²⁷ The present study was the first to determine possible long‐term influence of drinking alcohol in male adults on offspring central circulation, and the following novel data and findings were achieved: (1) Paternal preconception alcohol consumption affected the brain development as the organ appeared smaller while its weight was decreased and damaged metabolism (glycolysis) in the offspring. (2) Paternal preconception alcohol consumption elevated AngII‐mediated constriction in the offspring MCA, mainly via Agtr1a. (3) Paternal preconception alcohol consumption increased intracellular calcium via L‐Ca²⁺, IP₃ receptor, and ryanodine receptors, and decreased the role of KCa1.1 and Serca in regulating vessel tone of male offspring MCA, which might contribute to AngII‐potentiated contraction. (4) PKC was participated in regulating vessel tone in the offspring MCA; however, paternal preconception alcohol consumption did not significantly influence PKC expression and its regulatory functions. (5) Paternal preconception alcohol consumption induced stronger oxidative stress in the offspring MCA, which could increase the expression of AT1R (Figure 8). It is well‐known that alcohol could affect arteries and vascular functions in the adult brain, damaging the central oxygenation, causing stroke and other MCA dysfunction‐mediated brain diseases ²⁸ ; the underlying mechanisms are complicated and probably by multiple factors. Our recent study revealed that paternal preconception alcohol consumption could produce dysfunction in peripheral arteries in the systemic circulation in the offspring (unpublished). This study was the first to test whether the central arteries may be affected too by paternal preconception alcohol intake. The novel data gained are important for early prevention of central diseases before family plan of coming of new life.

FIGURE 8.

This figure summarises the influences of paternal preconception alcohol consumption on the MCA tone in male offspring, which might increase the risk of cerebrovascular diseases. AT1R and AT2R indicate AT1 and 2 receptors; L‐Ca²⁺, L‐type calcium channels. AngII, angiotensin II; BK_Ca, large‐conductance calcium‐activated potassium channels; ETC, electron transport chain; IP3R, IP3 receptor; PLC, phospholipase C; PKC, protein kinase C; ROS, reactive oxygen species; RyR, ryanodine receptor; SERCA, sarcoendoplasmic reticulum Ca²⁺‐ATPase.

We found that paternal preconception alcohol consumption (0.67 g/kg per day, intragastric administration) did not change body weight of male offspring rats at 4 weeks of age, but since 8 weeks of age, body weight displayed a reduction. At the age of 12 weeks, brain weight of male offspring was decreased in paternal preconception alcohol group, while the ratio of brain to body weight was increased. Richard C Chang found paternal preconception alcohol reduced body weight of male offspring from the time of birth and the reduction continued to display at 12 weeks of age. ²⁹ Maternal alcohol consumption during pregnancy did not significantly change body weight and brain weight in the foetuses, but high doses of alcohol intake during pregnancy decreased the weight of brain and body and the ratio of the brain to body weight in the fetus. ³⁰ , ³¹ In contrary, some found that maternal alcohol consumption in pregnancy increased the ratio of brain to body weight in offspring. ³² The different results might be caused by the amount and the method of alcohol consumption. These studies demonstrated that paternal preconception alcohol consumption altered the growth and development in the offspring, and the influence of alcohol intake on the growth might be dose‐dependent.

Although the weekly food consumption after birth was not significantly changed in the offspring from both groups, the metabolism‐related genes in the offspring brain tissue were changed, such as increased Pkm, which are closely associated with glycolysis. The present study found that circulating lactic acid was increased in the offspring exposed to paternal preconception alcohol. The abnormal growth in male offspring was associated with the altered metabolism by alcohol. Previous study found that paternal preconception alcohol consumption could affect the offspring metabolism, including insulin hypersensitivity and glucose tolerance. ²⁹ The effects of alcohol intake on glycolysis metabolism (the most important part of energy supply) in the offspring were unknown. This was the first study to demonstrate that paternal preconception alcohol consumption could affect the glycolysis metabolism, so as to influence the offspring growth. Changes in glycolysis metabolism in the brain could damage central functions. Dysfunction in the central circulation system such as the MCA might be injured by altered metabolism.

This present study firstly found that paternal preconception alcohol consumption potentiated AngII‐mediated constriction in the MCA of the male offspring but not in the female (supporting information Figure S1A). Oestrogen could protect vasculature and decrease the risk of the cardiovascular diseases. ³³ It is speculated that the difference in the offspring MCA between the female and male might be due to the protective effect of oestrogen. The previous study indicated that the offspring of parental alcohol consumption have an increased risk of congenital heart diseases. ³⁴ But there were still few studies about vascular changes in the offspring exposed to paternal preconception alcohol. Maternal alcohol exposure during pregnancy decreased foetal brain vessel diameters and blood flow and increased cerebral vasodilation and arterial stiffness in the foetuses. ³¹ , ³⁵ , ³⁶ Notably, the present study provided first evidence that paternal preconception alcohol consumption exerts sex‐specific effects on the offspring cerebral vasculature.

Blood pressure is controlled by many factors (especially resistance arteries and several hormones). Moreover, blood pressure mainly relies on systemic circulation and is relatively independent on cerebral circulation, even hypertension is a risk factor for cerebrovascular diseases. Paternal preconception alcohol exposure did not affect blood pressure at the younger age of offspring in this study. It is worth of further investigation on blood pressure and cerebral arteries at older age.

AT1R played an important role in AngII‐mediated contraction, and AT2R was reported to induce vasodilation in the control offspring MCA. ¹⁰ The stronger MCA contraction in the offspring exposed to paternal preconception alcohol consumption was mainly via increased activities and expression of AT1R, especially its subunit1α rather than subunit1β unit. PD123,319, an AT2R inhibitor, only enhanced AngII‐mediated constriction in the control offspring MCA, instead of in the alcohol group. Meanwhile, the present study uncovered higher circulating AngII concentrations in the alcohol offspring, which might contribute to the potentiated vascular contraction and indicated the activation of RAS. Maternal alcohol consumption during pregnancy increased expressions of AT1αR and angiotensin‐converting enzyme (ACE) and decreased expressions of AT2R in the offspring renal arteries. ²¹ , ³⁷ Alcohol intake could directly increase plasma AngII concentrations in rats. ²⁰ This study firstly demonstrated that paternal preconception alcohol changed the activities of RAS elements in the male offspring cerebral arteries. This novel finding also raised new question: How was the altered RAS‐mediated the central vessel dysfunction?

Ion channels, such as calcium channels and potassium channels, play an important role in AngII‐mediated constriction in MCA. ³⁸ Our subsequent patch‐clamp and molecular experiments found that paternal preconception alcohol enhanced activities and expression of L‐Ca²⁺ channels in the offspring cerebral arteries. The amplitude of calcium channel currents caused by AngII was significantly higher compared with the control, suggesting that AngII‐increased constriction in the alcohol group was closely related to L‐type calcium channels. In others' different experimental models, maternal alcohol consumption could increase activities of L‐Ca²⁺ channels on the foetal neurons. ³⁹ Long‐term alcohol exposure increased the expression and currents of L‐Ca²⁺ channels in undifferentiated pheochromocytoma. ⁴⁰ , ⁴¹ Previous studies demonstrated that alcohol consumption decreased the expression of L‐Ca²⁺ channels in atrial tissue and alcohol directly inhibited the activities of L‐Ca²⁺ channels in cerebral artery. ¹² , ⁴² Those work showed that alcohol could influence L‐Ca²⁺ channels despite resulted phenomenon were various due to complicated background each other. The present study was the first to demonstrate that paternal preconception alcohol increased activities of L‐type voltage‐dependent calcium channels in the offspring cerebral arteries.

In addition, activated large‐conductance calcium‐activated potassium (BK_Ca) channels mediated potassium efflux, leading to vasodilation. ³⁸ Paternal preconception alcohol decreased the currents and expression of potassium channels, especially BK_Ca channels in the male offspring cerebral arteries. Maternal alcohol consumption in pregnancy could reduce the function of BK_Ca in offspring cerebral arteries. ¹³ Alcohol directly enhanced cerebral constriction via inhibiting the frequency and amplitude of BK_Ca currents in the myocytes. ¹² This study demonstrated that decreased vascular expression of Kcnma1 might contribute to the potentiated AngII‐mediated constriction in the MCA of the alcohol offspring.

In study pathways in regulations of cellular calcium activities in vascular systems, PKC route is important for consideration. However, this study did not observe significant differences in PDBu‐mediated constriction and PKC expression in the MCA, except for Prkce between the two groups, demonstrating that paternal preconception alcohol consumption did not significantly affect PKC in the offspring cerebral arteries. Previous study demonstrated that alcohol exposure could increase the expression of PKC delta which mediated the function of L‐Ca²⁺channels. ¹¹ Alcohol could directly increase the expressions of PKC subtypes, such as δ, ε in the undifferentiated pheochromocytoma and PKC γ in the brain cortex tissue. ¹¹ , ⁴³ Additionally, maternal alcohol consumption could change the activities of PKC subtypes rather than their expression in the offspring hippocampus. ⁴⁴ In contrast to the drinking in adults or maternal alcohol exposure, paternal preconception alcohol consumption did not obviously change the PKC signalling pathway in the offspring cerebral arteries.

Intracellular calcium is both from the influx of extracellular calcium through voltage‐dependent calcium channels on the membrane and the calcium release from the endoplasmic reticulum through IP₃ receptors and ryanodine receptors inside cells. Another novel finding of this study is that not only AngII but also caffeine induced stronger contraction in MCA and more intracellular calcium in the VSMC, indicating that the increased contraction in the offspring MCA exposed to paternal preconception alcohol was also related to calcium release from the endoplasmic reticulum. The increased mRNA expressions of Itpr1 and Ryr2 may contribute to the enhanced contraction in alcohol offspring cerebral arteries; however, increased expression of endoplasmic reticulum Ca²⁺‐ATPase induced quicker velocity of calcium reflux into the endoplasmic reticulum, so as to play a negative role in regulating MCA tone. Previous studies demonstrated alcohol exposure irreversibly increased intracellular calcium in the VSMC of the MCA and thus increased the risk of stroke. ⁴⁵ , ⁴⁶ , ⁴⁷ Meanwhile, maternal alcohol exposure during pregnancy enhanced intracellular calcium in the offspring myocytes. ⁴⁸ Our data firstly revealed that paternal preconception alcohol also could augment intracellular calcium in the endoplasmic reticulum in the offspring MCA.

Above interesting findings offered a novel and important phenotype in central circulation system following preconception alcohol insult. Then we asked why and how those changes and damage were caused. Besides altered glycolysis metabolism in the brain mentioned above, possible metabolic disorders in the mitochondria could not be neglected. The mitochondria were the easiest damaged part in the foetal alcohol spectrum disorders, especially in the cerebral vasculature. ³⁰ , ⁴⁹ It is well‐established that the mitochondria are important source of ROS. Our present study novelty shows that mitochondria structures and ROS were altered in the alcohol offspring MCA. Increased ROS in the offspring MCA might be from the damaged mitochondria. Meanwhile, the predominant route of ROS production by electron transport chain (ETC) is the premature leak electrons from complexes I–III. ²⁶ With the increased activities of complexes II and III, the amount of ROS was increased. ⁵⁰ , ⁵¹ Different from the changed activities of complex III in the offspring exposed to the maternal alcohol consumption, the changed expression of complex II subunit a might result in oxidative stress in the MCA of paternal alcohol consumption offspring. ⁵² Alcohol consumption resulted in oxidative stress (increased lipid peroxidation product, and decreased superoxide dismutase and glutathione peroxide) in the male reproductive system. ²⁵ Increased ROS in the offspring MCA might be due to imprinting effects of paternal preconception alcohol consumption on the gamete, playing a role during development and in the later life of the offspring. It has been demonstrated that maternal alcohol consumption could cause oxidative stress in the cerebral vessel and heart tissue. ⁵³ , ⁵⁴ Alcohol consumption also could induce oxidative stress in the aorta. ⁵⁵ In alcohol offspring MCA, the links between oxidative stress and AT1R were not well‐elucidated. To deepen our exploring the underlying mechanisms, hypoxia was used to modulate the status of oxidative stress. Our study showed that oxidative stress caused by hypoxia could increase the expression of AT1R in the offspring MCA and VSMC. The potentiated AngII‐mediated constriction in the offspring MCA was via oxidative stress‐AT1R pathway.

In conclusion, our study firstly demonstrated paternal preconception alcohol consumption augmented AngII‐mediated vessel tone of cerebral arteries, via oxidative stress‐AT1R pathway in the brain of male offspring. The altered L‐Ca²⁺, BK_Ca and intracellular calcium were involved in the potentiated AngII‐mediated contraction in the offspring MCA. Disordered metabolic changes played critical roles in functional and molecular alterations in central vascular system following preconception exposure to alcohol. Notably, since the present study was the first in aiming at cerebral arteries in offspring with a preconception alcohol drinking model, almost all data gained are new and novel, significantly contributing to understanding pathological potentials of the specific preconception behaviour and male reproductive health, as well as further investigations in early prevention of brain diseases such as stroke.

AUTHOR CONTRIBUTIONS

Jiaqi Tang designed the experiments. Ze Zhang and Yumeng Zhang proceeded the experiments. Hongyu Su, Yun He and Qiutong Zheng gave help for raising the rats. Ze Zhang wrote the manuscript. Jiaqi Tang and Zhice Xu revised it. All authors listed have made a substantial, direct and intellectual contribution to the work and approved it for publication.

CONFLICT OF INTEREST STATEMENT

None.

Supporting information

Figure S1: Contractile responses in the MCA from female offspring. A and B: Cumulative concentration of AngII‐ (N = 14) and Bay K8644‐mediated response curve (N = 12). C: Caffeine‐induced contraction in female offspring MCA (N = 7). N, the number of female rats. Data were presented as means ± S.D. and analysed by t‐test or two‐way ANOVA.

Zhang Z, Zhang Y, Liu M, et al. Paternal preconception alcohol consumption increased Angiotensin II‐mediated vasoconstriction in male offspring cerebral arteries via oxidative stress‐AT1R pathway. Addiction Biology. 2024;29(3):13385. doi: 10.1111/adb.13385

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.