Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2024 Apr 1;68(5):e00174-24. doi: 10.1128/aac.00174-24

In vitro activity of cefoxitin, imipenem, meropenem, and ceftaroline in combination with vaborbactam against Mycobacterium abscessus

Liang Chen 1,2,, Elena Shashkina 1, Natalia Kurepina 1, Vinicius Calado Nogueira de Moura 3,4, Charles L Daley 3,4, Barry N Kreiswirth 1,2,
Editor: Jared A Silverman5
PMCID: PMC11064484  PMID: 38557171

ABSTRACT

Mycobacterium abscessus (MAB) infections pose a growing public health threat. Here, we assessed the in vitro activity of the boronic acid-based β-lactamase inhibitor, vaborbactam, with different β-lactams against 100 clinical MAB isolates. Enhanced activity was observed with meropenem and ceftaroline with vaborbactam (1- and >4-fold MIC50/90 reduction). CRISPRi-mediated blaMAB gene knockdown showed a fourfold MIC reduction to ceftaroline but not the other β-lactams. Our findings demonstrate vaborbactam’s potential in combination therapy against MAB infections.

KEYWORDS: Mycobacterium abscessus, vaborbactam, β-lactamase inhibitors, peptidoglycan synthesis, CRISPR interference

INTRODUCTION

Infections caused by the Mycobacterium abscessus (MAB) pose significant challenges in clinical treatment, and their prevalence is on the rise (13). The MAB subspecies, including M. abscessus subsp. abscessus, M. abscessus subsp. massiliense, and the less common M. abscessus subsp. bolletii, have gained recognition as significant clinical pathogens, particularly in immunocompromised patients. These infections cause chronic diseases and exhibit resistance to most antibiotic treatment protocols. Currently, recommended drug regimens are associated with poor clinical outcomes. Therefore, novel antibacterial drugs or combinational therapy is urgently needed to contain this global threat.

β-Lactams have long been recognized to have activity against MAB, and imipenem and cefoxitin are recommended in the current American Thoracic Society led multi-society treatment guidelines (4). However, MAB produces a broad-spectrum chromosomal β-lactamase, BlaMab, conferring resistance to most β-lactams and β-lactamase inhibitors (5, 6). The challenges to improve the efficacy of β-lactams in treating MAB infections, therefore, include inhibiting or resisting the BlaMab activity and developing strategies to address the redundancies in the peptidoglycan modifying enzymes that appear to overcome β-lactam activity (7, 8). Novel diazabicyclooctanes (DBO) inhibitors (avibactam, relebactam, or nacubactam) were reported to restore susceptibility to β-lactam antibiotics through the inhibition of BlaMab (5, 913). In addition, we and others have previously demonstrated the in vitro synergistic effect of dual β-lactams against MAB strains as reflected by the reduced minimum inhibitory concentrations (MICs) to the combination of ceftazidime/imipenem and ceftaroline/imipenem (7, 11, 14). However, the activity of β-lactams with novel boronic acid-based inhibitors (e.g., vaborbactam) against MAB has not yet been rigorously evaluated as only a limited number of clinical isolates have been tested (11).

In this study, we assessed the in vitro activity of vaborbactam, the first FDA-approved boronic acid-based β-lactamase inhibitor, in combination with different β-lactams against 100 clinical isolates from cystic fibrosis patients, encompassing all three MAB subspecies. The MICs of cefoxitin, imipenem, meropenem, and ceftaroline, both individually and in combination with vaborbactam, including the imipenem/ceftaroline combination, were evaluated using the CLSI standard microdilution method (1517). Imipenem, meropenem, cefoxitin, and ceftaroline were tested in Difco Middlebrook 7H9 broth supplemented with 10% ADC (Albumin-Dextrose-Catalase) at a range of 32 to 0.5 mg/L, and vaborbactam was evaluated at a fixed concentration of 8 mg/L, based on the CLSI guidelines for Meropenem-vaborbactam susceptibility testing for Enterobacterales (18). In the case of the imipenem and ceftaroline combination, the ceftaroline concentration was fixed at 1 mg/L, as previously described (7, 14). The MIC was defined as the lowest drug concentration without visible bacterial growth after a 3-day incubation period at 30°C. The reference strain M. abscessus ATCC 19977 was routinely included for quality control (QC).

The 100 isolates tested were selected from our previous study, and the genomes were deposited in BioProject accession no. PRJNA319839 (19). A core genome SNP-based maximum-likelihood phylogenetic tree was constructed using our previously published method (14). The phylogenetic comparison of the 100 clinical test strains clearly differentiated three subspecies of M. abscessus (59 isolates), M. massilliense (34 isolates), and M. bolletii (7 isolates) (data not shown).

The antimicrobial susceptibility results are summarized in Table 1. The MIC50/MIC90 of cefoxitin (8/16) and meropenem (8/16) had the same values, but imipenem, the most active β-lactam against MAB strains, exhibited improved MIC50/MIC90 values of 4/8 mg/L. The addition of 8 mg/L of vaborbactam with cefoxitin (8/16) and imipenem (4/8) did not significantly alter the MIC50/MIC90 values. However, some strains showed a two- four fold MIC reduction (data not shown). In contrast, meropenem, which is not commonly used to treat MAB strains, showed a onefold reduction (4/8) of MIC50/MIC90, and the values were comparable to imipenem. Consistent with the current literature (7, 8, 14, 20), the MIC50/MIC90 results with ceftaroline alone showed poor activity (32/>32); however, in combination with 8 mg/L vaborbactam, this fifth-generation cephalosporin’s activity was dramatically improved. The MIC50/MIC90 (2/8) values were reduced by 16- and >4-fold, respectively, to clinically achievable concentrations (21, 22). Imipenem/ceftaroline (ceftaroline was fixed at 1 mg/L) had MIC50/MIC90 values of 4/8 mg/L, similar to the values of meropenem-vaborbactam, imipenem-vaborbactam, and imipenem alone (Table 1).

TABLE 1.

MICs of β-lactams and β-lactamase against 100 clinical MAB isolates (mg/L)a

Meropenem Meropenem +
vaborbactam
Imipenem Imipenem +
vaborbactam
Cefoxitin Cefoxitin +
vaborbactam
Ceftaroline Ceftaroline +
vaborbactam
Imipenem +
ceftaroline
MIC50 8 4 4 4 8 8 32 2 4
MIC90 16 8 8 8 16 16 >32 8 8
Range 4–32 2–16 2–32 0.5–8 2–32 2–32 1–>32 0.5–16 0.5–32
a

For combination MIC testing, the concentrations of vaborbactam and ceftaroline were fixed at 8 and 1 µg/mL, respectively.

Macrolides serve as the cornerstone of MAB therapy; however, treatment success is often hampered by macrolide-resistant strains. Resistance to macrolides is typically acquired through point mutations at positions 2058 or 2059 of the 23S rRNA rrl gene, while induced resistance is associated with the presence of the erm41 gene in M. abscessus and M. bolletii. In this study, all 59 M. abscessus strains contained the erm41 gene, but among them, 14 harbored the erm41 T28C sequevar, which is correlated with macrolide susceptibility (19). Notably, none of these strains exhibited the 23S rrl 2058–2059 mutations linked to acquired macrolide resistance. Susceptibility analysis of the 45 M. abscessus strains with induced macrolide resistance genotypes (wild-type erm41) revealed no significant differences in MIC50 and MIC90 values for different β-lactam or β-lactamase inhibitor combinations compared to the overall strain collection (data not shown).

The results of adding vaborbactam with different β-lactams provided further evidence that both imipenem and cefoxitin are relatively insensitive to the MAB β-lactamase, in contrast to both meropenem and ceftaroline, which showed reduced MICs in the presence of the inhibitor. To experimentally evaluate this observation, the interactions between antibiotics and the β-lactamase BlaMAB were investigated by CRISPR interference (CRISPRi)-mediated gene knockdown, followed by antimicrobial susceptibility testing. Using our established CRISPRi method (23), we initially designed three single-guide RNAs (gRNAs) (n20 sequences: GGTTGCCGTTGCGCGAACAA, GACCGCCGATACCCCACCGA, and GGTCTTGACCGTTGAGCACA) targeted to inhibit blaMAB expression; however, blaMAB expression was not reduced by more than 25%. To improve gene inhibition efficiency, we employed the method described by Akusobi et al. (24) and created a CRISPRi plasmid with a combination of the three gRNAs. qRT-PCR indicated that this novel approach would inhibit blaMAB expression by over 80% (data not shown) when induced with 500 ng/mL anhydrotetracycline (Atc). We then examined the MICs of the ATCC19977 blaMAB CRISPRi mutant against the four β-lactam antibiotics with and without the induction with Atc (Table 2). Similar to the MIC results with vaborbactam against the 100 clinical isolates, the knockdown of the M. abscessus β-lactamase gene blaMAB showed a fourfold reduction in its MIC with ceftaroline but did not alter the MICs to imipenem, cefoxitin, and meropenem (Table 2).

TABLE 2.

MICs of selected β-lactams against M. abscessus ATCC19977 and its blaMAB CRISPRi mutants (mg/L)

Imipenem Meropenem Cefoxitin Ceftaroline
Without the addition of Atc (CRISPRi off)
 Control 4 16 16 >32
blaMAB CRISPRi 4 16 16 >32
With the addition of Atc 500 ng/mL (CRISPRi on)
 Control 4 16 16 >32
blaMAB CRISPRi 4 16 16 4

In addition to the broth microdilution evaluation, we explored the interactions between the four β-lactams (at ¼ MICs) and blaMAB knockdown on solid 7H10 agar plates, supplemented with ATc at concentrations of 500 ng/mL. The CRISPRi mutant of the two essential MAB genes (23), cwlM and pbpB, was included as controls. The results revealed that the addition of 500 ng/mL ATc led to a ~4 log reduction of colonies in cwlM and pbpB constructs, consistent with our prior findings that both are essential genes in MAB (23). At this concentration, the growth of the blaMAB construct was not significantly impacted (Fig. 1). Corresponding with the MIC results (Table 2), imipenem, cefoxitin, and meropenem showed minimal impact on the growth of the blaMAB CRISPRi construct, whereas ceftaroline demonstrated a ~3 log reduction of colonies with 500 ng/mL Atc treatment (Fig. 1).

Fig 1.

Fig 1

Growth of M. abscessus ATCC 19977 CRISPRi constructs (cwlM, pbpB, and blaMAB) under β-lactam treatment (1/4 MICs).

The traditional β-lactamase inhibitors—clavulanic acid, sulbactam, and tazobactam—have demonstrated inhibitory effects on the M. tuberculosis BlaC enzyme (20, 25, 26). However, these inhibitors were found ineffective against the closely related M. abscessus BlaMab enzyme, which not only remained unaffected but actively hydrolyzed the inhibitors (27). By contrast, the β-lactamase inhibitor avibactam exhibited inhibitory activity against the BlaMab enzyme (26). Unfortunately, its clinical utility is complicated by its commercial partnership with ceftazidime. Another inhibitor, relebactam, in conjunction with imipenem, displayed similar activity to avibactam; however, it failed to significantly reduce the imipenem MICs in clinical isolates (10, 12, 28, 29). By contrast, our findings align with a previous study on a smaller strain collection (11) that vaborbactam demonstrated similar activity to both avibactam and relebactam. The MIC90/MIC50 was reduced by one dilution when combined with meropenem. Importantly, vaborbactam demonstrated strong synergy with ceftaroline. Notably, vaborbactam has been commercially partnered with meropenem (named vabomere), and based on our results, we hypothesize that the combination of ceftaroline with vabomere will likely exhibit improved activity against MAB strains.

To this end, we next investigated the efficacy of the triple combination and performed additional susceptibility testing on eight selected MAB isolates that displayed high meropenem-vaborbactam MICs ( ≥ 8 mg/L). The results revealed that the addition of 1 mg/L ceftaroline resulted in a 2- to 16-fold reduction in the MICs (MICs 1–8 mg/L) compared to meropenem-vaborbactam (MIC 8–16 mg/L) and a 2- to 32-fold reduction compared to meropenem alone (MICs 8–32 mg/L) (Table 3). This observation supports the idea that ceftaroline enhances the activity of meropenem-vaborbactam against MAB isolates. The findings also suggest that meropenem-vaborbactam holds promise as a potential partner with an additional β-lactam, such as ceftaroline. The expectation is that the inhibitor will prevent hydrolysis, thereby facilitating the interaction between two active β-lactams.

TABLE 3.

MICs of meropenem + vaborbactam + ceftaroline against clinical MAB isolates (mg/L)a

Strain Meropenem Meropenem +
vaborbactam
Imipenem Imipenem +
vaborbactam
Cefoxitin Cefoxitin +
vaborbactam
Ceftaroline Ceftaroline +
vaborbactam
Meropenem +
vaborbactam + ceftaroline
MAB027 32 8 8 4 16 16 64 4 1
MAB055 8 8 4 2 16 16 64 4 4
MAB063 16 8 4 4 16 16 64 2 2
MAB066 8 8 8 8 16 8 32 2 2
MAB068 32 16 8 8 32 32 64 4 4
MAB069 32 16 8 4 32 32 32 4 1
MAB077 32 16 32 8 16 16 32 8 8
MAB079 32 8 16 8 32 16 64 8 1
a

For combination MIC testing, the concentrations of vaborbactam and ceftaroline were fixed at 8 and 1 µg/mL, respectively.

In summary, as a novel boronic acid-based inhibitor, vaborbactam improved the in vitro anti-MAB activity of two β-lactams (i.e., meropenem and ceftaroline). This study emphasizes the promising potential of vaborbactam, especially when utilized in conjunction with meropenem and ceftaroline, as an alternative therapeutic approach for treating MAB infections. Nevertheless, the efficacy of vaborbactam and β-lactam combinations should be further evaluated at clinically relevant exposures in preclinical models of MAB infection.

ACKNOWLEDGMENTS

The authors thank Melinta Therapeutics for providing vaborbactam for susceptibility testing and Jerry Nick, MD, for his leadership of the Cystic Fibrosis Foundation supported Colorado NTM National Resource Centers at National Jewish Health.

This work was, in part, supported by grants from the National Institutes of Health (R01AI141805) and Cystic Fibrosis Foundation to B.N.K. and C.L.D.

Contributor Information

Liang Chen, Email: liangch@buffalo.edu.

Barry N. Kreiswirth, Email: barry.kreiswirth@hmh-cdi.org.

Jared A. Silverman, Bill & Melinda Gates Medical Research Institute, Cambridge, Massachusetts, USA

REFERENCES

  • 1. Nessar R, Cambau E, Reyrat JM, Murray A, Gicquel B. 2012. Mycobacterium abscessus: a new antibiotic nightmare. J Antimicrob Chemother 67:810–818. doi: 10.1093/jac/dkr578 [DOI] [PubMed] [Google Scholar]
  • 2. Petrini B. 2006. Mycobacterium abscessus: an emerging rapid-growing potential pathogen. APMIS 114:319–328. doi: 10.1111/j.1600-0463.2006.apm_390.x [DOI] [PubMed] [Google Scholar]
  • 3. Story-Roller E, Maggioncalda EC, Cohen KA, Lamichhane G. 2018. Mycobacterium abscessus and beta-lactams: emerging insights and potential opportunities. Front Microbiol 9:2273. doi: 10.3389/fmicb.2018.02273 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Daley CL, Iaccarino JM, Lange C, Cambau E, Wallace RJ, Andrejak C, Böttger EC, Brozek J, Griffith DE, Guglielmetti L, Huitt GA, Knight SL, Leitman P, Marras TK, Olivier KN, Santin M, Stout JE, Tortoli E, van Ingen J, Wagner D, Winthrop KL. 2020. Treatment of nontuberculous mycobacterial pulmonary disease: an official ATS/ERS/ESCMID/IDSA clinical practice guideline. Clin Infect Dis 71:e1–e36. doi: 10.1093/cid/ciaa241 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Dubée V, Bernut A, Cortes M, Lesne T, Dorchene D, Lefebvre A-L, Hugonnet J-E, Gutmann L, Mainardi J-L, Herrmann J-L, Gaillard J-L, Kremer L, Arthur M. 2015. Beta-lactamase inhibition by avibactam in Mycobacterium abscessus. J Antimicrob Chemother 70:1051–1058. doi: 10.1093/jac/dku510 [DOI] [PubMed] [Google Scholar]
  • 6. Lefebvre A-L, Dubée V, Cortes M, Dorchêne D, Arthur M, Mainardi J-L. 2016. Bactericidal and intracellular activity of beta-lactams against Mycobacterium abscessus. J Antimicrob Chemother 71:1556–1563. doi: 10.1093/jac/dkw022 [DOI] [PubMed] [Google Scholar]
  • 7. Dousa KM, Kurz SG, Taracila MA, Bonfield T, Bethel CR, Barnes MD, Selvaraju S, Abdelhamed AM, Kreiswirth BN, Boom WH, Kasperbauer SH, Daley CL, Bonomo RA. 2020. Insights into the l,d-transpeptidases and d,d-carboxypeptidase of Mycobacterium abscessus: ceftaroline, imipenem, and novel diazabicyclooctane inhibitors. Antimicrob Agents Chemother 64:e00098-20. doi: 10.1128/AAC.00098-20 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Nguyen DC, Dousa KM, Kurz SG, Brown ST, Drusano G, Holland SM, Kreiswirth BN, Boom WH, Daley CL, Bonomo RA. 2021. One-two punch": synergistic ss-lactam combinations for Mycobacterium abscessus and target redundancy in the inhibition of peptidoglycan synthesis enzymes. Clin Infect Dis 73:1532–1536. doi: 10.1093/cid/ciab535 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Lefebvre AL, Le Moigne V, Bernut A, Veckerle C, Compain F, Herrmann JL, Kremer L, Arthur M, Mainardi JL. 2017. Inhibition of the beta-lactamase Bla(Mab) by avibactam improves the in vitro and in vivo efficacy of imipenem against Mycobacterium abscessus. Antimicrob Agents Chemother 61. doi: 10.1128/AAC.02440-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Harrison J, Weaver JA, Desai M, Cox JAG. 2021. In vitro efficacy of relebactam versus avibactam against Mycobacterium abscessus complex. Cell Surface 7:100064. doi: 10.1016/j.tcsw.2021.100064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Kaushik A, Ammerman NC, Lee J, Martins O, Kreiswirth BN, Lamichhane G, Parrish NM, Nuermberger EL. 2019. In vitro activity of the new beta-lactamase inhibitors relebactam and vaborbactam in combination with beta-lactams against Mycobacterium abscessus complex clinical isolates. Antimicrob Agents Chemother 63:e02623-18. doi: 10.1128/AAC.02623-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Misawa K, Nishimura T, Kashimura S, Enoki Y, Taguchi K, Uno S, Uwamino Y, Matsumoto K, Hasegawa N. 2022. In vitro effects of diazabicyclooctane beta-lactamase inhibitors relebactam and nacubactam against three subspecies of Mycobacterium abscessus complex. Int J Antimicrob Agents 60:106669. doi: 10.1016/j.ijantimicag.2022.106669 [DOI] [PubMed] [Google Scholar]
  • 13. Le Run E, Atze H, Arthur M, Mainardi JL. 2020. Impact of relebactam-mediated inhibition of Mycobacterium abscessus BlaMab beta-Lactamase on the in vitro and intracellular efficacy of imipenem. J Antimicrob Chemother 75:379–383. doi: 10.1093/jac/dkz433 [DOI] [PubMed] [Google Scholar]
  • 14. Pandey R, Chen L, Manca C, Jenkins S, Glaser L, Vinnard C, Stone G, Lee J, Mathema B, Nuermberger EL, Bonomo RA, Kreiswirth BN. 2019. Dual beta-lactam combinations highly active against Mycobacterium abscessus complex in vitro. mBio 10:e02895-18. doi: 10.1128/mBio.02895-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. CLSI . 2018. M62. Performance standards for susceptibility testing of mycobacteria, Nocardia spp., and other aerobic actinomycetes. 1st ed. CLSI, Wayne, PA. [Google Scholar]
  • 16. CLSI . 2018. M24. Susceptibility testing of mycobacteria, Nocardia spp., and other aerobic actinomycetes. 3rd ed. CLSI, Wayne, PA. [Google Scholar]
  • 17. CLSI . 2023. M24S. Performance standards for susceptibility testing of mycobacteria, Nocardia spp., and other aerobic actinomycetes. 2nd ed. CLSI, Wayne, PA. [Google Scholar]
  • 18. CLSI . 2023. Performance standards for antimicrobial susceptibility testing M100-Ed33. CLSI, Wayne, PA. [Google Scholar]
  • 19. Marras SAE, Chen L, Shashkina E, Davidson RM, Strong M, Daley CL, Kreiswirth BN. 2021. A molecular-beacon-based multiplex real-time PCR assay to distinguish Mycobacterium abscessus subspecies and determine macrolide susceptibility. J Clin Microbiol 59:e0045521. doi: 10.1128/JCM.00455-21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Dubée V, Soroka D, Cortes M, Lefebvre A-L, Gutmann L, Hugonnet J-E, Arthur M, Mainardi J-L. 2015. Impact of beta-lactamase inhibition on the activity of ceftaroline against Mycobacterium tuberculosis and Mycobacterium abscessus. Antimicrob Agents Chemother 59:2938–2941. doi: 10.1128/AAC.05080-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Soriano A. 2021. Ceftaroline. Rev Esp Quimioter 34:29–31. doi: 10.37201/req/s01.08.2021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Poon H, Chang MH, Fung HB. 2012. Ceftaroline fosamil: a cephalosporin with activity against methicillin-resistant Staphylococcus aureus. Clin Ther 34:743–765. doi: 10.1016/j.clinthera.2012.02.025 [DOI] [PubMed] [Google Scholar]
  • 23. Kurepina N, Chen L, Composto K, Rifat D, Nuermberger EL, Kreiswirth BN. 2022. CRISPR inhibition of essential peptidoglycan biosynthesis genes in Mycobacterium abscessus and its impact on beta-lactam susceptibility. Antimicrob Agents Chemother 66. doi: 10.1128/aac.00093-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Akusobi C, Benghomari BS, Zhu J, Wolf ID, Singhvi S, Dulberger CL, Ioerger TR, Rubin EJ. 2022. Transposon mutagenesis in Mycobacterium abscessus identifies an essential penicillin-binding protein involved in septal peptidoglycan synthesis and antibiotic sensitivity. Elife 11:e71947. doi: 10.7554/eLife.71947 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Soroka D, Li de la Sierra-Gallay I, Dubée V, Triboulet S, van Tilbeurgh H, Compain F, Ballell L, Barros D, Mainardi J-L, Hugonnet J-E, Arthur M. 2015. Hydrolysis of clavulanate by Mycobacterium tuberculosis beta-lactamase BlaC harboring a canonical SDN motif. Antimicrob Agents Chemother 59:5714–5720. doi: 10.1128/AAC.00598-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Soroka D, Ourghanlian C, Compain F, Fichini M, Dubée V, Mainardi J-L, Hugonnet J-E, Arthur M. 2017. Inhibition of beta-lactamases of mycobacteria by avibactam and clavulanate. J Antimicrob Chemother 72:1081–1088. doi: 10.1093/jac/dkw546 [DOI] [PubMed] [Google Scholar]
  • 27. Soroka D, Dubée V, Soulier-Escrihuela O, Cuinet G, Hugonnet J-E, Gutmann L, Mainardi J-L, Arthur M. 2014. Characterization of broad-spectrum Mycobacterium abscessus class A beta-lactamase. J Antimicrob Chemother 69:691–696. doi: 10.1093/jac/dkt410 [DOI] [PubMed] [Google Scholar]
  • 28. Burke A, Carter R, Tolson C, Congdon J, Duplancic C, Bursle E, Bell SC, Roberts JA, Thomson R. 2023. In vitro susceptibility testing of imipenem-relebactam and tedizolid against 102 Mycobacterium abscessus isolates. Int J Antimicrob Agents 62:106938. doi: 10.1016/j.ijantimicag.2023.106938 [DOI] [PubMed] [Google Scholar]
  • 29. Froberg G, Ahmed A, Chryssanthou E, Davies Forsman L. 2023. The in vitro effect of new combinations of carbapenem-beta-lactamase inhibitors for Mycobacterium abscessus. Antimicrob Agents Chemother 67:e0052823. doi: 10.1128/aac.00528-23 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES