In vitro activity of cefoxitin, imipenem, meropenem, and ceftaroline in combination with vaborbactam against Mycobacterium abscessus

ABSTRACT

Mycobacterium abscessus (MAB) infections pose a growing public health threat. Here, we assessed the in vitro activity of the boronic acid-based β-lactamase inhibitor, vaborbactam, with different β-lactams against 100 clinical MAB isolates. Enhanced activity was observed with meropenem and ceftaroline with vaborbactam (1- and >4-fold MIC₅₀/₉₀ reduction). CRISPRi-mediated bla_MAB gene knockdown showed a fourfold MIC reduction to ceftaroline but not the other β-lactams. Our findings demonstrate vaborbactam’s potential in combination therapy against MAB infections.

INTRODUCTION

Infections caused by the Mycobacterium abscessus (MAB) pose significant challenges in clinical treatment, and their prevalence is on the rise (1–3). The MAB subspecies, including M. abscessus subsp. abscessus, M. abscessus subsp. massiliense, and the less common M. abscessus subsp. bolletii, have gained recognition as significant clinical pathogens, particularly in immunocompromised patients. These infections cause chronic diseases and exhibit resistance to most antibiotic treatment protocols. Currently, recommended drug regimens are associated with poor clinical outcomes. Therefore, novel antibacterial drugs or combinational therapy is urgently needed to contain this global threat.

β-Lactams have long been recognized to have activity against MAB, and imipenem and cefoxitin are recommended in the current American Thoracic Society led multi-society treatment guidelines (4). However, MAB produces a broad-spectrum chromosomal β-lactamase, BlaMab, conferring resistance to most β-lactams and β-lactamase inhibitors (5, 6). The challenges to improve the efficacy of β-lactams in treating MAB infections, therefore, include inhibiting or resisting the BlaMab activity and developing strategies to address the redundancies in the peptidoglycan modifying enzymes that appear to overcome β-lactam activity (7, 8). Novel diazabicyclooctanes (DBO) inhibitors (avibactam, relebactam, or nacubactam) were reported to restore susceptibility to β-lactam antibiotics through the inhibition of BlaMab (5, 9–13). In addition, we and others have previously demonstrated the in vitro synergistic effect of dual β-lactams against MAB strains as reflected by the reduced minimum inhibitory concentrations (MICs) to the combination of ceftazidime/imipenem and ceftaroline/imipenem (7, 11, 14). However, the activity of β-lactams with novel boronic acid-based inhibitors (e.g., vaborbactam) against MAB has not yet been rigorously evaluated as only a limited number of clinical isolates have been tested (11).

In this study, we assessed the in vitro activity of vaborbactam, the first FDA-approved boronic acid-based β-lactamase inhibitor, in combination with different β-lactams against 100 clinical isolates from cystic fibrosis patients, encompassing all three MAB subspecies. The MICs of cefoxitin, imipenem, meropenem, and ceftaroline, both individually and in combination with vaborbactam, including the imipenem/ceftaroline combination, were evaluated using the CLSI standard microdilution method (15–17). Imipenem, meropenem, cefoxitin, and ceftaroline were tested in Difco Middlebrook 7H9 broth supplemented with 10% ADC (Albumin-Dextrose-Catalase) at a range of 32 to 0.5 mg/L, and vaborbactam was evaluated at a fixed concentration of 8 mg/L, based on the CLSI guidelines for Meropenem-vaborbactam susceptibility testing for Enterobacterales (18). In the case of the imipenem and ceftaroline combination, the ceftaroline concentration was fixed at 1 mg/L, as previously described (7, 14). The MIC was defined as the lowest drug concentration without visible bacterial growth after a 3-day incubation period at 30°C. The reference strain M. abscessus ATCC 19977 was routinely included for quality control (QC).

The 100 isolates tested were selected from our previous study, and the genomes were deposited in BioProject accession no. PRJNA319839 (19). A core genome SNP-based maximum-likelihood phylogenetic tree was constructed using our previously published method (14). The phylogenetic comparison of the 100 clinical test strains clearly differentiated three subspecies of M. abscessus (59 isolates), M. massilliense (34 isolates), and M. bolletii (7 isolates) (data not shown).

The antimicrobial susceptibility results are summarized in Table 1. The MIC₅₀/MIC₉₀ of cefoxitin (8/16) and meropenem (8/16) had the same values, but imipenem, the most active β-lactam against MAB strains, exhibited improved MIC₅₀/MIC₉₀ values of 4/8 mg/L. The addition of 8 mg/L of vaborbactam with cefoxitin (8/16) and imipenem (4/8) did not significantly alter the MIC₅₀/MIC₉₀ values. However, some strains showed a two- four fold MIC reduction (data not shown). In contrast, meropenem, which is not commonly used to treat MAB strains, showed a onefold reduction (4/8) of MIC₅₀/MIC₉₀, and the values were comparable to imipenem. Consistent with the current literature (7, 8, 14, 20), the MIC₅₀/MIC₉₀ results with ceftaroline alone showed poor activity (32/>32); however, in combination with 8 mg/L vaborbactam, this fifth-generation cephalosporin’s activity was dramatically improved. The MIC₅₀/MIC₉₀ (2/8) values were reduced by 16- and >4-fold, respectively, to clinically achievable concentrations (21, 22). Imipenem/ceftaroline (ceftaroline was fixed at 1 mg/L) had MIC₅₀/MIC₉₀ values of 4/8 mg/L, similar to the values of meropenem-vaborbactam, imipenem-vaborbactam, and imipenem alone (Table 1).

TABLE 1.

MICs of β-lactams and β-lactamase against 100 clinical MAB isolates (mg/L)^a

	Meropenem	Meropenem + vaborbactam	Imipenem	Imipenem + vaborbactam	Cefoxitin	Cefoxitin + vaborbactam	Ceftaroline	Ceftaroline + vaborbactam	Imipenem + ceftaroline
MIC50	8	4	4	4	8	8	32	2	4
MIC90	16	8	8	8	16	16	>32	8	8
Range	4–32	2–16	2–32	0.5–8	2–32	2–32	1–>32	0.5–16	0.5–32

^a For combination MIC testing, the concentrations of vaborbactam and ceftaroline were fixed at 8 and 1 µg/mL, respectively.

Macrolides serve as the cornerstone of MAB therapy; however, treatment success is often hampered by macrolide-resistant strains. Resistance to macrolides is typically acquired through point mutations at positions 2058 or 2059 of the 23S rRNA rrl gene, while induced resistance is associated with the presence of the erm41 gene in M. abscessus and M. bolletii. In this study, all 59 M. abscessus strains contained the erm41 gene, but among them, 14 harbored the erm41 T28C sequevar, which is correlated with macrolide susceptibility (19). Notably, none of these strains exhibited the 23S rrl 2058–2059 mutations linked to acquired macrolide resistance. Susceptibility analysis of the 45 M. abscessus strains with induced macrolide resistance genotypes (wild-type erm41) revealed no significant differences in MIC₅₀ and MIC₉₀ values for different β-lactam or β-lactamase inhibitor combinations compared to the overall strain collection (data not shown).

The results of adding vaborbactam with different β-lactams provided further evidence that both imipenem and cefoxitin are relatively insensitive to the MAB β-lactamase, in contrast to both meropenem and ceftaroline, which showed reduced MICs in the presence of the inhibitor. To experimentally evaluate this observation, the interactions between antibiotics and the β-lactamase BlaMAB were investigated by CRISPR interference (CRISPRi)-mediated gene knockdown, followed by antimicrobial susceptibility testing. Using our established CRISPRi method (23), we initially designed three single-guide RNAs (gRNAs) (n20 sequences: GGTTGCCGTTGCGCGAACAA, GACCGCCGATACCCCACCGA, and GGTCTTGACCGTTGAGCACA) targeted to inhibit bla_MAB expression; however, bla_MAB expression was not reduced by more than 25%. To improve gene inhibition efficiency, we employed the method described by Akusobi et al. (24) and created a CRISPRi plasmid with a combination of the three gRNAs. qRT-PCR indicated that this novel approach would inhibit bla_MAB expression by over 80% (data not shown) when induced with 500 ng/mL anhydrotetracycline (Atc). We then examined the MICs of the ATCC19977 bla_MAB CRISPRi mutant against the four β-lactam antibiotics with and without the induction with Atc (Table 2). Similar to the MIC results with vaborbactam against the 100 clinical isolates, the knockdown of the M. abscessus β-lactamase gene bla_MAB showed a fourfold reduction in its MIC with ceftaroline but did not alter the MICs to imipenem, cefoxitin, and meropenem (Table 2).

TABLE 2.

MICs of selected β-lactams against M. abscessus ATCC19977 and its bla_MAB CRISPRi mutants (mg/L)

	Imipenem	Meropenem	Cefoxitin	Ceftaroline
Without the addition of Atc (CRISPRi off)
Control	4	16	16	>32
blaMAB CRISPRi	4	16	16	>32
With the addition of Atc 500 ng/mL (CRISPRi on)
Control	4	16	16	>32
blaMAB CRISPRi	4	16	16	4

In addition to the broth microdilution evaluation, we explored the interactions between the four β-lactams (at ¼ MICs) and bla_MAB knockdown on solid 7H10 agar plates, supplemented with ATc at concentrations of 500 ng/mL. The CRISPRi mutant of the two essential MAB genes (23), cwlM and pbpB, was included as controls. The results revealed that the addition of 500 ng/mL ATc led to a ~4 log reduction of colonies in cwlM and pbpB constructs, consistent with our prior findings that both are essential genes in MAB (23). At this concentration, the growth of the bla_MAB construct was not significantly impacted (Fig. 1). Corresponding with the MIC results (Table 2), imipenem, cefoxitin, and meropenem showed minimal impact on the growth of the bla_MAB CRISPRi construct, whereas ceftaroline demonstrated a ~3 log reduction of colonies with 500 ng/mL Atc treatment (Fig. 1).

Fig 1.

Growth of M. abscessus ATCC 19977 CRISPRi constructs (cwlM, pbpB, and bla_MAB) under β-lactam treatment (1/4 MICs).

The traditional β-lactamase inhibitors—clavulanic acid, sulbactam, and tazobactam—have demonstrated inhibitory effects on the M. tuberculosis BlaC enzyme (20, 25, 26). However, these inhibitors were found ineffective against the closely related M. abscessus BlaMab enzyme, which not only remained unaffected but actively hydrolyzed the inhibitors (27). By contrast, the β-lactamase inhibitor avibactam exhibited inhibitory activity against the BlaMab enzyme (26). Unfortunately, its clinical utility is complicated by its commercial partnership with ceftazidime. Another inhibitor, relebactam, in conjunction with imipenem, displayed similar activity to avibactam; however, it failed to significantly reduce the imipenem MICs in clinical isolates (10, 12, 28, 29). By contrast, our findings align with a previous study on a smaller strain collection (11) that vaborbactam demonstrated similar activity to both avibactam and relebactam. The MIC₉₀/MIC₅₀ was reduced by one dilution when combined with meropenem. Importantly, vaborbactam demonstrated strong synergy with ceftaroline. Notably, vaborbactam has been commercially partnered with meropenem (named vabomere), and based on our results, we hypothesize that the combination of ceftaroline with vabomere will likely exhibit improved activity against MAB strains.

To this end, we next investigated the efficacy of the triple combination and performed additional susceptibility testing on eight selected MAB isolates that displayed high meropenem-vaborbactam MICs ( ≥ 8 mg/L). The results revealed that the addition of 1 mg/L ceftaroline resulted in a 2- to 16-fold reduction in the MICs (MICs 1–8 mg/L) compared to meropenem-vaborbactam (MIC 8–16 mg/L) and a 2- to 32-fold reduction compared to meropenem alone (MICs 8–32 mg/L) (Table 3). This observation supports the idea that ceftaroline enhances the activity of meropenem-vaborbactam against MAB isolates. The findings also suggest that meropenem-vaborbactam holds promise as a potential partner with an additional β-lactam, such as ceftaroline. The expectation is that the inhibitor will prevent hydrolysis, thereby facilitating the interaction between two active β-lactams.

TABLE 3.

MICs of meropenem + vaborbactam + ceftaroline against clinical MAB isolates (mg/L)^a

Strain	Meropenem	Meropenem + vaborbactam	Imipenem	Imipenem + vaborbactam	Cefoxitin	Cefoxitin + vaborbactam	Ceftaroline	Ceftaroline + vaborbactam	Meropenem + vaborbactam + ceftaroline
MAB027	32	8	8	4	16	16	64	4	1
MAB055	8	8	4	2	16	16	64	4	4
MAB063	16	8	4	4	16	16	64	2	2
MAB066	8	8	8	8	16	8	32	2	2
MAB068	32	16	8	8	32	32	64	4	4
MAB069	32	16	8	4	32	32	32	4	1
MAB077	32	16	32	8	16	16	32	8	8
MAB079	32	8	16	8	32	16	64	8	1

^a For combination MIC testing, the concentrations of vaborbactam and ceftaroline were fixed at 8 and 1 µg/mL, respectively.

In summary, as a novel boronic acid-based inhibitor, vaborbactam improved the in vitro anti-MAB activity of two β-lactams (i.e., meropenem and ceftaroline). This study emphasizes the promising potential of vaborbactam, especially when utilized in conjunction with meropenem and ceftaroline, as an alternative therapeutic approach for treating MAB infections. Nevertheless, the efficacy of vaborbactam and β-lactam combinations should be further evaluated at clinically relevant exposures in preclinical models of MAB infection.