Efflux pump effects on levofloxacin resistance in Mycobacterium abscessus

ABSTRACT

Mycobacterium abscessus (M. abscessus) inherently displays resistance to most antibiotics, with the underlying drug resistance mechanisms remaining largely unexplored. Efflux pump is believed to play an important role in mediating drug resistance. The current study examined the potential of efflux pump inhibitors to reverse levofloxacin (LFX) resistance in M. abscessus. The reference strain of M. abscessus (ATCC19977) and 60 clinical isolates, including 41 M. abscessus subsp. abscessus and 19 M. abscessus subsp. massilense, were investigated. The drug sensitivity of M. abscessus against LFX alone or in conjunction with efflux pump inhibitors, including verapamil (VP), reserpine (RSP), carbonyl cyanide 3-chlorophenylhydrazone (CCCP), or dicyclohexylcarbodiimide (DCC), were determined by AlarmarBlue microplate assay. Drug-resistant regions of the gyrA and gyrB genes from the drug-resistant strains were sequenced. The transcription level of the efflux pump genes was monitored using qRT-PCR. All the tested strains were resistant to LFX. The drug-resistant regions from the gyrA and gyrB genes showed no mutation associated with LFX resistance. CCCP, DCC, VP, and RSP increased the susceptibility of 93.3% (56/60), 91.7% (55/60), 85% (51/60), and 83.3% (50/60) isolates to LFX by 2 to 32-fold, respectively. Elevated transcription of seven efflux pump genes was observed in isolates with a high reduction in LFX MIC values in the presence of efflux pump inhibitors. Efflux pump inhibitors can improve the antibacterial activity of LFX against M. abscessus in vitro. The overexpression of efflux-related genes in LFX-resistant isolates suggests that efflux pumps are associated with the development of LFX resistance in M. abscessus.

INTRODUCTION

Mycobacterium abscessus (M. abscessus) is a rapidly growing nontuberculous mycobacterium (NTM) that has been increasingly isolated in clinical settings in recent years. This rapidly growing microorganism consists of three subspecies, namely subsp. abscessus, subsp. bolletii, and subsp. massiliense (1). Pulmonary disease caused by M. abscessus is considered one of the hardest to treat successfully among all known mycobacteria-related diseases, with a cure rate of about 25–58% (2). Therefore, M. abscessus lung disease is known as an “antibiotic nightmare” (3). The major underlying reason is that the bacilli is one of the most drug-resistant mycobacterial species, displaying inherent resistance to most antibiotics (4, 5). The mechanisms of intrinsic drug resistance mainly include low permeability of cell wall or barrier effect (6, 7), antibiotic inactivation caused by antibiotic hydrolase or modifying enzyme (8), and the drug efflux pump system (9, 10). Despite great efforts, the mechanism underlying the intrinsic resistance of M. abscessus toward different drugs is not well deciphered. Research has shown that the extensive drug resistance in Mycobacterium tuberculosis (Mtb) is related to elevated expression of the efflux pump (11). Furthermore, using efflux pump inhibitors (EPIs) could enhance the bactericidal activity, reverse the resistance of Mtb, and produce synergy with first-line anti-tuberculosis drugs (12). Efflux pump-associated research has mainly focused on Mtb, and there are also relatively limited studies on M. abscessus. Researchers have found that, EPI verapamil improves the efficacy of bedaquiline and spectinomycin activity against M. abscessus clinical isolates (13, 14). Quinoxaline-based efflux pump inhibitors such as 2-aryl-3-phenoxymethyl-quinoxaline derivatives also could restore drug susceptibility in drug-resistant M. abscessus (15).

Fluoroquinolones constitute a diverse group of synthetic broad-spectrum antibiotics. Currently, fluoroquinolones are prescribed to treat various diseases caused by Gram-negative and Gram-positive bacteria, including urinary tract infections, respiratory tract infections, and several gastrointestinal tract infections (16, 17). Levofloxacin (LFX) was recommended as the second-line agent for the treatment of tuberculosis (TB), mainly for drug-resistant cases or for cases who cannot tolerate the first-line anti-TB therapy (18). LFX displayed effective antibacterial activity against most commonly isolated NTM species, except for M. abscessus. The major mycobacterial resistance mechanism against quinolones involves mutations in the gyrA and gyrB genes, especially in the quinolone resistance-determining region (QRDR). Our previous study found no intra-species variation in QRDR of gyrA and gyrB in M. abscessus isolates despite the significant variation in MIC values to LFX (19). The role of the efflux pump in mediating drug resistance of M. abscessus to LFX is yet to be established.

This study investigated the effect of four EPIs on the LFX resistance of M. abscessus reference strain and 60 clinical isolates which were collected from patients with lung diseases. The transcription levels of these efflux pump-encoding genes were also monitored. Our results showed that efflux pumps render LFX resistance in M. abscessus.

MATERIALS AND METHODS

Bacterial strains and culture

The M. abscessus reference strain and 60 clinical strains were collected from the Tuberculosis Biobank in the National Clinical Laboratory on Tuberculosis located in Beijing Chest Hospital, Capital Medical University (Beijing, China). The clinical M. abscessus isolates were identified at the subspecies level by sequencing and comparison of the 16S rRNA, rpoB, and hsp65 genes. Bacterial strains were cultured in Mueller-Hinton broth and on the Lowenstein-Jensen (L-J) medium. The growth phenotypes of the clinical strains on the L-J medium were recorded.

Antimicrobial susceptibility testing

The in vitro susceptibility of M. abscessus isolates to LFX (CAS#100986-85-4, St Louis, MO, USA) was tested according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (20). The tested concentrations of LFX were serially diluted 2-fold in Mueller-Hinton broth ranging from 0.0125 to 64 µg/mL. The 0.5 McFarland standard bacterial suspension, prepared with freshly grown M. abscessus, was diluted 200-fold. Then, 100 µL of diluted inoculum was pipetted to each well of the plate that contained 100 µL of corresponding LFX at concentrations as previously prepared. The final concentration of M. abscessus in each well reached 10⁵ CFU/mL. After 3 days of incubation at 37°C, 20 µL of AlamarBlue (Invitrogen) (in an amount equal to 8–10% of the volume) and 50 µL of 5% Tween 80 were added to each well. The plates were re-incubated at 37°C for an additional 24 h before assessing color change. A blue color in the well indicated no mycobacterial growth, while a pink color indicated growth. Minimum inhibition concentration (MIC) was defined as the lowest concentration of antimicrobial agent preventing the color change from blue to pink. All the experiments were performed in triplicate. The MIC ≥4 µg/mL was used as the LFX-resistant breakpoint (21): MIC ≤1 µg/mL, susceptible; MIC = 2 µg/mL, moderate; and MIC ≥4 µg/mL, resistant.

Monitoring the transcription of efflux pump genes

Four clinical isolates with MIC ratio ≤2 and MIC ratio ≥8 were selected, respectively. Four clinical isolates with MIC ratio ≤2 and four clinical isolates with MIC ratio ≥8 were randomly selected. Due to the MIC ratio of the reference strain being variable in different EPIs (2–8), only clinical strains with more uniform or consistent effects were randomly selected for qRT-PCR experiments. The isolate suspensions were inoculated in the Mueller-Hinton broth in the presence of half its MIC of LFX. RNA extraction from the isolates was performed by following the protocols described by Trizol Reagent (Thermo Fisher, USA). cDNA was synthesized using the First-Strand cDNA Synthesis SuperMix Kit (TransGen Biotech, Beijing, China) and stored at –80℃ until used. By reviewing the literature, a total of 10 efflux pump genes were selected, among which MAB_2355, MAB_1846, and MAB_1560 belong to the ABC superfamily, MAB_2301, MAB_1134, and MAB_4382 belong to the RND superfamily, and MAB_3142, MAB_1409, MAB_2807, and MAB_0970 belong to the MFS superfamily (22, 23). Primer pairs (shown in Table 1) were used for amplification and were synthesized by Ruibo BioTech Company (Beijing, China). 16S rRNA was chosen as the endogenous reference gene. RT-PCR was performed using the PowerUp SYBR Green Master Mix kit (Thermo Biotech, USA) on a Roche LightCycler 480 II Real-Time PCR System (Roche, Shanghai, China). All the RT-PCR reactions were performed in quadruplicate.

TABLE 1.

Primer sequences used for efflux pump gene expression

Gene	Sequence 5′−3′
	Forward primer	Reverse primer
MAB_2301	CCGATTCTCGATACCCATTCTC	GTGCTGCTTGATCACTGTTTC
MAB_1134	CCGGAAGGTCTTTCGCATATC	CGAGTTCGATCTTGGCATCTT
MAB_4382	GGGCTATCACACCACCTAT	CGGGTTCATCTTGGCTTTA
MAB_3142	GTGAGAGTGAAGAGCACCCC	GCTGCTGATCGCCTTCCTAT
MAB_1409	GTCCTGGTCCAATTCTCGCA	TCGCCACAACTCTGGTCATC
MAB_2355	CTGGCCAGCTCATACGGAAT	ACTCATGGAGTGCGACAGTG
MAB_1846	CCCACCAACAACCTGGACTT	ATTACCGGATCGGGTCTCCA
MAB_1560	AACGTCTGGGAGGTCGTTTC	CGAAACATATGCCCGCGAAG
MAB_2807	TCATTCTCTGGGAATCGCGG	GACAAGGGTCACCATCAGGG
MAB_0970	CGCGCGTAAGGAAATTGGAG	TCACCCTCATCGTGCAGAAC

Detection of antimicrobial susceptibility of EPIs combined with LFX against M. abscessus

Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) (CAS#555-60-2), N, N′-dicyclohexylcarbodiimide (DCC) (CAS#538-75-0), verapamil (VP) (CAS#52-53-9) and reserpine (RSP) (CAS#50-55-5) were purchased from Sigma-Aldrich Co. (St Louis, MO, USA) or Solarbio (Beijing, China). The MIC of LFX was determined in the presence of CCCP, DCC, VP, and RSP, respectively. First, the MICs of four EPIs against M. abscessus were detected according to the method described above in the antimicrobial susceptibility test. The tested concentrations of each EPIs ranged from 0.23 to 768 µg/mL by serially diluted twofold in Mueller-Hinton broth. Then, each EPI was added to respective wells in a final concentration of 1/2 of the MIC (24). All the experiments were performed in triplicate. For the sake of presentation, we defined the reduction of MIC values of LFX decreased in the presence of an efflux inhibitor as MIC ratio = LFX MIC/(LFX + EPI) MIC. The MIC ratio was considered significant when the MIC ratio >2 (twofold reduction) (25).

Statistical analysis

Statistical analysis was performed using SPSS v24.0 and GraphPad Prism 8.0 software. For the MIC of LFX combined with EPIs or not against M. abscessus, a paired t test was used to determine significant differences between groups. A one-way ANOVA test followed by a post hoc test was used to determine significant differences between the different groups' transcription of efflux pump genes. The difference was declared significant if P was less than 0.05.

RESULTS

Phenotype of the M. abscessus isolates

A total of 60 M. abscessus isolates, including 41 M. abscessus subsp. abscessus and 19 M. abscessus subsp. massiliense isolates, were investigated. Among the 41 M. abscessus subsp. abscessus isolates, 22 had smooth morphotypes and 19 had rough morphotypes. Among the 19 M. abscessus subsp. massiliense isolates, 11 had smooth morphotypes, and 8 had rough morphotypes (Table 2).

TABLE 2.

MICs of LFX for 60 M. abscessus clinical isolates

M. abscessus subspecies	Morphotype	No. of isolates sensitive to the indicated LFX conc (µg/mL)						MIC50 (µg/mL)	MIC90 (µg/mL)
		2	4	8	16	32	64
abscessus (n = 41)	Smooth	0	1	10	11	0	0	8	16
	Rough	0	2	10	5	2	0	8	16
massiliense (n = 19)	Smooth	0	0	2	5	4	0	16	32
	Rough	0	0	3	0	4	1	32	32

LFX susceptibility against M. abscessus isolates

The MICs of LFX ranged from 4 to 64 μg/mL for the 60 clinical isolates. All isolates were resistant to LFX; however, no mutation associated with high-level LFX resistance was found in the QRDR of gyrA and gyrB genes. The MIC₅₀ for LFX against subsp. abscessus and subsp. massiliense were 8 and 16 µg/ mL, respectively. The MIC₉₀ for LFX against subsp. abscessus and subsp. massiliense were 16 and 32 µg/mL, respectively. M. abscessus subsp. massiliense showed relatively higher MIC than M. abscessus subsp. abscessus to LFX. For subsp. abscessus, no difference was found in the MICs of LFX between the smooth and rough morphotypes. For subsp. massiliense, the MIC₅₀ of LFX against the rough morphotype was slightly higher than that of the smooth morphotype (Table 2).

MIC values of LFX in the presence of efflux pump inhibitors

The efflux pump inhibitors CCCP, DCC, VP, and RSP can all reduce the MIC level of LFX, with CCCP having the most potent effect and RSP having a relatively weak effect. Specifically, the MIC levels of LFX were significantly reduced in more than half of the 60 strains in the presence of EPI (P < 0.05), except RSP (P > 0.05) (Fig. 1). The effect of each EPI in combination with LFX and the MIC change ratio is shown in Table 3. After the combined use of CCCP or DCC, the MIC value of LFX in 58.5–63.3% of the strains decreased more than two times. After combining VP or RSP, the MIC value of LFX decreased more than two times in nearly 43.3% of the strains. In the presence of CCCP, DCC, VP, and RSP, 21.7% (13/60), 13.3% (8/60), 10% (6/60), and 6.7% (4/60) of LFX-resistant strains reversed to sensitive, respectively. Specifically, the MIC value was lower than 1 µg/mL. Additionally, 15% (9/60), 21.7% (13/60), 5% (3/60), and 16.7% (10/60) of the resistant strain recovered to moderate sensitivity (i.e., MIC = 2 µg/mL). Among the four efflux pump inhibitors, CCCP manifested the most potent efflux pump inhibitory effect, followed by DCC, and the effects of VP and RSP were relatively weak.

Fig 1.

MIC changes of LFX after being combined with different efflux pump inhibitors.

TABLE 3.

Fold decrease in LFX MIC of M. abscessus isolates in the presence of efflux pump inhibitors

Efflux pump inhibitors	No. of isolates showed decreased fold change in LFX MIC
	≤2-fold	4-fold	8-fold	≥16-fold
CCCP	22	20	10	8
DCC	25	20	10	5
VP	34	14	7	5
RSP	34	20	2	4

Transcription level of efflux pump genes

Ten efflux pump genes have been selected by reviewing the literature, including the ABC superfamily (MAB_2355, MAB_1846, and MAB_1560), RND superfamily (MAB_2301, MAB_1134, and MAB_4382), and MFS superfamily (MAB_ 3142, MAB_ 1409, MAB_ 2807, and MAB_ 0970). The transcription of the above efflux pump genes was investigated in four isolates with MIC of LFX reduced less than two times, and four strains with MIC reduced more than eight times. Compared with the group of isolates with LFX MIC change less than two times, the transcription level of MAB_2355, MAB_1846, MAB_1560, MAB_2301, MAB_1134, MAB_2807, and MAB_0970 genes was significantly higher in the group with MIC change more than eight times (P < 0.05). The transcription of MAB_ 4382, MAB_ 3142, and MAB_ 1409 genes were relatively low in both groups (data not shown). These findings indicated that strains exhibiting more pronounced EPI effects displayed somewhat elevated transcription levels for efflux pump genes upon exposure to LFX (Fig. 2).

Fig 2.

Efflux pump gene expression in M. abscessus clinical isolates following exposure to LFX.

DISCUSSION

Limited drug options, high treatment side effects, long treatment courses, and high expenditure are common challenges in treating M. abscessus infections. LFX has been proven to be active, safe, and relatively cheap in TB treatment; however, its therapeutic efficacy against M. abscessus is poor. Thus, we investigated the mechanism of intrinsic LFX resistance in M. abscessus clinical isolates. Our present study showed that the efflux pump inhibitors could reverse the LFX resistance of most M. abscessus isolates in vitro. This work extends our understanding of the factors that affect the resistance of M. abscessus to LFX and sheds light on applying this efficacious reagent in M. abscessus infection treatment with a new strategy.

The main resistance mechanism of Mycobacterium to quinolones is DNA gyrase and topoisomerase IV specific site mutation due to gyrA and gyrB gene mutations (26, 27). An alanine residue at position 83 (Ala-83) in the gyrA gene and Arg-447 and Asn-464 in gyrB was associated with intrinsic resistance to quinolones in M. abscessus (28). We also found that the QRDR region of gyrA and gyrB genes was almost identical in all M. abscessus clinical strains, and only two to three single-nucleotide polymorphisms (SNPs) existed (Fig. S1 and S2). Still, no SNP in gyrA or gyrB genes could explain the relatively higher level of LFX resistance in M. abscessus. Therefore, alternate mechanisms need to be investigated (29, 30). Recently, efflux pump-mediated drug resistance has been considered to be a putative contributor to drug resistance in M. abscessus (31, 32).

Efflux transporters are transmembrane proteins that extrude harmful compounds and cellular metabolites from the cells into the external environment (33). They are involved in drug resistance by expelling antimicrobials, reducing their intracellular concentration. Sun et al. found that RSP, VP, and CCCP could reduce the MIC of quinolone in 55%, 74%, and 83% of drug-resistant strains of Mtb by more than two times, and the efflux pump activity is higher among the strains with high level of quinolone resistance (34). Recently, Machado et al. found a new EPI (3-phenyl quinolones) can significantly reduce the MIC value of LFX against sensitive and drug-resistant Mycobacterium avium strains (35) and showed better inhibitory activity than VP (36). It has been reported that EPIs reduced the clarithromycin MIC of M. abscessus (32, 37). However, the effect of EPIs on the activity of LFX against M. abscessus has not been verified in clinical isolates. In this study, we found that CCCP, DCC, VP, and RSP reduced the MIC of LFX in 63.3% (38/60), 58.3% (35/60), 43.3% (26/60), and 43.3% (26/60) of the clinical strains, and 21.7% (13/60), 13.3% (8/60), 10% (6/60), and 6.7% (4/60) LFX-resistant strains reversed to sensitive phenotype (MIC ≤1 µg/mL), supporting that efflux is also involved in conferring resistance against LFX in M. abscessus. We observed that VP and RSP exhibited minimal effects on LFX resistance in M. abscessus, but the specific reason is not yet clear. Similar phenomena have been found in some studies on the efflux pump inhibitors of Mycobacterium. Gumral and Yuri et al. found that VP and RSP have a less inhibitory effect on the efflux of Mycobacterium tuberculosis and drug-resistant Mycobacterium tuberculosis than CCCP and other EPIs (38, 39). We speculated that the effect of specific efflux pump inhibitors may be related to the efflux pump gene and the type of drug, but more studies are needed to elucidate it.

To further analyze the contribution of efflux pumps in conferring LFX resistance in M. abscessus, the transcription of 10 efflux pump genes belonging to ABC superfamily, RND superfamily and MFS superfamily, were investigated in eight selected isolates exposed to 1/2 MIC of LFX determined for each isolate. We noted that the transcription levels of 7 out of 10 efflux pump genes increased significantly in isolates with high fold change of MIC after the LFX-EPI combination. Li et al. found that deleting the MFS superfamily transporter LfrA homologous gene (MAB_ 2807 in M.abscessus) can restore the sensitivity of Mycobacterium smegmatis against antibacterial drugs, including quinolones (40–43). In addition, MFS superfamily transporter Rv1634 and ABC binding box superfamily transporter complex Rv2686c-Rv2627c-Rv2688c were found to be involved in quinolone resistance in Mycobacterium smegmatis (44, 45). Consistent with other findings, our study demonstrated that the efflux pump played an important role in the LFX resistance of M. abscessus and can be inhibited by EPIs to a certain extent.

This study has several limitations. First, all 60 M. abscessus clinical isolates were collected from one biobank, lacking other strains from diverse biobanks. Thus, the interpretation of the data may be biased. Second, the M. abscessus subsp. bolletii has rarely been isolated in China, and our center has not isolated this species so far, so it was impossible to study it in our present study. Third, we did not measure genes other than gyrA and gyrB; we would test genes such as parC. Finally, we did not test the transcription levels of efflux pump genes in all isolates. The specific mechanism of these genes needs to be explored further to identify whether they also mediate the resistance of M. abscessus against other antibiotics. The mechanism of the efflux pump gene in causing drug resistance of M. abscessus is the focus of our next exploration.

Conclusion

Efflux pump plays an important role in the resistance mechanism of M. abscessus to LFX, and EPIs could reverse the resistance of M. abscessus isolates to LFX in vitro. Combining LFX and EPIs in M. abscessus infection treatment is worthy of further investigation in animal models or clinical practice.

ETHICS APPROVAL

The study was approved by the Ethics Committee of Beijing Chest Hospital, Capital Medical University.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/aac.01348-23.

Figure S1. aac.01348-23-s0001.tif.

QRDR of gyrA.

Figure S2. aac.01348-23-s0002.tif.

QRDR of gyrB.

Supplemental legends. aac.01348-23-s0003.docx.

Legends for Table S2 and Fig. S1 and S2.

Table S1. aac.01348-23-s0004.xlsx.

Raw data that include strain ID, morphotype, LFX, and each efflux pump inhibitor MIC values of each isolate.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.