Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Feb 28;103(5):103587. doi: 10.1016/j.psj.2024.103587

Pigeon novel-miR-741 targets OTUD1 to inhibit proliferation and promote apoptosis of crop fibroblasts

Ran Zhang *,1, Yunlei Li *,1, Xinyi Li *, Aixin Ni *, Yuxin Gao †, Yunhe Zong *, Yanyan Sun *, Jingwei Yuan *, Jilan Chen *, Hui Ma *,2
PMCID: PMC11067753  PMID: 38479099

Abstract

Trichomonas gallinae (T. gallinae) is a globally distributed protozoan parasite and could cause serious damage to the pigeon industry. MiRNAs have important roles in regulating parasite infection, but its impacts on T. gallinae resistance have rarely been reported. In the present study, we identified a new miRNA (novel-miR-741) and its predicted target OTU deubiquitinase 1 (OTUD1) that might be associated with immunity to T. gallinae in pigeon. Novel-miR-741 and OTUD1 over-expression vectors and interference vectors were constructed. Results from dual luciferase activity assay demonstrated that OTUD1 was a downstream target of novel-miR-741. The Cell Counting Kit-8 and apoptosis assays showed that novel-miR-741 inhibited the proliferation and promoted apoptosis of pigeon crop fibroblasts. Meanwhile, mRNA levels of OTUD1 were significantly reduced in novel-miR-741 mimic-transfected fibroblasts, while mRNA levels of OTUD1 were significantly increased in the novel-miR-741 inhibitor-transfected fibroblasts. The regulatory roles of si-OTUD1 on fibroblasts proliferation, apoptosis, and migration were similar to novel-miR-741 mimic. Our findings demonstrated that novel-miR-741 inhibited the proliferation, and migration of crop fibroblasts, while OTUD1 promoted the proliferation and migration of crop fibroblasts. Therefore, the regulation of OTUD1 by novel-miR-741 was proposed as a potential therapeutic strategy for T. gallinae.

Key words: pigeon, Trichomonas gallinae, crop fibroblast, novel-miR-741, OTUD1

INTRODUCTION

The flagellate Trichomonas gallinae (T. gallinae), which is prevalent in pigeons in particular, dwells in the respiratory tracts (Collántes-Fernández et al., 2018; Santos et al., 2020). Through saliva and crop milk, it infects the pharynx, esophagus, and upper digestive tract (mouth) of pigeons, resulting in serious lesions or clinical symptoms in squabs (Collántes-Fernández et al., 2018). Significant financial losses are experienced as a result of the widespread distribution and simplicity of secondary infection caused by T. gallinae. Currently, the prevention and treatment of T. gallinae frequently include the use of chemical synthetic pharmaceuticals and medicinal plant extracts, which are easily the source of drug resistance and drug residues, damaging human health when used in cattle and poultry products (Lumeij and Zwijnenberg, 1990; Munoz et al., 1998; Mehriardestania et al., 2017).

MiRNAs are a class of highly evolutionary conserved endogenous single-stranded small non-coding RNAs (19-25 nucleotides), which participate in numerous biological processes and diseases. MiRNAs can post-transcriptionally control expression of target genes by directly binding to their 3′-untranslated region (UTR), leading to mRNA degradation or inhibition of mRNA translation (Bartel, 2009; Saliminejad et al., 2019). Host miRNAs have been shown to regulate cellular responses to infection by parasites (Ming et al., 2017). Researches of miRNAs demonstrate that they play important roles in immunologic process. However, the mechanisms of miRNA resistance to parasitic infections in pigeon are still unknown.

In the previous study, we analyzed the whole transcriptome sequencing of oral mucosa tissues of 11 squabs from 3 groups including control (C), susceptible (S) and tolerant (T) groups according to different resistance to T. gallinae infections (Yuan et al., 2021; Li et al., 2023). According to the small RNA sequencing results, the expression of novel-miR-741 was significantly downregulated in T group compared with C group. Novel-miR-741 had a predicted targeting relationship with differentially expressed OTUD1, which was significantly upregulated in T group compared with C group. The conclusion of the previous study was that both novel-miR-741 and OTUD1 were related to the immune regulation of T. gallinae. We hypothesize that OTUD1 could be negatively regulated by novel-miR-741 and could promote the immune response after T. gallinae infection. The objective of this study was to demonstrate the regulating role of novel-miR-741 to OTUD1 and reveal the regulatory mechanisms of novel-miR-741/OTUD1 on T. gallinae resistance in pigeon.

MATERIALS AND METHODS

Sample Collection and Cell Culture

Crop was separated from embryonated pigeon eggs at 17 d under sterile circumstances. The surrounding connective tissue and blood in the crop tissue were removed before the crop tissue was rinsed 5 to 6 times with phosphate-buffered saline (PBS, Gibco, GRI) containing 1% antibiotics (1% penicillin and 1% streptomycin mixture; Solarbio, Beijing, China). The crop tissue was minced to 1 mm3 pieces by sterile surgical shears and equally distributed on a 10 cm cell culture dish. Fetal bovine serum about 1 mL (FBS, Gibco, ASW, AU) was added in the dish and then it was placed in a 5% CO2 cell incubator. In order to cultivate the cells, complete medium with 10% fetal bovine serum (FBS) and 1% antibiotics (1% penicillin and 1% streptomycin mixture) was added. They were identified as fibroblasts by immunofluorescence. The cells were processed through 0.25% pancreatic enzyme after reaching a confluence of 80 to 90%, and the cells after passage were employed for subsequent testing.

Plasmid Construction and Cell Transfection

The novel-miR-741 mimic, novel-miR-741 inhibitor, si-OTUD1 and empty vector required for the assay were synthesized by Shanghai Jima Pharmaceutical Technology Company (Gene Pharma, Shanghai, China). All constructs were verified by sequencing using the sequence information showed in Table 1. At a density of approximately 2×105 cells per well, the cells were seeded into 6-well culture plates and incubated at 5% CO2 cell incubator. For plasmid transfection, fibroblasts were transfected using Lipofectamine 3000 Reagent (Invitrogen, Carlsbad, CA) following the product manual. Cells were collected 24 h after transfection.

Table 1.

The oligonucleotide sequences used in the present study.

Name1 Sense strand Anti-sense strand
si-OTUD1-1 GGUGGAGAAGCAGGACAAGUATT UACUUGUCCUGCUUCUCCACCTT
si-OTUD1-2 GGCAAAUGCUGAACGUGAACATT UGUUCACGUUCAGCAUUUGCCTT
si-OTUD1-3 GAUGUACAUUGAGCAGAAUGCTT GCAUUCUGCUCAAUGUACAUCTT
NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
Novel-miR-741 mimic CCAGCAGGAGCUGGGAGCCUCU AGGCUCCCAGCUCCUGCUGGUU
Novel-miR-741 inhibitor AGAGGCUCCCAGCUCCUGCUGG /
Open in a new tab
1

si-OTUD1-1, si-OTUD1-2 and si-OTUD1-3 were the interference RNA of OTUD1 gene. NC was negative control.

RNA Extraction, Reverse-Transcription and Real-Time Quantitative PCR

Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA) from cell samples. The concentration of RNA was estimated using the NanoDrop 2000 (Thermo, Waltham), and its integrity was assessed by electrophoresis on 1.5% agarose gels. HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme, Nanjing, China) was used for the reverse transcription of cDNA according to the manufacturer's instruction. The real-time quantitative PCR (qRT-PCR) primer pairs for genes and novel-miR-741 were given in Table 2. For the protein-coding gene, the β-action gene was used as the internal reference, and U6 was used as an internal reference for miRNA expression analysis. Primers were designed using National Center for Biotechnology Information (NCBI) and Vazyme miRNA primer design software. All primers were synthesized by Beijing Liuhe Huada Gene Technology Co., Ltd. (Beijing, China).

Table 2.

The primer pairs used in the present study.

Gene symbol Primer sequence (5′→3′)
OTUD1 F:TTCCGCTTCCACATCATCCC R:AGTGGTCAGCGATGTAGTGC
β-actin1 F:GAGAAATTGTGCGTGACATCA R:CCTGAACCTCTCATTGCCA
Open in a new tab
1

indicate the housekeeping genes for protein-coding gene and miRNA, respectively.

F, forward primer; R, reverse primer.

The real-time PCR was conducted using Taq Pro Universal SYBR qRCR Master Mix (Vazyme, Nanjing, China) on ABI Q7 Flex. The PCR volume included 2 μL of cDNA template, forward and reverse primers (0.4 μL each), 10 μL of 2 × SYBR Green qPCR Master Mix (Q712, Vazyme), and RNase-free water to the final volume of 20 μL. All reactions were conducted under the following conditions: pre-denaturation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 3 s, and annealing extension at 60°C for 30 s. Finally, the default solution curve acquisition program of instrument was adopted. The level of relative gene expression was evaluated by the 2−ΔΔCt method (Schmittgen and Livak, 2008).

Target Gene Prediction, Plasmid Construction and Dual-Luciferase Reporter Assay

The target genes of novel-miR-741 were predicted using a combination of miRanda, miRTarBase and TargetScan databases, and the binding region of novel-miR-741 in the 3′-UTR of pigeon OTUD1 gene was predicted on BiBiServ (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/). To construct the dual-luciferase miRNA target reporter plasmid, the 3′-UTR of OTUD1 containing the novel-miR-741 binding region was cut by restriction enzyme XbaⅠ and cloned in the GV272 vector. To determine whether novel-miR-741 targeting 3′-UTR of OTUD1, HEK293T cells cultured in 24-well plates were co-transfected with novel-miR-741 mimic or negative control (NC) and GV272/OTUD1-wt or GV272/ OTUD1-mut using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA), respectively. At 48 h after transfection, HEK293T cells were harvested and lysed, then the luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega, Madison, WI). The relative luciferase activities were calculated by comparing the Firefly/Renilla luciferase activity ratio. Transfections repeated at least 3 times in every independent experiments.

Cell Proliferation Assay

The fibroblasts (1×104 cells/well) were seeded in 96-well plate and transfected with si-OTUD1, novel-miR-741 mimic, novel-miR-741 inhibitor and their matched controls. Cell proliferation assays were performed using the Cell Counting Kit-8 (CCK-8) (Beyotime, China) following the manufacturer's instructions. After transfecting for 0 h, 24 h, 48 h, and 72 h, the CCK-8 solution (10 μL) was added to each well at every time. The plates were then incubated at 37°C for 1.5 h. Using a microplate reader, the absorbance of each well was detected at 450 nm.

Cell Apoptosis Assay

Transfection was performed when cells reached 80% confluence after being seeded in 6-well plates. After 48 h culture, cells were collected and washed with PBS. Then cells were incubated with Annexin V-FITC/PI (Solarbio, China) and the apoptotic rate was analyzed by flow cytometry (BD FACSVerse; Becton Dickinson, Holdrege, NE).

Cell Migration Assay

Cell migration was determined using falcon cell culture inserts with a pore size of 8 μm. The lower chamber was filled with 600 mL of complete medium supplemented with 10% FBS, and the upper chamber was seeded with cells suspended in 200 mL of serum-free medium. After incubation at 37°C and 5% CO2, nonmigrated cells were removed carefully from the upper surface of the membrane with a cotton swab. Then the cells were fixed with methanol. With the use of crystal violet solution and a light microscope, the migrated cells on the lower side of the membrane were counted. The number of fibroblast migration was calculated using Image J software.

Statistical Analysis

Statistical analysis was performed using SPSS 26.0 (IBM Corp, Armonk, NY) and GraphPad Prism software version 9.0 (GraphPad Software, San Diego CA). The data were presented as mean ± standard error of the mean (SEM), we compared data between 2 groups with Student t-test. P value < 0.05 was considered to be statistically significant. P value < 0.01 was considered to be statistically extremely significant.

RESULTS

Efficiency of si-OTUD1 Interference Detection

Efficiency of the transfection was determined 24 h after the fibroblasts were transfected with si-OTUD1-1, si-OTUD1-2, si-OTUD1-3, and negative control (NC), respectively. The result demonstrated that OTUD1 expression was significantly reduced by both si-OTUD1-2 and si-OTUD1-3 (P < 0.01, Figure 1). Si-OTUD1-2 had the highest interference efficiency among the 3, so si-OTUD1-2 was used in the following experiments.

Figure 1.

Figure 1

Open in a new tab

Detection of OTUD1 gene interference effect. si-OTUD1-1, si-OTUD1-2 and si-OTUD1-3 was the interference RNA of OTUD1 gene. NC was negative control. ⁎⁎P < 0.01.

OTUD1 was a Target Gene of Novel-miR-741

The target genes of novel-miR-741 were predicted using a combination of the miRanda, miRTarBase, and TargetScan databases. In order to confirm that novel-miR-741 specifically targeted OTUD1 in 293T cells, the luciferase report assay was used. We created OTUD1-wt and OTUD1-mut plasmids with novel-miR-741 binding sites (Figure 2). When the 293T cells reached a confluence of 70%, the OTUD1-wt or OTUD1-mut vector was co-transfected with the miR-27b-3p mimic or its negative control using Lipofectamine 3000 Reagent, respectively. NC or novel-miR-741 mimic were co-transfected into 293T cells with wild-type or mutant plasmids. The results showed that the luciferase activity significantly decreased (P < 0.01, Figure 3) in the 293T cells co-transfected with the OTUD1-wt vector and novel-miR-741 mimic than in those co-transfected with the OTUD1-wt vector and mimic NC. However, there was no significant difference (P > 0.05) in the luciferase activity between the cells co-transfected with the OTUD1-mut vector and novel-miR-741 mimic and those co-transfected with the OTUD1-mut vector and mimic NC.

Figure 2.

Figure 2

Open in a new tab

Information of GV272 and CV045 vector and novel-miR-741 binding sites. (A) Firefly luciferase was labeled on GV272 vector; (B) Renilla luciferase was labeled on CV045 vector; (C) The highlighted part indicates the binding site, and the base marked with red indicates the mutation site.

Figure 3.

Figure 3

Open in a new tab

OTUD1 was verified as a target gene of novel-miR-741. Effects of transfection with the novel-miR-741 mimic on the luciferase activity of OTUD1-wt and OTUD1-mut when compared to the mimic NC group. ⁎⁎P < 0.01.

Regulation Effect of Novel-miR-741 on OTUD1 Expression

To further verify whether novel-miR-741 directly regulating the expression of OTUD1, vectors of novel-miR-741 overexpression and interference were constructed and transfected into fibroblasts. After transfection with novel-miR-741 mimic, novel-miR-741 inhibitor, mimic NC and inhibitor NC, extracting RNA from cells, reverse transcription, and quantification. The results showed that when novel-miR-741 was overexpressed, the expression of OTUD1 was significantly decreased (P < 0.001, Figure 4A), and when novel-miR-741 was inhibited, the expression of OTUD1 was significantly increased (P < 0.05, Figure 4B), indicating that OTUD1 was negatively regulated by novel-miR-741.

Figure 4.

Figure 4

Open in a new tab

(A) The expression level of OTUD1 changes after overexpression of novel-miR-741. ⁎⁎⁎P < 0.001. (B) The expression level of OTUD1 changes after novel-miR-741 was knocked down. *P < 0.05.

OTUD1 Promotes Proliferation and Migration of Fibroblast

To evaluate the biological function of OTUD1, we used the CCK-8 assay to assess the effects of OTUD1 on proliferation of fibroblasts. We transfected si-OTUD1 and NC to the fibroblasts. The CCK8 data showed that 48 h after transfection, the proliferation of cells transfected with si-OTUD1 was significantly reduced compared with that of cells transfected with NC (P < 0.01, Figure 5), demonstrating that OTUD1 gene could significantly improve fibroblast proliferation. To confirm the effect of OTUD1 on fibroblast migration, a transwell test was performed (Figure 6A). Compared with the negative control group, the migration efficiency of si-OTUD1 transfected group was significant lower (P < 0.01, Figure 6B). This result suggested that OTUD1 could improve cell migration.

Figure 5.

Figure 5

Open in a new tab

Effects of OTUD1 on proliferation of fibroblasts. The cell proliferation assay was performed using the Cell Counting Kit-8. The fibroblasts were transfected with si-OTUD1 and NC. ⁎⁎P < 0.01.

Figure 6.

Figure 6

Open in a new tab

Effects of OTUD1 on migration of fibroblasts. (A) The fibroblasts were transfected with si-OTUD1 and NC. (B) The number of fibroblast migration was calculated using Image J software. The values were means ± SEM. ⁎⁎P < 0.01.

OTUD1 Inhibits Apoptosis of Fibroblast

Cell samples were stained and incubated with Annexin V and PI, the apoptosis rate of the si-OTUD1 group was significantly higher than that of the NC group (P < 0.05, Figure 7B) according to the results of the flow cytometry assay (Figure 7A), demonstrating that OTUD1 gene can significantly inhibit fibroblast apoptosis.

Figure 7.

Figure 7

Open in a new tab

Effects of OTUD1 on apoptosis of fibroblasts. (A) The apoptosis of fibroblasts was performed using the flow cytometry. The fibroblasts were transfected with si-OTUD1 and NC. Three repetitions per group as shown. (B) The apoptosis rate was tested by t test. *P < 0.05.

Novel-miR-741 Inhibited Proliferation and Migration of Fibroblast

Results of CCK8 demonstrated that at 24 h and 72 h, cells transfected with novel-miR-741 mimic had significant less capacity to proliferate than cells transfected with mimic NC (P < 0.01, Figure 8). After transfection with novel-miR-741 inhibitor, cell proliferation was stimulated, demonstrating that novel-miR-741 might decrease cell proliferation. According to a cell migration test (Figure 9A), novel-miR-741 could significantly decrease the efficiency of cell migration since it significantly increased after novel-miR-741 was inhibited and dramatically decreased after novel-miR-741 was overexpressed (P < 0.01, Figure 9B).

Figure 8.

Figure 8

Open in a new tab

Effects of novel-miR-741 on proliferation of fibroblasts. The cell proliferation assay was performed using the Cell Counting Kit-8. (A) The fibroblasts were transfected with novel-miR-741 mimic, mimic NC. (B) The fibroblasts were transfected with novel-miR-741 inhibitor and inhibitor NC. *P < 0.05, ⁎⁎P < 0.01, ⁎⁎⁎P < 0.001.

Figure 9.

Figure 9

Open in a new tab

Effects of novel-miR-741 on migration of fibroblasts. (A) The fibroblasts were transfected withnovel-miR-741 mimic, mimic NC, novel-miR-741 inhibitor and inhibitor NC. Three repetitions per group as shown. (B) The number of fibroblast migration was calculated using Image J software. The values were means ± SEM.⁎⁎P < 0.01.

Novel miR-741 Promoted Apoptosis of Fibroblast

According to the results of flow cytometry, novel-miR-741 promoted apoptosis after transfection with novel-miR-741 mimic, but apoptosis significantly decreased after transfection with novel-miR-741 inhibitor (P < 0.05, Figure 10A). By analyzing the effects of novel-miR-741 on the apoptosis of fibroblast, it was found that the apoptosis rate was significantly higher (P < 0.05) compared with NC. The apoptosis rate was significantly lower in the novel-miR-741 inhibitor group (P < 0.05, Figure 10B).

Figure 10.

Figure 10

Open in a new tab

Effects of novel-miR-741 on apoptosis of fibroblasts. (A) The apoptosis of fibroblasts was performed using the flow cytometry. The fibroblasts were transfected with novel-miR-741 mimic, mimic NC, novel-miR-741 inhibitor and inhibitor NC. Three repetitions per group as shown. (B) The apoptosis rate was tested by t test. *P < 0.05.

DISCUSSION

Trichomonosis is an important factor restricting the development of pigeon industry. Trichomonosis is caused by T. gallinae infection, which will result in reducing production, widespread dissemination, and subsequent significant financial losses (Spriggs et al., 2020). Study of T. gallinae treatment has been necessary for the long-term development of the pigeon industry and there are many investigations by several academics now. While the current research primarily focuses on drugs and bioactive substance, including adding metronidazole-loaded lactoferrin nanoparticles, peganum harmala alkaloid extract, Chinese patent medicine, and other ingredients in feed and drinking water (Tabari et al., 2017; Tabari et al., 2021; Bailén et al., 2022). However, the effect is not effective, and there may be drug residues and tolerance ( Kurohara et al., 1991; Sobel et al., 1999). At present, there are few studies on pigeon T. gallinae at molecular level. With the advancement of molecular technology, it is now possible to manage T. gallinae in pigeons at the molecular level.

MicroRNAs are a class of small noncoding RNAs (19–25 nucleotides) that regulate mRNA and protein expression (Maudet et al., 2014). MiRNAs are involved in regulating various biological processes, such as cell differentiation, proliferation, angiogenesis, metabolism and cancer development (Piedade and Azevedo-Pereira, 2016). Previous studies had shown that miRNAs were involved in the staging, grading and histological subtype of ovarian cancer, indicating that miRNA could be used as a biomarker for screening ovarian cancer (Staedel and Darfeuille, 2013). By analyzing miRNA expression profiles in osteosarcoma, He et al. (2019) found that the expression level of miR-627-3p was relatively low, which could promote the proliferation and metastasis of osteosarcoma cells found that miRNA regulated the response of host epithelium to cryptosporidium infection. However, there are few reports about miRNA in T. gallinae pigeon infection. In previous study, we constructed T. gallinae control (C), susceptible (S) and tolerant (T) groups, and found differently expressed miRNAs and their target genes. The results showed that novel-miR-741 was down-regulated and OTUD1 was up-regulated in T group compared with C group (Li et al., 2023). There were many reports of the relationship of miRNAs and their target genes (Lewis et al., 2005; Betel et al., 2007; Chou et al., 2018). In this research, we studied the regulating effect of miRNA and their target gene on fibroblasts of crop in vitro, in order to reveal the mechanism of miRNA and their target genes resistant to T. gallinae. For crop is one of the main infected organs for T. gallinae, so crop cells were separated and cultivated in this study.

By interfering the expression of OTUD1, the proliferation of fibroblasts was reduced, the efficiency of cell migration was decreased, and the apoptosis rate was increased all significantly, indicating that OTUD1 could promote crop growth during T. gallinae infection. OTUD1 has previously been shown to be associated with immune and antiviral pathways. As report, OTUD1 is a key regulator of inflammation, innate immune and ROS signaling pathways (Oikawa et al., 2022). It can maintain immune homeostasis, and mutation of OTUD1 leading to autoimmunity (Lu et al., 2018). OTUD1 could upregulate the interferon (IFN) antiviral pathway and improve the immune ability (Zhang et al., 2020). Previous transcriptome sequencing results showed that novel-miR-741 was significantly down-regulated in oral tissues in T group compared with C group after T. gallinae infection. In this results, we verified that OTUD1 was negatively regulated by novel-miR-741, indicating that T group could activate immune response more efficiently than C croup.

CONCLUSION

In summary, this study identified OTUD1 was the functional target of novel-miR-741, which was negatively regulated by novel-miR-741. OTUD1 expression was up-regulated in T group after T. gallinae infection, which promoted the proliferation and migration of fibroblasts, and inhibited the apoptosis of fibroblasts. While novel-miR-741 inhibited the proliferation and migration of fibroblasts, and promoted apoptosis of crop fibroblasts. The results of this study provided a new insight into the regulation of miRNA in the course of T. gallinae infection, and provided a scientific basis for the prevention and control of T. gallinae in pigeons.

ACKNOWLEDGMENTS

This research was funded by Beijing Agriculture Innovation Consortium (BAIC06-2023) and Agricultural Science and Technology Innovation Program (ASTIPIAS04).

DISCLOSURES

The authors declare no conflicts of interest.

REFERENCES

  1. Bailén M., Díaz-Castellanos I., Azami-Conesa I., Fernández S.A., Martínez-Díaz R.A., Navarro-Rocha J., Gómez-Muñoz M.T., González-Coloma A. Anti-Trichomonas gallinae activity of essential oils and main compounds from Lamiaceae and Asteraceae plants. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.981763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bartel D.P. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136:215–233. doi: 10.1016/j.cell.2009.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Betel D., Wilson M., Gabow A., Marks D.S., Sander C. The microRNA.org resource: targets and expression. Nucleic Acids Res. 2007;36:D149–D153. doi: 10.1093/nar/gkm995. (Database) [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chou C., Shrestha S., Yang C., Chang N., Lin Y., Liao K., Huang W., Sun T., Tu S., Lee W., Chiew M., Tai C., Wei T., Tsai T., Huang H., Wang C., Wu H., Ho S., Chen P., Chuang C., Hsieh P., Wu Y., Chen W., Li M., Wu Y., Huang X., Ng F.L., Buddhakosai W., Huang P., Lan K., Huang C., Weng S., Cheng Y., Liang C., Hsu W., Huang H. miRTarBase update 2018: a resource for experimentally validated microRNA-target interactions. Nucleic Acids Res. 2018;46:D296–D302. doi: 10.1093/nar/gkx1067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Collántes-Fernández E., Fort M.C., Ortega-Mora L.M., Schares G. Parasitic Protozoa of Farm Animals and Pets. Springer International Publishing AG; 2018. pp. 313–387. [Google Scholar]
  6. He M., Shen P., Qiu C., Wang J. miR-627-3p inhibits osteosarcoma cell proliferation and metastasis by targeting PTN. Aging (Albany NY) 2019;11:5744–5756. doi: 10.18632/aging.102157. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  7. Kurohara M.L., Kwong F.K., Lebherz T.B., Klausterm eyer W.B. Metronidazole hypersensitivity and oral desensitization. J. Allergy. Clin. Immunol. 1991;88:279–280. doi: 10.1016/0091-6749(91)90341-k. [DOI] [PubMed] [Google Scholar]
  8. Lewis B.P., Burge C.B., Bartel D.P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are MicroRNA targets. Cell. 2005;120:15–20. doi: 10.1016/j.cell.2004.12.035. [DOI] [PubMed] [Google Scholar]
  9. Li X., Ni A., Zhang R., Li Y., Yuan J., Sun Y., Chen J., Ma H. Identification of miRNA Associated with Trichomonas gallinae resistance in pigeon (Columba livia) Int. J. Mol. Sci. 2023;24:16453. doi: 10.3390/ijms242216453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Lu D., Song J., Sun Y., Qi F., Liu L., Jin Y., McNutt M.A., Yin Y. Mutations of deubiquitinase OTUD1 are associated with autoimmune disorders. J Autoimmun. 2018;94:156–165. doi: 10.1016/j.jaut.2018.07.019. [DOI] [PubMed] [Google Scholar]
  11. Lumeij J.T., Zwijnenberg R.J. Failure of nitro-imidazole drugs to control trichomoniasis in the racing pigeon (Columba livia domestica) Avian Pathol. 1990;19:165–166. doi: 10.1080/03079459008418665. [DOI] [PubMed] [Google Scholar]
  12. Maudet C., Mano M., Eulalio A. MicroRNAs in the interaction between host and bacterial pathogens. Febs. Lett. 2014;588:4140–4147. doi: 10.1016/j.febslet.2014.08.002. [DOI] [PubMed] [Google Scholar]
  13. Mehriardestania M., Aliahmadib A., Toliatc T., Rahimia R. Medicinal plants and their isolated compounds showing anti- Trichomonas vaginalis- activity. Biomed. Pharmacother. 2017;88:885–893. doi: 10.1016/j.biopha.2017.01.149. [DOI] [PubMed] [Google Scholar]
  14. Ming Z., Zhou R., Chen X.M. Regulation of host epithelial responses to Cryptosporidium infection by microRNAs. Parasite Immunol. 2017;39 doi: 10.1111/pim.12408. [DOI] [PubMed] [Google Scholar]
  15. Munoz E., Castella J., Gutierrez J.F. In vivo and in vitro sensitivity of Trichomonas gallinae to some nitroimidazole drugs. Vet. Parasitol. 1998;78:239–246. doi: 10.1016/s0304-4017(98)00164-2. [DOI] [PubMed] [Google Scholar]
  16. Oikawa D., Gi M., Kosako H., Shimizu K., Takahashi H., Shiota M., Hosomi S., Komakura K., Wanibuchi H., Tsuruta D., Sawasaki T., Tokunaga F. OTUD1 deubiquitinase regulates NF-κB- and KEAP1-mediated inflammatory responses and reactive oxygen species-associated cell death pathways. Cell Death Dis. 2022;13:694. doi: 10.1038/s41419-022-05145-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Piedade D., Azevedo-Pereira J. The role of microRNAs in the pathogenesis of herpesvirus infection. Viruses. 2016;8:156. doi: 10.3390/v8060156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Saliminejad K., Khorram Khorshid H.R., Soleymani Fard S., Ghaffari S.H. An overview of microRNAs: biology, functions, therapeutics, and analysis methods. J. Cell. Physiol. 2019;234:5451–5465. doi: 10.1002/jcp.27486. [DOI] [PubMed] [Google Scholar]
  19. Santos H.M., Tsai C., Catulin G.E.M., Trangia K.C.G., Tayo L.L., Liu H., Chuang K.P. Common bacterial, viral, and parasitic diseases in pigeons (Columba livia): a review of diagnostic and treatment strategies. Vet. Microbiol. 2020;247 doi: 10.1016/j.vetmic.2020.108779. [DOI] [PubMed] [Google Scholar]
  20. Schmittgen T.D., Livak K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008;3:1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]
  21. Sobel J.D., Nagappan V., Nyirjesy P. Metronidazole-resistant vaginal trichomoniasis–an emerging problem. N. Engl. J. Med. 1999;340:618–626. doi: 10.1056/NEJM199907223410417. [DOI] [PubMed] [Google Scholar]
  22. Spriggs M.C., Purple K.E., Gerhold R.W. Detection of Trichomonas gallinae in wild birds admitted to a rehabilitation center, Florida, USA. J. Wildlife Dis. 2020;56:733. doi: 10.7589/2019-05-127. [DOI] [PubMed] [Google Scholar]
  23. Staedel C., Darfeuille F. MicroRNAs and bacterial infection. Cell Microbiol. 2013;15:1496–1507. doi: 10.1111/cmi.12159. [DOI] [PubMed] [Google Scholar]
  24. Tabari M.A., Poźniak B., Abrishami A., Moradpour A.A., Shahavi M.H., Kazemi S., Youssefi M.R. Antitrichomonal activity of metronidazole-loaded lactoferrin nanoparticles in pigeon trichomoniasis. Parasitol Res. 2021;120:3263–3272. doi: 10.1007/s00436-021-07263-z. [DOI] [PubMed] [Google Scholar]
  25. Tabari M.A., Youssefi M.R., Moghadamnia A.A. Antitrichomonal activity of Peganum harmala alkaloid extract against trichomoniasis in pigeon (Columba livia domestica) Br. Poult. Sci. 2017;58:236–241. doi: 10.1080/00071668.2017.1280725. [DOI] [PubMed] [Google Scholar]
  26. Yuan J., Ni A., Li Y., Bian S., Liu Y., Wang P., Shi L., Isa A.M., Ge P., Sun Y., Ma H., Chen J. Transcriptome analysis revealed potential mechanisms of resistance to Trichomoniasis gallinae infection in pigeon (Columba livia) Front. Vet. Sci. 2021;8 doi: 10.3389/fvets.2021.672270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Zhang Z., Wang D., Wang P., Zhao Y., You F. OTUD1 negatively regulates type I IFN induction by disrupting noncanonical ubiquitination of IRF3. J. Immunol. 2020;7:1904–1918. doi: 10.4049/jimmunol.1900305. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES