Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Feb 27;103(5):103592. doi: 10.1016/j.psj.2024.103592

Coagulase-negative staphylococci are the main causes of bacterial meningitis in duck

Jingyu Wang *,†,‡, Yu Meng *,†,‡, Ruihua Zhang *,†,‡, Hui Yan *,†,‡, Guige Xu *,†,‡, Yanli Zhu *,†,‡, Zhijing Xie *,†,‡, Shijin Jiang *,†,‡,1
PMCID: PMC11067754  PMID: 38447309

Abstract

Since September 2018, serious meningitis has been found on some breeding-duck farms in Shandong Province, China. A large number of ducks exhibit severe neurological symptoms. The ducks were randomly selected for laboratory testing. Duck brain samples were collected using standard sterile techniques, and the staphylococci isolates were detected in 404 (70.14%) out of 576 brain samples. A total of 525 coagulase-negative staphylococci (CoNS) strains were isolated, including 6 species: Staphylococcus sciuri (S. sciuri) (67.24%, 353/525), Staphylococcus epidermidis (S. epidermidis) (9.71%, 51/525), Staphylococcus saprophyticus (S. saprophyticus) (8.38%, 44/525), Staphylococcus lentus (S. lentus) (7.62%, 40/525), Staphylococcus haemolyticus (S. haemolyticus) (2.48%, 13/525), and Staphylococcus xylosus (S. xylosus) (4.57%, 24/525). Mixed strain infections were detected in 121 (29.95%) infected presentations. The antimicrobial susceptibility testing indicated that 40.38% of the isolates exhibited multi-drug resistance, and 53.90% of the strains were methicillin-resistant strains by amplification of the methicillin resistance gene (mecA) gene. Through experimental reproduction of the disease, we determined that the CoNS strains were the leading pathogens causing bacterial meningitis in ducks. Although these CoNS strains does not directly cause the death of sick ducks, they still cause large economic losses due to the retarded growth and development of the sick ducks, lower feed returns, and lower grades of processed duck products. The results of this study will contribute to our understanding of the epidemiology and pathogenesis of CoNS and be helpful in the prevention and treatment of the infection.

Key words: CoNS, bacterial meningitis, antimicrobial resistance, virulence factor

INTRODUCTION

Meningitis is an inflammatory infection of the membranes covering the brain and spinal cord, which is induced by different microorganisms such as bacteria, viruses, parasites, and fungi (Piantadosi, et al., 2021). Bacterial meningitis is a life-threatening invasive infectious disease of the central nervous system (CNS) and is associated with high morbidity and mortality all over the world (Hasbun, 2022). The genus Staphylococcus belongs to the family Micrococcaceae which are capable of causing a wide array of diseases. Staphylococci are widely distributed in nature, including air, soil, water, feed, human and animal surfaces, and the surface of objects (Bier and Schittek, 2021). Among staphylococci, coagulase-negative staphylococci (CoNS) are usually considered to be contaminants rather than causative agents (Michalik et al., 2020; Bier and Schittek, 2021). Although CoNS are the normal flora of skin and mucosa, some of them are the causative agents of meningitis (Huang et al., 2005; Ye et al., 2022). Clinically, severe infections such as meningitis induced by CoNS are generally found in immunocompromised patients (Huang et al., 2005; Peng et al., 2021).

As an opportunistic pathogen, CoNS has been gaining more and more attention in the healthcare field. The infections caused by CoNS have become increasingly common, which are not only harmful to humans, animals, and the environment, but also increase economic burden (Blot et al., 2005). For instance, bovine mastitis infections related to CoNS have increasingly been reported in recent years (Blot et al., 2005; Taponen and Pyörälä, 2009). Coagulase-negative staphylococci have been detected as food contaminants in different kinds of animal-derived food, such as meat or milk (Chajęcka-Wierzchowska et al., 2015; Osman et al., 2016). To date, it is particularly worrying that CoNS may be transferred from pets to owners, which suggests the urgent need to develop a new strategy for the prevention and treatment of the infection (Gómez-Sanz et al., 2019; Dazio et al., 2021). In poultry production, the most common CoNS associated with infections are Staphylococcus lentus (S. lentus), Staphylococcus xylosus (S. xylosus), Staphylococcus cohnii (S. cohnii), and Staphylococcus hyicus (S. hyicus) (Stępień-Pyśniak et al. 2017). A previous study has confirmed that CoNS isolates could be collected from ducklings exhibiting tremor in South Korea (Han et al., 2013). The CoNS strains isolated from broiler chickens and turkeys on poultry farms in Egyptian and Poland were either phenotypically or genotypically multidrug-resistant (Pyzik et al., 2019; Sorour et al., 2023). Further, Shokry et al. have comfirmed that experimental infection of broiler chicks with CoNS strains led to mild subclinical disease with histopathological lesions in the liver, spleen, and intestine (Shokry et al. 2018); polyserositis, hepatic, and myocardial necrosis have also been found in infected broiler chicks revealing the pathogenic potential of CoNS (Sorour et al., 2023). These studies all revealed the pathogenicity of CoNS strains to poultry.

At present, several virulence factors that contribute to the pathogenicity of staphylococci have been identified (Shahid et al., 2023). Staphylococcal enterotoxins (SEs) are a family of powerful superantigenic toxins encoded by multiple genes, mainly produced by Staphylococcus aureus (S. aureus), which often cause gastrointestinal disorders (Chen et al., 2023; Duarte et al., 2023; Zhao et al., 2023). Furthermore, the Staphylococcal enterotoxin gene sec is thought to be intensely linked to mastitis caused by S. aureus, and these strains can be transmitted to humans through the food chain (Fang et al., 2019). Hemolysin is an exotoxin produced by staphylococci which has lytic activity on erythrocytes. Bacterial strains with α-hemolysin can cause skin infection, septicemia, and pneumonia in human (Wan et al., 2022; Hulme, 2023). The the cell wall anchored protein-encoding gene (sasX) is a newly described virulence factor, which can significantly affect the adhesion, aggregation and biofilm formation of methicillin-resistant Staphylococcus aureus (MRSA) (De Backer et al., 2019; Tekeli et al., 2020). Data on the virulence genes of CoNS strains in ducks is limited, studies have revealed that the pathogenic potential of CoNS species depends on the production of enterotoxin genes which could be transmitted by coexistence with pathogenic staphylococci (Osman et al. 2020). For example, Sorour et al. have detected the sed gene in 7 out of 25 CoNS isolates collected from broiler chicks (Sorour et al., 2023). Pyzik et al. (2019) have also indicated CoNS strains can be a source of food intoxication by testing for the presence of the 5 classical enterotoxin genes.

Recently, there has been an increase in clinical research interest in CoNS, however, little data on their prevalence, antibiotic resistance profiles, and pathogenicity on breeding-duck farms was reported. In this study, we assessed the staphylococci strains isolated from duck brain tissue samples and found that CoNS strains were the leading cause of duck bacterial meningitis. By analyzing the relevant epidemiological characteristics, antimicrobial resistance profiles, and virulence potential of these CoNS strains, we tried to clarify the role of CoNS in duck bacterial meningitis.

MATERIALS AND METHODS

Sample Collection

From September 2018 to April 2021, a disease that manifested severe neurological symptoms continued to occur on breeding-duck farms in Shandong Province of China. Randomly selected ducks showing clinical symptoms of the disease were examined. The clinical signs were mainly ataxia, twisted head and neck, tremor, paralysis of the legs, and angulation. During this time, brain samples from 576 diseased ducks were collected for viral nucleic acid detection and bacterial isolation. To collect brain samples, ducks were anesthetized using Nembutal and then decapitated. After isolation and removal of the meninges using standard sterile techniques, the brain samples were collected in polypropylene tubes and were used for bacterial isolation. For total RNA isolation, brains were washed in ice-cold, RNase-free saline for 1-2 min. The brain tissues were homogenized in TRIzol, frozen in dry ice, and stored at −80°C until processed.

Bacterial Isolation and Identification

According to the manufacturer's instructions, RNA was extracted from the collected brain samples using RNA pure Tissue & Cell Kit (DNase I) (Cowin, Beijing, China). Common infections caused by known viruses related to neurological symptoms in ducks were ruled out based on detection by PCR, including the avian influenza virus (AIV) and duck Tembusu virus (DTMUV), Newcastle disease virus (NDV) and novel duck-origin goose parvovirus virus (NGPV). The primers used in the study are shown in Table 1. All primers were synthesized by Sangon Biotech Co. Ltd. (Shanghai, China).

Table 1.

Primer sequences for virus detection.

Gene GenBank accession numbers Sequence (5’→3’) Anneal temperature(°C) Size/bp
AIV MK964315.1 F: GGAGGTTGGTCAGGATTAGTTG 59 560
R: ACAAGAGATGAGGCGACAGT
NDV MK660779.1 F: AGGGACTGAAGAGGAGGATT 52 427
R: TGAGTGTGATTGTATTAGGTGG
TMUV MN747003.2 F: CTGAAATAGCGGAAGCACTGA 58 277
R: CTGGAGGTGTGGCTGTCAT
N-GPV MN233574.1 F: GAGCATCAACTCCCGTATGTCC 48 640
R: CTACTTCCTGCTCGTCCGTGA
Open in a new tab

The collected brain tissue samples were plated on a blood agar medium (HaiBo, Qingdao, China) and Chapman selective medium (Tuopu, Qingdao, China) and incubated under aerobic conditions at 37°C for 24 to 48 h, depending on the rate of growth of the bacteria. Single colonies were picked from the plates and repeatedly grown on blood agar plates until pure cultures were obtained, and a preliminary bacteriological characterization was made of the isolated microbiota, involving Gram-staining, cell morphology and motility, and examination under a microscope. Isolated bacteria were stored in brain-heart infusion (BHI, Sigma, Darmstadt, Germany) broth containing 50% glycerol at −80°C.

Identification of all staphylococci strains was performed by MALDI-TOF/TOF mass spectrometry, as described by Silva et al. (2022).

Antimicrobial Susceptibility Testing

The Kirby-Bauer disk diffusion method was applied to test the antibiotic susceptibility of all isolates. The tested antibiotics included: amikacin (AMK, 30µg), ampicillin (AMP, 10μg), ceftriaxone (CRO, 5µg), ciprofloxacin (CIP, 5µg), clindamycin (DA, 10μg), enrofloxacin (ENR, 10μg), erythromycin (ERY, 15 μg), florfenicol (FFC, 30μg), ofloxacin (OFX, 5µg), fosfomycin (FOS, 50µg), gentamicin (CN, 10μg), methicillin (MET, 5μg), neomycin (N, 30μg), nitrofurantoin (FT, 300μg), penicillin (PEN, 10μg), rifampin (RFP, 5µg), tetracycline (TET, 30μg) and vancomycin (VA, 30μg). The diameter of the inhibition zones around each disc was measured and recorded in millimeters. Interpretation of results was performed according to the recommendations of the Clinical and Laboratory Standards Institute recommendations (CLSI, 2018). For quality control, S. aureus ATCC 25923 was used in the disc diffusion tests.

Screening for Virulence-Associated Genes

All staphylococci isolates were screened for virulence-associated genes by PCR assays, the detected genes including α, β, δ, and γ-hemolysin genes (hla, hlb, hld, and hlg), leukocidin gene (pvl), fibronectin-binding proteins A and B genes (fnbA and fnbB), coagulation factor A gene (clfA), enterotoxin genes (sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep and seq), exfoliative toxin genes (exhA and exhB), toxic shock syndrome toxin gene (tst), sasX and mecA gene. The PCR amplifications were recovered, purified, and sequencing analyzed. Detailed information on the primer sequences was shown in Table 2. The following standard strains were employed as positive controls for PCR assays: ATCC8739, ATCC29213, ATCC13048, ATCC43300, ATCC14458, ATCC13565, ATCC25923, ATCC23235 and ATCC19095.

Table 2.

Primer sequences of virulence-associated genes.

Gene Sequence (5’→3’) Anneal temperature (°C) Size /bp Ref.
FnbA F: CACAACCAGCAAATATAG 48 1279 Paniagua-Contreras et al., 2012
R: CTGTGTGGTAATCAATGTC
fnbB F:CAGAAGTACCAAGCGAGCCGGAAA 65 258 Campbell et al., 2008
R:CGAACAACATGCCGTTGTTTGTTGA
clfA F: ATTGGCGTGGCTTCAGTGCTTG 48 357 Campbell et al., 2008
R: GCTTGATTGAGTTGTTGCCGGTGT
pvl F: TGCCAGACAATGAATTACCCCCATT 60 894 Paniagua-Contreras et al., 2012
R: TCTGCCATATGGTCCCCAACCA
sea F:TTGCAGGGAACAGCTTTAGGCAATC 60 252 Paniagua-Contreras et al., 2012
R: TGGTGTACCACCCGCACATTGA
seb GACATGATGCCTGCACCAGGAGA 64 355 Paniagua-Contreras et al., 2012
AACAAATCGTTAAAAACGGCGACACAG
sec CCCTACGCCAGATGAGTTGCACA 62 602 Paniagua-Contreras et al., 2012
CGCCTGGTGCAGGCATCATATC
sed GAAAGTGAGCAAGTTGGATAGATTGCGGCTAG 65 352 Paniagua-Contreras et al., 2012
CCGCGCTGTATTTTTCCTCCGAGAG
see AGATTTAGCAAAGAAGTACAAAGATG 55 473 Sergeev et al., 2004
TGTATAAATACAAATCAATATGGAGGTTCTCT
seg AGAATTAGCTAACAATTATAAAGATAAAAAAG 52 496 Sergeev et al., 2004
TCAGTGAGTATTAAGAAATACTTCCAT
seh TGATTTAGCTCAGAAGTTTAAAAATAAAAATG 52 466 Sergeev et al., 2004
TTTCTTAGTATATAGATTTACATCAATATG
sei TGATTTAGCTCAGAAGTTTAAAAATAAAAATG 51 505 Sergeev et al., 2004
TTAGTTACTATCTACATATGATATTTCGA
sej ATGAAAAAAACAATATTTATACTGATTTTCTCCC 56 807 Sergeev et al., 2004
TCTACAGAACCAAAGGTAGACTTATTAATAC
sek ATGAATCTTATGATTTAATTTCAGAATCAA 51 545 Sergeev et al., 2004
ATTTATATCGTTTCTTTATAAGAAATATCG
sel ATGAAAAAAAGATTATTATTTGTAATTGTTATTAC 52 723 Sergeev et al., 2004
ATCATCTTTTTGAAATTTCGACATCTAG
sem ATGAAAAGAATACTTATCATTGTTGTTTTATTG 53 720 Sergeev et al., 2004
CTTCAACTTTCGTCCTTATAAGATATTTC
sen ATAAAAAATATTAAAAAGCTTATGAGATTGTTC 51 777 Sergeev et al., 2004
ACTTAATCTTTATATAAAAATACATCAATATG
seo TATGTAGTGTAAACAATGCATATGCA 53 685 Sergeev et al., 2004
TCTATTGTTTTATTATCATTATAAATTTGCAAAT
sep TTAGACAAACCTATTATCATAATGGAAGT 52 618 Sergeev et al., 2004
TATATAAATATATATCAATATGCATATTTTTAGACT
seq GGAAAATACACTTTATATTCACAGTTTCA 53 539 Sergeev et al., 2004
ATTTATTCAGTTTTCTCATATGAAATCTC
tst AGCCCTGCTTTTACAAAAGGGGAAAA 64 306 Paniagua-Contreras et al., 2012
CCAATAACCACCCGTTTTATCGCTTG
hla CGAAAGGTACCATTGCTGGT 53 744 Tavares et al., 2014
CCAATCGATTTTATATCTTTC
hlb GTGCACTTACTGACAATAGTGC
GTTGATGAGTAGCTACCTTCAGT		 52 309 Zhang et al., 2020
hld AGAATTTTTATCTTAATTAAGGAAGGAGTG
TTAGTGAATTTGTTCACTGTGTCGA		 56 111 Zhang et al., 2020
hlg TTGGCTGGGGAGTTGAAGCACA 64 306 Paniagua-Contreras et al., 2012
CGCCTGCCCAGTAGAAGCCATT
coa ATAGAGATGCTGGTACAGG 58 polymorphism Paniagua-Contreras et al., 2012
GCTTCCGATTGTTCGATGC
sasX AGAATTAGAAGTACGTCTAAATGC 60 615 Sergeev et al., 2004
GCTGATTATGTAAATGACTCAAATG
exhA ATAGAGGAGAAATCAACATG
CTATAGTTACTTGACCTCTA		 55 865 Kanbar et al., 2008
exhB GACCATGACTATCACTCTAT
GAGAACGATTCTCGTAAA AT		 53 1284 Kanbar et al., 2008
Open in a new tab

Experimental Reproduction of the Disease With the Isolated Strains

Two staphylococci strains were randomly selected from the 2 virulence-associated genes harboring isolates to validate the pathogenicity. Staphylococcus sciuri (S. sciuri) 201206 (S.sc-201206) strain harbored hla and hlg gene and Staphylococcus epidermidis (S. epidermidis) 210316 (S.ep-210316) strain harbored sec and see gene. After 1 wk of feeding, ninety 1-day-old specific pathogen-free (SPF) ducklings were divided into 3 groups, and then intraperitoneal injection of 108 CFU of S.sc-201206, 108 CFU of S.ep-210316, and equal doses of stroke-physiological saline solution (SPSS), respectively. Three groups of ducklings were raised in negative pressure isolators (Fengshi, Suzhou, China) with adequate sterile feed and drinking water. Clinical signs and mortality were observed daily. At 3, 6, 9, 12, 15, 18, 21, and 24 d postinfection (dpi), 3 ducklings in each group were randomly selected to collect heart, liver, spleen, and brain samples for detection. The tissue samples were fixed in 10% neutral buffer formalin, and paraffin tissue sections were made for histomorphology observation. The bacterium was reisolated and confirmed by MALDI-TOF/TOF mass spectrometry as described before.

The animal experiments were carried out in accordance with the guidelines issued by Shandong Agricultural University Animal Care and Use Committee (Approval Number: # SDAUA-2021-007).

RESULTS

Clinical Symptoms and Gross Lesions

The clinical symptoms of the sick ducks were mainly ataxia, twisted neck, tremors, paralysis of the legs, and angulation. Autopsy examination showed severe meningeal hyperemia (Figure 1A), pericardial effusion (Figure 1B), hepatomegaly, texture than the normal brittle and pale yellow, with hemorrhagic necrosis (Figure 1C), and spleen hemorrhage and edema (Figure 1D).

Figure 1.

Figure 1

Open in a new tab

The main anatomical changes in clinical natural infection. (A) meningeal hyperemia. (B) pericardial effusion. (C) hepatomegaly, texture than the normal brittle and pale yellow, with hemorrhagic necrosis. (D) spleen hemorrhage and edema.

Bacterial Isolation and Identification

The conventional infections caused by known viruses related to neurological symptoms were ruled out by PCR detection. The bacterial isolates were Gram-positive spherical cells and occurred characteristically in irregular grape-like clusters under the microscope (Figure 2A). A total of 525 bacterial strains belonging to the species of CoNS were isolated from 70.14% (404/576) of test material, including 6 species: S. sciuri (67.24%, 353/525), S. epidermidis (9.71%, 51/525), Staphylococcus saprophyticus (S. saprophyticus) (8.38%, 44/525), S. lentus (7.62%, 40/525), Staphylococcus haemolyticus (S. haemolyticus) (2.48%, 13/525), and S. xylosus (4.57%, 24/525). The proportion of the 6 staphylococci species was similar in each of the 4 years (Figure 2B). More than one species of staphylococci was isolated from 121 duck brain tissues. In the 121 samples, the isolation rates of the 6 species were 100% (121, S. sciuri), 33% (40, S. saprophyticus), 28.9% (35, S. epidermidis), 22.3% (27, S. lentus) and 15.6% (19, S. xylosus), respectively.

Figure 2.

Figure 2

Open in a new tab

The characteristics of isolated strains. (A) morphology of isolates under microscope (magnification 100 × . Scale bar: 50 μm). (B) distribution of the strains according to time.

Antimicrobial Susceptibility Testing

The results showed that 315 isolates were resistant to methicillin. Notably, S. sciuri strains were resistant to all antibiotics except vancomycin. Among the isolated CoNS, S. sciuri isolates showed the highest resistance to gentamicin and enrofloxacin (43.9% and 57.22%). Considerable proportions of S. epidermidis isolates were found to be resistant to cefoxitin (78.43%) and ciproflocin (56.86%). Half of the S. sciuri (50.71%) and S. epidermidis (50.98%) strains were resistant to tetracycline, and over half of the S. haemolyticus isolates exhibited resistance to penicillin (61.54%) and ampicillin (69.23%). S. epidermidis isolates had the highest inducible clindamycin resistance rates (39.22%), followed by S. sciuri (31.73%), S. haemolyticus (30.77%), S. xylosus (20.83%), S. saprophyticus (18.18%), and S. lentus (12.5%). The antimicrobial susceptibility phenotypes of the isolates are given in Table 3.

Table 3.

Resistance to 18 antimicrobial agents of the staphylococci strains [no. (%)] isolated in this study.

Antimicrobial agents Staphylococci species (no.)
S.sciuri (n = 353) S.epidermidis (n = 51) S.saprophyticus (n = 44) S.haemolyticus (n = 13) S.lentus (n = 40) S.xylosus (n = 24)
Cefoxitin 211 (59.77) 40 (78.43) 27 (61.36) 9 (69.23) 15 (37.5) 11 (45.83)
Penicillin 183 (51.84) 31 (60.78) 26 (59.09) 8 (61.54) 11 (27.50) 9 (37.50)
Ampicillin 223 (63.17) 19 (37.25) 21 (47.72) 9 (69.23) 17 (42.5) 8 (33.33)
Gentamicin 155 (43.90) 17 (33.33) 18 (40.90) 5 (38.46) 13 (32.50) 5 (20.83)
Ofloxacin 113 (32.01) 23 (45.10) 22 (50.00) 7 (53.85) 23 (57.50) 16 (66.67)
Amikacin 124 (35.13) 16 (31.37) 17 (38.64) 3 (23.07) 6 (15.00) 7 (29.17)
Enrofloxcin 202 (57.22) 24 (47.06) 8 (18.18) 6 (46.15) 20 (50.00) 3 (12.50)
Clindamycin 112 (31.73) 20 (39.22) 8 (18.18) 4 (30.77) 5 (12.50) 5 (20.83)
Tetracycline 179 (50.71) 26 (50.98) 19 (43.18) 8 (61.54) 16 (40.00) 5 (20.83)
Ciproflocin 156 (44.19) 29 (56.86) 22 (50.00) 0 12 (30.00) 11 (45.83)
Erythromycin 132 (37.39) 19 (37.25) 21 (47.72) 5 (38.46) 9 (22.50) 2 (8.33)
Florfenicol 105 (29.75) 18 (35.29) 19 (43.18) 2 (15.38) 4 (10.00) 5 (20.83)
Nitrofurantoin 74 (20.96) 7 (13.73) 8 (18.18) 3 (23.07) 0 0
Ceftriaxone 23 (6.52) 9 (17.65) 12 (27.27) 0 0 0
Fosfomycin 41 (11.61) 0 9 (20.45) 0 0 0
Open in a new tab

Moreover, as shown in Figure 3, 212 (40.38%) of the isolates exhibited multidrug resistance (MDR) since they showed resistance to at least 3 different classes of antimicrobials (Magiorakos et al., 2012). It is noteworthy that 28.19% of the tested CoNS strains showed resistance to 4 or even 5 classes of antimicrobial agents used. The MDR pattern was as follows: 121 (34.28%) of the MDR isolates were S. sciuri, 28 (63.64%) S. saprophyticus, 14 (58.33%) S. xylosus, 22 (55%) S. lentus, 6 (46.15%) S. haemolyticus, 2 (4.08%), and 21 (41.18%) S. epidermidis.

Figure 3.

Figure 3

Open in a new tab

Multidrug resistant patterns of coagulase-negative staphylococci isolated from poultry farms in the selected regions.

Detection of Virulence-Associated Genes

In this study, only 6 virulence-associated genes (hla, hlg, hld, sasX, sec, and see) were detected in all 525 staphylococci isolates (Table 4). A total of 32 staphylococci isolates (6.10%, 32/525) harbored virulence-associated genes, containing 21 S. sciuri, 7 S. epidermidis, 1 S. saprophyticus, and 3 S. haemolyticus strains. Among them, 21 isolates (65.63%, 21/32) harbored 2 virulence-associated genes, including 19 S. sciuri strains with hla and hlg genes and 2 S. epidermidis strains with sec and see genes. In the 11 single virulence-associated gene harboring isolates, hld gene was identified in 3 S. epidermidis (3/51, 5.88%) and 2 S. haemolyticus (2/13, 15.38%), while sasX gene was detected in 2 S. sciuri (2/353, 0.57%), 2 S. epidermidis (2/51, 3.92%), and 1 S. haemolyticus (1/13, 7.69%). In all the 44 S. saprophyticus strains, only 1 strain harbored a virulence-associated gene (hlg). No virulence-associated gene was identified in S. lentus and S. xylosus isolates.

Table 4.

Detection result of virulence-associated genes in staphylococci isolates from duck.

Staphylococci species (no.) Virulence-associated gene positive strain no. (%)
 Positive strain
no. (%)
hla hlg hld sasX sec see
S. sciuri (353) 19 (5.38) 19 (5.38) 0 2 (0.57) 0 0 21 (5.95)
S. epidermidis (51) 0 0 3 (5.88) 2 (3.92) 2 (3.92) 2 (3.92) 7 (13.73)
S. saprophyticus (44) 0 1 (2.27) 0 0 0 0 1 (2.27)
S. lentus (40) 0 0 0 0 0 0 0
S. xylosus (24) 0 0 0 0 0 0 0
S. haemolyticus (13) 0 0 2 (15.38) 1 (7.69) 0 0 3 (23.08)
Total (525) 19 (3.62) 20 (3.81) 5 (0.95) 5 (0.95) 2 (0.38) 2 (0.38) 32 (6.10)
Open in a new tab

Animal Pathogenicity Experiment Results

The main clinical symptoms observed in the infected ducks showed depression, and loss of appetite at 5 dpi in the S.sc-201206 inoculation group, and 6 dpi in the S.sc-210316 inoculation group. The experimental group of ducks showed obvious neurological symptoms, and the diseased ducks showed head and neck jerks and tremors at 12 to 40 dpi (Supplementary video 1). The necropsy results showed that the gross lesions were similar to those of naturally infected breeding ducks, including meningeal hyperemia, bleeding spots on the surface of the liver and with brittle texture, myocardial hemorrhage, and spleen swelling and necrosis (Figure 4). Histopathological changes were manifested as nerve cells edema and necrosis, nucleus cytolysis and even disappearance of some nerve cells, obvious neuronophagia occurred in some areas (Figures 5A and 5B); Hepatocyte necrosis, with diffuse vacuolar degeneration, and inflammatory cell infiltration (Figures 5D and 5E); Spleen hemorrhage, necrosis, and local tissue disintegration (Figures 5G and 5H); Myocardial necrosis and fibers rupture (Figures 5J and 5K). Bacteria were isolated from the brains of infected ducks that showed or did not show neurological symptoms in the experimental group, and then identified as target CoNS strains by MALDI-TOF/TOF mass spectrometry. However, no bacteremia occurred in infected ducks during the test period. No clinical symptoms or pathological changes were observed in ducks from the control group.

Figure 4.

Figure 4

Open in a new tab

Pathological changes in necropsy of artificially-infected ducks. (A) hyperemia in meninges of sick ducks. (B) normal meninges of healthy ducks. (C) bleeding point on the liver surface of sick ducks. (D) normal liver of healthy ducks. (E) myocardial hemorrhage of sick ducks. (F) the normal heart of healthy ducks. (G) spleen swelling and necrosis sick ducks. (H) normal spleen of healthy ducks.

Figure 5.

Figure 5

Open in a new tab

The histopathological changes of artificially-infected ducks. (A) neuronophagia and vacuolar degeneration in nerve cells. (B) neuronal necrosis, nucleus cytolysis, and even the disappearance of some nerve cells. (C) brain tissue of healthy duck. (D) hepatocyte necrosis, with diffuse vacuolar degeneration. (E) inflammatory cell infiltration. (F) liver tissue of healthy duck. (G) spleen hemorrhage, necrosis. (H) local tissue disintegration of the spleen. (I) spleen tissue of healthy duck. (J/K) myocardial necrosis and fibers rupture. (L) heart tissue of healthy duck. (A, B, D, E, G, H, J, K) magnification 100 × . Scale bar: 10 μm. (C, F, I, L) magnification 40 × . Scale bar: 50 μm. Black arrows indicate corresponding lesions.

DISCUSSION

There is emerging evidence that some species of CoNS such as S. epidermidis and S. haemolyticus are associated with infectious diseases and are believed to be the major nosocomial pathogens, rather than symbiotic bacteria (Wolska-Gębarzewska et al., 2023). In recent years, the pathogenicity of CoNS has attracted increasingly attention in animals, but there is very limited research on their prevalence and resistance profiles in poultry production. In the present study, CoNS strains were isolated from duck brain tissues in some breeding-duck farms in Shandong Province, China. The isolates showed high levels of antibiotic resistance even MDR. Although the virulence-associated genes in these strains were limited in detection, inoculation of CoNS strains carrying the virulence-associated genes can duplicate the disease in ducks. These findings indicated the potential threat of CoNS to humans and animals.

Among the 576 duck brain samples, 404 (70.14%) carried at least one CoNS. This carriage frequency was higher than the results of other studies (Moawad et al., 2019; Marek et al., 2021; Sorour et al., 2023). The CoNS species isolated from poultry samples varies widely, covering different years or published by various authors. Pyzik et al. (2019) found a higher occurrence of S. cohnii in diseased broiler chickens and turkeys. In the study of Saha et al. (2020), S. lentus was the most common CoNS species. Boamah et al. (2017) detected a high number of CoNS species, with S. sciuri being the most frequent followed by S. lentus and S. xylosus. Our results indicated that the S. sciuri with the highest isolation rate showed extensive resistance to multiple antibiotics. These results collectively indicated that some species of CoNS, such as S. sciuri, S. xylosus, or S. cohnii, are increasingly important in pathogenicity to poultry, especially when they carry several different genes encoding antimicrobial resistance (Pyzik et al., 2019).

In recent years, the frequent use of antibiotics in poultry has resulted in antibiotic selection pressure causing the prevalence of antibiotic-resistant bacteria (Xu et al., 2018). Contaminated poultry and their products are widely recognized as the main source of exposure leading to human infection, which poses a serious threat to both the poultry industry and human health (Levy and Marshall, 2004; Zhi et al., 2020). In our study, the CoNS strains exhibited different degrees of resistance to the tested antibiotics. Notably, the isolates exhibited high level resistance to cefoxitin, tetracycline, penicillin, and ampicillin. Whereas, the emergence of vancomycin-resistant strains was not detected. This is not surprising because there are limited reports of vancomycin-resistant staphylococci (Saravolatz et al., 2010). Furthermore, 40.38% of the isolates were classified as MDR among all of the resistant strains. CoNS are now considered reservoirs for the evolution and spread of resistance genes (Xu et al., 2018). It is reported that more than 70% of hospital-acquired infections (HAIs) are caused by bacteria resistant to one or more commonly used antibiotics (Mishra et al., 2012). In some developing countries, the abuse and misuse of antibiotics in the poultry industry have led to the upsurge of MDR in staphylococci strains, and the emergence of MDR strains poses an increasing danger to public health (Boamah et al., 2017; Bertelloni et al., 2023).

In our study, 53.90% of CoNS isolates were identified as methicillin-resistant strains by the detection of mecA. The mechanisms of methicillin resistance in methicillin-resistant coagulase-negative staphylococci (MR-CoNS) are complex and remain unclear, and MR-CoNS is considered an increasingly serious clinical problem (Seng et al., 2017). A question arises as to whether there was a slight inconsistency between the phenotype of cefoxitin resistance and the genotype of the mecA gene in the CoNS strains. Several factors may explain these discrepancies. The results of phenotypic tests may be influenced by technical and methodological factors (Tenover et al., 1999). Additionally, it may be possible that there was another predominant mechanism to control the phenotype of methicillin resistance other than the expression of the mecA gene (Gradelski et al., 2001; Pyzik et al., 2019).

An increasing body of evidence shows that CoNS may possess virulence genes which are associated with infection, although they are considered moderately commensal organisms (Opoku-Asare et al., 2023; Wolska-Gębarzewska et al., 2023). In this study, we have identified the presence of SE-encoding genes among 2 S. epidermidis isolates, including 2 classical SE genes sec and see. Only 25 isolates carried genes encoding hemolysin and 19 S. sciuri strains contained the genes hla and hlg. The hld gene was detected in 3 S. epidermidis and 2 S. haemolyticus strains, while the hlg was found in only 1 strain of S. saprophyticus. The sasX-positive CoNS strains have already been found according to previous reports (Tekeli et al., 2020). We identified the sasX gene from 5 isolated strains, including 1 S. haemolyticus, 2 S. epidermidis, and 2 S. sciuri. Additionally, we found that 4 out of 5 sasX-positive isolates were methicillin-resistant. It is remarkable that S. sciuri was the predominant strain among the isolated CoNS carrying virulence-associated genes. Most of the S. sciuri strains harbored hla and hlg genes, and the sasX gene was detected in all other isolated S. sciuri strains. Genetic evidence of the toxigenic strain does not conclusively indicate that functional toxins are produced. This phenomenon can be explained by gene mutation or the absence of regulatory genes necessary for expression inside the operon. A previous study reported the CoNS strains were isolated from trembling ducklings (Han et al., 2013), but CoNS strains were proven to be the causative agent of duck bacterial meningitis in the study for the first time. Further research is required to clarify the pathogenic mechanism of CoNS penetrating across the blood-brain barrier.

CONCLUSIONS

The CoNS strains isolated in this study were the leading pathogens causing bacterial meningitis in ducks. To our knowledge, this is the first study to report this important outcome. These strains showed extensive resistance to multiple antibiotics, and nearly half of the isolates exhibited MDR. Although there were few isolates carrying virulence-associated genes, we confirmed that these isolates are the main pathogens causing bacterial meningitis in ducks through animal experiments. Since bacteria can be transmitted to humans via foodborne routes, it is plausible that these strains may constitute a significant threat to both human and animal health. This study enriches our knowledge of CoNS strains and provides the microbiological basis for the prevention and control of bacterial meningitis in poultry.

ACKNOWLEDGEMENTS

This study was funded by the Key Research and Development Program of Shandong Province, China (2022CXGC010606), Science and Technology Innovation Major Project of Taian, China (2021ZDZX032), Shandong Provincial Poultry Industry and Technology System, China (SDAIT-11-03).

DISCLOSURES

The authors declare no conflict of interest.

Footnotes

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.103592.

Appendix. Supplementary materials

Download video file (2.2MB, mp4)

Supplemental video 1. The obvious neurological symptoms in animal pathogenicity experiments. (A) Artificially infected ducks showed distorted head and neck and difficulty walking at 9 dpi. (B) Artificially infected ducks showed distorted heads and necks and difficulty walking at 23 dpi.

Download video file (4.7MB, mp4)

REFERENCES

  1. Bertelloni F., Cagnoli G., Bresciani F., Scotti B., Lazzerini L., Marcucci M., Colombani G., Ebani V.V. Antimicrobial Resistant coagulase-negative staphylococci carried by house flies (Musca domestica) captured in swine and poultry farms. Antibiotics (Basel) 2023;12:636. doi: 10.3390/antibiotics12040636. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bier K., Schittek B. Beneficial effects of coagulase-negative Staphylococci on Staphylococcus aureus skin colonization. Exp. Dermatol. 2021;30:1442–1452. doi: 10.1111/exd.14381. [DOI] [PubMed] [Google Scholar]
  3. Blot S.I., Depuydt P., Annemans L., Benoit D., Hoste E., De Waeleet J.J., Decruyenaere J., Vogelaers D., Colardyn F., Vandewoude K.H. Clinical and economic outcomes in critically ill patients with nosocomial catheter-related bloodstream infections. Clin. Infect. Dis. 2005;41:1591–1598. doi: 10.1086/497833. [DOI] [PubMed] [Google Scholar]
  4. Boamah V.E., Agyare C., Odoi H., Adu F., Gbedema S.Y., Dalsgaard A. Prevalence and antibiotic resistance of coagulase-negative Staphylococci isolated from poultry farms in three regions of Ghana. Infect. Drug Resist. 2017;10:175–183. doi: 10.2147/IDR.S136349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Campbell S.J., Deshmukh H.S., Nelson C.L., Bae I., Stryjewski M.E., Federspiel J.J., Tonthat G.T., Rude T.H., Barriere S.L., Corey R., Fowler V.G., Jr Genotypic characteristics of staphylococcus aureus isolates from a multinational trial of complicated skin and skin structure infections. J. Clin. Microbiol. 2008;46:484–678. doi: 10.1128/JCM.01822-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chajęcka-Wierzchowska W., Zadernowska A., Nalepa B., Sierpińska M., Łaniewska-Trokenheim L. Coagulase-negative staphylococci (CoNS) isolated from ready-to-eat food of animal origin–phenotypic and genotypic antibiotic resistance. Food Microbiol. 2015;46:222–226. doi: 10.1016/j.fm.2014.08.001. [DOI] [PubMed] [Google Scholar]
  7. Chen Q., Zhao G., Yang W., Chen F., Qi Y., Lou Z. Investigation into the prevalence of enterotoxin genes and genetic background of Staphylococcus aureus isolates from retain foods in Hangzhou, China. BMC Microbiol. 2023;23:294. doi: 10.1186/s12866-023-03027-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dazio V., Nigg A., Schmidt J.S., Brilhante M., Campos-Madueno E.I., Mauri N., Kuster S.P., Brawand S.G., Willi B., Endimiani A., Perreten V., Schuller S. Duration of carriage of multidrug-resistant bacteria in dogs and cats in veterinary care and co-carriage with their owners. One Health. 2021;13 doi: 10.1016/j.onehlt.2021.100322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. De Backer S., Xavier B.B., Vanjari L., Coppens J., Lammens C., Vemu L., Carevic B., Hryniewicz W., Jorens P., Kumar-Singh S., Lee A., Harbarth S., Schrenzel J., Tacconelli E., Goossens H., Malhotra-Kumar S. Remarkable geographical variations between India and Europe in carriage of the staphylococcal surface protein-encoding sasX/sesI and in the population structure of methicillin-resistant Staphylococcus aureus belonging to clonal complex 8. Clin. Microbiol. Infect. 2019;25 doi: 10.1016/j.cmi.2018.07.024. 628.e1-7. [DOI] [PubMed] [Google Scholar]
  10. Duarte A., Montagna D.R., Pastorini M., Alemán M. Apoptosis-mediated inhibition of human T-cell acute lymphoblastic leukemia upon treatment with Staphylococus Aureus enterotoxin-superantigen. Front. Immunol. 2023;14 doi: 10.3389/fimmu.2023.1176432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fang R., Cui J., Cui T., Guo H., Ono H.K., Park C.H., Okamura M., Nakane A., Hu D.L. Staphylococcal enterotoxin C is an important virulence factor for mastitis. Toxins. 2019;11:141. doi: 10.3390/toxins11030141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gómez-Sanz E., Ceballos S., Ruiz-Ripa L., Zarazaga M., Torres C. Clonally diverse methicillin and multidrug resistant coagulase negative staphylococci are ubiquitous and pose transfer ability between pets and their owners. Front. Microbiol. 2019;10:485. doi: 10.3389/fmicb.2019.00485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gradelski E., Valera L., Aleksunes L., Bonner D., Fung-Tomc J. Correlation between genotype and phenotypic categorization of staphylococci based on methicillin susceptibility and resistance. J. Clin. Microbiol. 2001;39:2961–2963. doi: 10.1128/JCM.39.8.2961-2963.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Han J.E., Hwang S.Y., Kim J.H., Shin S.P., Jun J.W., Chai J.Y., Park Y.H., Park S.C. CPRMethicillin resistant coagulase-negative staphylococci isolated from South Korean ducks exhibiting tremor. Acta Vet. Scand. 2013;55:88. doi: 10.1186/1751-0147-55-88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hasbun R. Progress and challenges in bacterial meningitis: a review. JAMA. 2022;328:2147–2154. doi: 10.1001/jama.2022.20521. [DOI] [PubMed] [Google Scholar]
  16. Huang C.R., Lu C.H., Wu J.J., Chang H.W., Chien C.C., Lei C.B., Chang W.N. Coagulase-negative staphylococcal meningitis in adults: clinical characteristics and therapeutic outcomes. Infection. 2005;33:56–60. doi: 10.1007/s15010-005-4083-7. [DOI] [PubMed] [Google Scholar]
  17. Hulme J. Staphylococcus infection: relapsing atopic dermatitis and microbial restoration. Antibiotics (Basel) 2023;12:222. doi: 10.3390/antibiotics12020222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kanbar T., Voytenko A.V., Alber J., Lämmler C., Weiss R., Skvortzov V.N. Distribution of the putative virulence factor encoding gene sheta in Staphylococcus hyicus strains of various origins. J Vet Sci. 2008;9:327–329. doi: 10.4142/jvs.2008.9.3.327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Levy S.B., Marshall B. Antibacterial resistance worldwide: causes, challenges and responses. Nat Med. 2004;10:S122–S129. doi: 10.1038/nm1145. [DOI] [PubMed] [Google Scholar]
  20. Magiorakos A.P., Srinivasan A., Carey R.B., Carmeli Y., Falagas M.E., Giske C.G., Harbarth S., Hindler J.F., Kahlmeter G., Olsson-Liljequist B., Paterson D.L., Rice L.B., Stelling J., Struelens M.J., Vatopoulos A., Weber J.T., Monnet D.L. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012;18:268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
  21. Marek A., Pyzik E., Stępień-Pyśniak D., Dec M., Jarosz Ł.S., Nowaczek A., Sulikowska M. Affiliations expand biofilm-formation ability and the presence of adhesion genes in coagulase-negative staphylococci isolates from chicken broilers. Animals (Basel) 2021;11:728. doi: 10.3390/ani11030728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Michalik M., Samet A., Podbielska-Kubera A., Savini V., Międzobrodzki J., Kosecka-Strojek M. Coagulase-negative staphylococci (CoNS) as a significant etiological factor of laryngological infections: a review. Ann. Clin. Microbiol. Antimicrob. 2020;19:26. doi: 10.1186/s12941-020-00367-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mishra R.P., Oviedo-Orta E., Prachi P., Rappuoli R., Bagnoli F. Vaccines and antibiotic resistance. Curr. Opin. Microbiol. 2012;15:596–602. doi: 10.1016/j.mib.2012.08.002. [DOI] [PubMed] [Google Scholar]
  24. Moawad A.A., Hotzel H., Awad O., Roesler U., Hafez H.M., Tomaso H., Neubauer H., El-Adawy H. Evolution of antibiotic resistance of coagulase-negative staphylococci isolated from healthy turkeys in Egypt: first report of linezolid resistance. Microorganisms. 2019;7:476. doi: 10.3390/microorganisms7100476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Opoku-Asare B., Boima V., Ganu V.J., Aboagye E., Asafu-Adjaye O., Asare A.A., Kyeremateng I., Kwakyi E., Agyei A., Sampane-Donkor E., Puplampu P. Catheter-related bloodstream Infections among patients on maintenance haemodialysis: a cross-sectional study at a tertiary hospital in Ghana. BMC Infect. Dis. 2023;23:664. doi: 10.1186/s12879-023-08581-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Osman K., Badr J., Al-Maary K.S., Moussa I.M., Hessain A.M., Amin Girah Z.M., Abo-Shama U.H., Orabi A., Saad A. Prevalence of the antibiotic resistance genes in coagulase-positive-and Negative-Staphylococcus in chicken meat retailed to consumers. Front. Microbiol. 2016;7:1846. doi: 10.3389/fmicb.2016.01846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Osman KM., Pires Á.d.S., Franco O.L., Orabi A., Hanafy M.H., Marzouk E E., Hussien H., Alzaben F.A., Almuzaini A.M., Elbehiry A. Enterotoxigenicity and antibiotic resistance of coagulase-negative Staphylococci isolated from raw buffalo and cow milk. Microb. Drug Resist. 2020;26:520–530. doi: 10.1089/mdr.2019.0114. [DOI] [PubMed] [Google Scholar]
  28. Paniagua-Contreras G., Sáinz-Espu T., Monroy-Pérez E., Rodríguez-Moctezuma J.R., Arenas-Aranda D., Negrete-Abascal E., Vaca S. Virulence markers in Staphylococcus aureus strains isolated from hemodialysis catheters of Mexican patients. Adv. Microbiol. 2012;2:476–487. [Google Scholar]
  29. Peng X., Zhu Q., Liu J., Zeng M., Qiu Y., Zhu C., Cheng Y., Zhou Y., Xu Y., Chen M., Wen Z., Chen Y., Li R., Tong J., Shan Q., Lin D., Wu S., Zhuo Z., Wang C., Zhao S., Qi Z., Sun X., Maihebuba B., Jia C., Gao H., Li S., Zhu Y., Wan C. Prevalence and antimicrobial resistance patterns of bacteria isolated from cerebrospinal fluid among children with bacterial meningitis in China from 2016 to 2018: a multicenter retrospective study. Antimicrob. Resist Infect. Control. 2021;10:24. doi: 10.1186/s13756-021-00895-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Piantadosi A., Mukerji S.S., Ye S., Leone M.J., Freimark L.M., Park D., Adams G., Lemieux J., Kanjilal S., Solomon I.H., Ahmed A.A., Goldstein R., Ganesh V., Ostrem B., Cummins K.C., Thon J.M., Kinsella C.M., Rosenberg E., Frosch M.P., Goldberg M.B., Cho T.A., Sabeti P. Enhanced virus detection and metagenomic sequencing in patients with meningitis and encephalitis. mBio. 2021;12 doi: 10.1128/mBio.01143-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Pyzik E., Marek A., Stępień-Pyśniak D., Urban-Chmiel R., Jarosz Ł.S., Jagiełło-Podębska I. Detection of antibiotic resistance and classical enterotoxin genes in coagulase-negative staphylococci isolated from poultry in Poland. J Vet Res. 2019;63:183–190. doi: 10.2478/jvetres-2019-0023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Saha O., Rakhi N.N., Istiaq A., Islam I., Sultana M., Hossain MA M.A., Rahaman M.M. Evaluation of commercial disinfectants against Staphylococcus lentus and Micrococcus spp. of poultry origin. Vet Med Int. 2020;2020 doi: 10.1155/2020/8811540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Saravolatz L.D., Pawlak J., Johnson L.B. In vitro activity of oritavancin against community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA), vancomycin-intermediate S. aureus (VISA), vancomycin-resistant S. aureus (VRSA) and daptomycin-non-susceptible S. aureus (DNSSA) Int. J. Antimicrob Agents. 2010;36:69–72. doi: 10.1016/j.ijantimicag.2010.02.023. [DOI] [PubMed] [Google Scholar]
  34. Seng R., Kitti T., Thummeepak R., Kongthai P., Leungtongkam U., Wannalerdsakun S., Sitthisak S. Biofilm formation of methicillin-resistant coagulase negative staphylococci (MR-CoNS) isolated from community and hospital environments. PloS One. 2017;12 doi: 10.1371/journal.pone.0184172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sergeev N., Volokhov D., Chizhikov V., Rasooly A. Simultaneous analysis of multiple staphylococcal enterotoxin genes by an oligonucleotide microarray assay. J. Clin. Microbiol. 2004;42:2134–2143. doi: 10.1128/JCM.42.5.2134-2143.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Shahid M., Hussain R., Nawaz Z., Aslam B., Ahmad M.Z., Siddique A.B., Ahsan H., Fatima A., Khan I., Mustafa B., Iqbal R., Syaad K.M.A., Shami A. Occurrence of virulence genes among methicillin-resistant Staphylococcus aureus isolated from subclinical bovine mastitis. ACS Omega. 2023;8:38111–38117. doi: 10.1021/acsomega.3c04206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Shokry M.H., Bosila M., El-Ghany A., Wafaa A., Redwan I.A., Amer M.M. Pathogenicity of coagulase negative Staphylococcus chicken isolates to 10 days old broiler chickens. Egypt J. Vet. Sci. 2018;49:49–57. [Google Scholar]
  38. Silva V., Caniça M., Ferreira E., Vieira-Pinto M., Saraiva C., Pereira J.E., Capelo J.L., Igrejas G., Poeta P. Multidrug-resistant methicillin-resistant coagulase-negative staphylococci in healthy poultry slaughtered for human consumption. Antibiotics (Basel) 2022;11:365. doi: 10.3390/antibiotics11030365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sorour H.K., Shalaby A.G., Abdelmagid M.A., Hosny R.A. Characterization and pathogenicity of multidrug-resistant coagulase-negative Staphylococci isolates in chickens. Int. Microbiol. 2023;26:989–1000. doi: 10.1007/s10123-023-00354-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Stępień-Pyśniak D., Wilczyński J., Marek A., Śmiech A., Kosikowska U., Hauschild T. Staphylococcus simulans associated with endocarditis in broiler chickens. Avian Pathol. 2017;46:44–51. doi: 10.1080/03079457.2016.1203392. [DOI] [PubMed] [Google Scholar]
  41. Taponen S., Pyörälä S. Coagulase-negative staphylococci as cause of bovine mastitis- not so different from Staphylococcus aureus? Vet. Microbiol. 2009;134:29–36. doi: 10.1016/j.vetmic.2008.09.011. [DOI] [PubMed] [Google Scholar]
  42. Tavares A., Nielsen J.B., Boye K., Rohde S., Paulo A.C., Westh H., Schønning K., de Lencastre H., Miragaia M. Insights into alpha-hemolysin (Hla) evolution and expression among Staphylococcus aureus clones with hospital and community origin. PLoS ONE. 2014;9:e98634. doi: 10.1371/journal.pone.0098634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tekeli A., Öcal D.N., Dolapçı İ. Detection of sasX gene and distribution of SCCmec types in invasive and non-invasive coagulase-negative Staphylococci. Balkan Med J. 2020;37:215–221. doi: 10.4274/balkanmedj.galenos.2020.2019.8.21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tenover F.C., Jones R.N., Swenson J.M., Zimmer B., McAllister S., Jorgensen J.H. Methods for improved detection of oxacillin resistance in coagulase-negative staphylococci: results of a multicenter study. J. Clin. Microbiol. 1999;37:4051–4058. doi: 10.1128/jcm.37.12.4051-4058.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Wan Y., Wang X., Bai T., Zheng X., Yang L., Li Q., Wang X. Lysine inhibits hemolytic activity of staphylococcus aureus and its application in food model contaminated with Staphylococcus aureus. Toxins (Basel) 2022;14:867. doi: 10.3390/toxins14120867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wolska-Gębarzewska M., Międzobrodzki J., Kosecka-Strojek M. Current types of staphylococcal cassette chromosome mec (SCCmec) in clinically relevant coagulase-negative staphylococcal (CoNS) species. Crit. Rev. Microbiol. 2023:1–17. doi: 10.1080/1040841X.2023.2274841. [DOI] [PubMed] [Google Scholar]
  47. Xu Z., Shah H.N., Misra R., Chen J., Zhang W., Liu Y., Cutler R.R., Mkrtchyan H.V. The prevalence, antibiotic resistance and mecA characterization of coagulase negative staphylococci recovered from non-healthcare settings in London, UK. Antimicrob. Resist. Infect. Control. 2018;7:73. doi: 10.1186/s13756-018-0367-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Ye Y., Tian Y., Kong Y., Ma J., Shi G. Trends of antimicrobial susceptibility in clinically significant coagulase-negative staphylococci isolated from cerebrospinal fluid cultures in neurosurgical adults: a nine-year analysis. Microbiol. Spectr. 2022;10 doi: 10.1128/spectrum.01462-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Zhang P., Miao X., Zhou L., Baozhong C., Jie Z., Xuebin X., Congming W., Xiaoli P., Xin W. Characterization of oxacillin-susceptible mecA-positive Staphylococcus aureus from food poisoning outbreaks and retail foods in China. Foodborne Pathog Dis. 2020;17:728–734. doi: 10.1089/fpd.2019.2774. [DOI] [PubMed] [Google Scholar]
  50. Zhao G., Lou Z., Zhu Z., Lai X., Li J., Lou X X., Huang L., Chen Q. Epidemiological and molecular evidence of foodborne poisoning outbreak caused by enterotoxin gene cluster-harboring Staphylococcus aureus of new sequence type 7591. Int J Infect Dis. 2023;135:132–135. doi: 10.1016/j.ijid.2023.08.005. [DOI] [PubMed] [Google Scholar]
  51. Zhi S., Shen S., Zhou J., Ding G., Zhang K. Systematic analysis of occurrence, density and ecological risks of 45 veterinary antibiotics: focused on family livestock farms in Erhai Lake basin, Yunnan, China. Environ Pollut. 2020;267 doi: 10.1016/j.envpol.2020.115539. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Download video file (2.2MB, mp4)

Supplemental video 1. The obvious neurological symptoms in animal pathogenicity experiments. (A) Artificially infected ducks showed distorted head and neck and difficulty walking at 9 dpi. (B) Artificially infected ducks showed distorted heads and necks and difficulty walking at 23 dpi.

Download video file (4.7MB, mp4)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES