Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 May 1.
Published in final edited form as: Bioorg Chem. 2024 Mar 16;146:107283. doi: 10.1016/j.bioorg.2024.107283

Magnolol derivatives as specific and noncytotoxic inhibitors of breast cancer resistance protein (BCRP/ABCG2)

Isadora da Silva Zanzarini 1, Diogo Henrique Kita 1,2, Gustavo Scheiffer 1, Kelly Karoline dos Santos 1, Julia de Paula Dutra 1, Matteo Augusto Pastore 1, Fabiane Gomes de Moraes Rego 3, Geraldo Picheth 3, Suresh V Ambudkar 2, Luana Pulvirenti 4, Nunzio Cardullo 5, Vivian Rotuno Moure 1, Vera Muccilli 5,*, Corrado Tringali 5, Glaucio Valdameri 1,*
PMCID: PMC11069345  NIHMSID: NIHMS1981025  PMID: 38513324

Abstract

The breast cancer resistance protein (BCRP/ABCG2) transporter mediates the efflux of numerous antineoplastic drugs, playing a central role in multidrug resistance related to cancer. The absence of successful clinical trials using specific ABCG2 inhibitors reveals the urge to identify new compounds to attend this critical demand. In this work, a series of 13 magnolol derivatives was tested as ABCG2 inhibitors. Only two compounds, derivatives 10 and 11, showed partial and complete ABCG2 inhibitory effect, respectively. This inhibition was selective toward ABCG2, since none of the 13 compounds inhibited neither P-glycoprotein nor MRP1. Both inhibitors (10 and 11) were not transported by ABCG2 and demonstrated a low cytotoxic profile even at high concentrations (up to 100 μM). 11 emerged as the most promising compound of the series, considering the ratio between cytotoxicity (IG50) and ABCG2 inhibition potency (IC50), showing a therapeutic ratio (TR) higher than observed for 10 (10.5 versus 1.6, respectively). This derivative showed a substrate-independent and a mixed type of inhibition. The effect of compound 11 on the ABCG2 ATPase activity and thermostability revealed allosteric protein changes. This compound did not affect the expression levels of ABCG2 and increased the binding of the conformational-sensitive antibody 5D3. A docking study showed that 11 did not share the same binding site with ABCG2 substrate mitoxantrone. Finally, 11 could revert the chemoresistance to SN-38 mediated by ABCG2.

Keywords: multidrug resistance, ABC transporters, ABCG2, inhibitors, magnolol

Graphical Abstract

graphic file with name nihms-1981025-f0009.jpg

1. INTRODUCTION

Multidrug resistance (MDR) related to cancer has been described as a major challenge in oncological therapy [1]. Among several biological mechanisms of MDR, the overexpression of ATP-binding cassette (ABC) transporters is considered the leading cause of MDR in neoplastic cells [2]. These overexpressed ABC transporters increase the efflux of chemotherapeutic drugs, decreasing their intracellular accumulation to subclinical concentrations, and leading the protocols to their failure [3]. ABC transporters are described as polyspecific due to their ability to export, in eukaryotic cells [4], a wide range of drugs with unrelated chemical structures and cellular targets [5]. The human genome encodes 48 ABC proteins [6] and among them, three ABC transporters are closely involved with the MDR phenotype: glycoprotein-P (P-gp or MDR1), multidrug resistance protein 1 (MRP1) and breast cancer resistance protein (BCRP or ABCG2) [7].

The use of inhibitors of ABC transporters is the most common strategy to overcome MDR. The first identified ABC transporter related to MDR was P-gp [8]. Nevertheless, clinical studies of P-gp inhibitors still fail to improve the chemotherapeutic efficacy of oncological protocols [912]. One of the diverse reasons for the reported clinical failure is that many drugs transported by P-gp are also transported by ABCG2 and other ABC transporters [13]. Since P-gp and ABCG2 are both overexpressed in several cancers, and despite recent advances, there are very few potent, non-toxic ABCG2 inhibitors available for clinical studies, demonstrating that the development of new ABCG2 inhibitors is an urgent necessity. During the last few years, we have identified certain classes of compounds, naturally occurring or not, as potent ABCG2 inhibitors, including chromones [14,15], stilbenes [16], chalcones [17], indeno[1,2-b]indoles [1821] and porphyrins [22].

Indeed, natural products are a great source of chemical scaffolds for new drugs and represent a powerful starting point for ABCG2 inhibitors. Flavonoids [23], botryllamides [24], and curcumin [25] are among the natural compounds identified as ABCG2 inhibitors. Among the most widely researched polyphenols, two dimeric neolignans, magnolol (1) and its isomer honokiol (2), isolated from the bark of Magnolia spp and constituted by a bisphenolic core bearing two allyl side chains, have shown numerous and increasing research data [26].

graphic file with name nihms-1981025-f0008.jpg

Numerous preclinical studies have verified an antitumoral activity exerted by 1 against different types of cancer, such as lung, prostate, breast, gallbladder, colon, skin and liver [2732]. In vitro and, subsequently, in vivo studies have shown that magnolol has a satisfactory safety profile [33,34], contributes to the reduction of tumor growth, induces apoptosis and inhibits invasion, migration and metastasis [32,35,36].

Some bisphenol neolignans inspired by magnolol (1), and synthesized through enzymatic dimerization and regioselective ortho-hydroxylation, showed inhibitory activities against tankyrase-2 [37] and yeasts α-glucosidase enzymes [38]. The former plays an important role in cancer, whereas the latter is an important target for development of new antidiabetic drugs. Other studies on bisphenol neolignans inspired by honokiol pointed out their antioxidant [39], antiproliferative [40] and anti-obesity activity as lipase inhibitor [41].

Additional studies suggest that magnolol, honokiol and 4-O-methylhonokiol may be promising agents in combating MDR through down-regulation of P-gp (ABCB1) expression levels [42]. More recently, the two isomers were described as promising inhibitors of ABCG2 activity and down-regulators of expression levels [43]. In this study, we evaluated the inhibitory potential of magnolol derivatives (new and previously described structures) toward the main MDR-related ABC transporters and the mechanism of ABCG2 inhibition of the most promising compounds was characterized.

2. MATERIAL AND METHODS

2.1. GENERAL EXPERIMENTAL PROCEDURE

NMR spectra were run on a Varian Unity Inova spectrometer operating at 500 MHz (1H) and 125 MHz (13C). Chemical shifts (δ) were indirectly referred to TMS using residual solvent signals (δ 3.31 for CD3OD, 7.26 for CDCl3, 2.05 for (CD3)2CO). High-resolution mass spectra were acquired with a Q Exactive Orbitrap mass spectrometer (Thermo Fisher Scientific, Bremen, Germany) equipped with an ESI ion source operating in negative ion mode. Compound 13 (1 × 10−5 Min 50:50 MeOH:H2O + 1% formic acid) was directly infused in the mass spectrometer. A survey scan was performed from m/z 150 to 1000 at 140 K resolution.

HPLC analyses were carried out using an Agilent Series (Milan, Italy) G1354A pump and an Agilent UV G1315D as a diode array detector. An Agilent Series 1100 G1313A autosampler was used for sample injection. Samples were purified by semi-preparative HPLC-UV onto a RP-18 (Phenomenex luna, 10um, 250 × 10 mm) with a gradient of CH3CN (solvent b) in water (solvent a) at 3 ml/min: t0min b = 90%, t1min b = 100%, t7min b = 100%, t9min b = 90%.

Thin-layer chromatography (TLC) was conducted using pre-coated silica gel F254 plates (Merck Millipore, Milan, Italy). Each reaction mixture was observed under UV light at wavelengths of 254 and 366 nm or through staining with a cerium sulfate solution.

All chemicals were of reagent grade and were used without further purification. Horseradish peroxidase (type I), tyrosol, and homovanillyl alcohol were purchased from Merck (Milan, Italy). Candida antarctica lipase (Chirazyme, L-2, c.-f. C2, lyo) was purchased from Roche (Monza, MB, Italy). Magnolol and eugenol were purchased from TCI Europe N.V. (Zwijndrecht, Belgium). IBX was prepared according to the literature [44].

2.2. CHEMISTRY

The syntheses of compounds 310 were achieved as previously reported in Pulvirenti et al. and Baschieri et al. [38,45]. Compound 3 was obtained by regioselective ortho-hydroxylation of magnolol (1) with IBX (2-iodox-ybenzoic acid). Compounds 4 and 6 were obtained by enzymatic dimerization of eugenol and tyrosol in the presence of horseradish peroxidase type I (HRP). Compound 5 was obtained from 4 after a reaction with IBX. Compound 7 was obtained from tyrosol after enzymatic acetylation with Candida antarctica lipase (CAL) followed by enzymatic dimerization in the presence of HRP. Compound 8 was obtained from homovanillyl alcohol after enzymatic acetylation with CAL and subsequent dimerization with HRP. Compounds 9 and 10 were obtained from 8 after IBX-mediated oxidative demethylation. The monomethylated and dimethylated magnolol derivatives 11 (Scheme 1) and 12, were obtained from 1 by a reaction with methyl iodide. Compound 14 was obtained from 1 after catalytic hydrogenation. Compound 15 was obtained from 11 after catalytic hydrogenation as well. The NMR spectroscopic data of compounds 310 were compared with those previously reported [38]. Also the spectroscopic characterization of compounds 11, 12, 14 and 15 were in agreement with previously published data [4648]. All the reactions are summarized in Supplementary Material (Scheme S1-6 and Fig. S1-3).

Scheme 1.

Scheme 1.

Synthesis of 13. a) dry acetone, K2CO3 (2 equiv), MeI (2 equiv), 56 °C, 4h. b) 11 (0.2 M in MeOH), IBX (1.2 equiv), 0 °C, 30 min; Na2S2O4, rt, 5 min.

2.2.1. SYNTHESIS OF 5,5’-diallyl-2’-methoxy-[1,1’-biphenyl]-2,3-diol (13)

Compound 11 (171.6 mg, 0.61 mmol) was dissolved in MeOH (3.0 mL, 0.2 M), then IBX (205.2 mg, 0.73 mmol) was added (See Supplementary material). The solution was stirred at 0 °C until the disappearance of the substrate (30 min). Then, a Na2S2O4 solution (83.5 mg, 0.81 mmol in 8.9 mL of H2O) was added, and the solution was stirred for 5 min at rt. The crude reaction was concentrated in vacuo, and the residue was solubilized with ethyl acetate (20 mL) and partitioned with a saturated NaHCO3 solution (10 mL). The aqueous phase was extracted with ethyl acetate (2 × 10 mL). The organic phases were washed with a saturated NaCl solution and dried over Na2SO4. After filtration, the solvent was evaporated under vacuum. The flash chromatography with DIOL Silica-gel, eluted with n-hexane: CH2Cl2 (30:70 → 0:100) and n-hexane:CH2Cl2: (100 → 97:3) afforded the neolignan 13 with 86% purity. This fraction was further purified by semi-preparative HPLC-UV onto a RP-18 (Phenomenex Luna C18, 10um, 250 × 10 mm) with a gradient of CH3CN (solvent B) in water (solvent A) at 3 mL/min: t0min B = 90%, t1min B = 100%, t7min B = 100%, t9min B = 90%.

The desired compound was recovered with 11.6 % of yield (22.6 mg): Rf (TLC) 0.46 (100% CH2Cl2). 1H-NMR (500 MHz,CDCl3): δ = 7.21–7.19 (m, 2 H, H-6’ and H-4’), 6.99 (d, J = 8.5 Hz, 1H, H-3’), 6.82 (d, J = 2.0 Hz, 1 H, H-4), 6.70 (s, 1 H, OH), 6.65 (d, J = 2.0 Hz, 1 H, H-6), 6.00–5.95 (m, 2 H, H-8/8’), 5.85 (s, 1 H, OH), 5.12–5.04 (m, 4 H, CH2-9/9’), 3.91 (s, 3 H, OMe), 3.31 (d, J = 7.0 Hz, 2 H, CH2-7’), 3.34 (d, J = 7.0 Hz, 2 H, CH2-7). 13C-NMR (125 MHz): δ = 153.5 (C, C-2’), 146.3 (C, C-3), 139.0 (C, C-2), 137.7 (CH, C-8), 137.4 (CH, C-8’), 134.4 (C, C-5’), 133.8 (C, C-5), 132.5 (CH, C-6’), 129.3 (CH, C-4’), 127.4 (C, C-1), 126.8 (C, C-1’), 121.9 (CH, C-6), 116.0 (CH, C-3’), 115.8 (CH2, C-9), 114.4 (CH2, C-9’), 112.3 (CH, C-4), 56.9 (CH3, OMe), 39.9 (CH2, C-7), 39.4 (CH2, C-7’). HRESIMS m/z 295.1368 [M - H], calcd for C19H19O3 m/z 295.1334.

2.3. CELL LINES

The human fibroblast HEK293 cell line was stably transfected to overexpress ABCG2 (HEK293-ABCG2) as previously described [49]. The murine fibroblast NIH3T3 was stably transfected to overexpress P-gp (NIH3T3-ABCB1) as previously described [50]. BHK21 cell line was stably transfected to overexpress MRP1 (BHK21-ABCC1) as previously described [51]. Both parental and stably transfected cell lines were kindly provided by Dr. Attilio Di Pietro (IBCP, Lyon, France). All cell lines were cultivated in High Glucose modified Dulbecco’s Modified Eagle Medium, supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin and maintained at 37 °C and 5% CO2 under controlled humidity. The stably transfected cells were additionally treated with 0.75 mg mL−1 of G418 (HEK293-ABCG2), 60 ng mL−1 of colchicine (NIH3T3-ABCB1) or 0.1 mg mL−1 methotrexate (BHK21-ABCC1). The cells were cultivated until reaching 80–90% of confluence and then used for experimentation.

2.4. INHIBITION ASSAY

The transport inhibition assay was carried out with cells overexpressing the ABC transporters: ABCG2 (HEK293-ABCG2), P-gp (NIH3T3-ABCB1) and MRP1 (BHK21-ABCC1). Cells were seeded at the density of 1.5×105 cells/well in 24 well culture plates and incubated for 48 h at 37 °C under 5% CO2. Cells were treated with compounds 312 (10 or 50 μM) and substrate (5 μM of mitoxantrone, 5 μM rhodamine 123 and 0.15 μM of calcein-AM for ABCG2, P-gp and MRP1, respectively). Stably transfected cells treated with the reference inhibitors Ko143 (0.5 μM), GF120918 (0.5 μM) and verapamil (30 μM) were used as positive inhibition controls for ABCG2, P-gp and MRP1 respectively. The negative control consisted of stably transfected cells exposed only to their respective substrates. Cells in all conditions (negative/positive controls and tested conditions) were incubated for 30 min at 37 °C and 5% CO2. After treatment, cells were washed with PBS (400 μl), detached with trypsin (50 μl) and resuspended in ice-cold PBS (300 μl). The intracellular fluorescence was monitored with a FACS Calibur cytometer (Becton Dickinson) using Red Laser/FL4 channel for mitoxantrone and Blue Laser/FL1 channel for rhodamine 123 and calcein-AM, with at least 10,000 events acquired inside the gate (geometrical delimitation of higher density and most homogeneous cells within a dot plot). The maximal fluorescence (assumed as 100%) was determined by the median value of intracellular accumulation of substrates in stably transfected cells incubated with their specific reference inhibitors (or using their respective parental cell lines). A minimum ratio of 2 between the maximum and minimum fluorescence values obtained by the positive and negative inhibition controls, respectively, was necessary to validate each experiment. The percentage of transport inhibition was calculated by the following equation:

%inhibition=(C-S)/(I-S)×100

where “C” corresponds to the intracellular fluorescence of cells in the presence of the tested compounds and their specific substrate, “S” corresponds to the intracellular fluorescence of cells in the presence of the substrate alone, and “I” corresponds to the intracellular fluorescence of cells in the presence of both their specific substrate and reference inhibitor. The IC50 curves of ABCG2 inhibition were obtained with increasing concentrations of magnolol derivatives (0.39 – 50 μM) using mitoxantrone as fluorescent substrate.

2.5. CONFOCAL MICROSCOPY

HEK293-ABCG2 cells were seeded at a density of 1×105 cells/well in 24-well culture plates containing coverslips for microscopy and incubated for 48 h at 37 °C under 5% CO2. Cells that adhered to the coverslips were treated with 50 μM of inhibitor and 1 μM of the ABCG2 substrate Hoechst 33342 for 30 min at 37°C and 5% CO2. After incubation, the coverslips were removed from the plate and placed on slides for microscopy. The slides were then read in a confocal microscopy Nikon A1R MP + (NIKON, Tokyo, Japan) using an oil-immersed 40X objective (with the numerical aperture of 1.15). A laser of 405 nm was used for excitation, and the fluorescence emission was recorded using a bandpass filter of 425–475 nm. The software Nis Elements 4.20 (NIKON, Tokyo, Japan) was used for the visualization of the images.

2.6. CELL VIABILITY ASSAYS

Cell viability was evaluated with a 3-(4,5-dimethylthiazol-2-yl)-2,5-iphenyltetrazolium bromide (MTT) colorimetric assay [52]. HEK293 and HEK293-ABCG2 cells were seeded into 96-well culture plates at 1.5×104 cells/well density. After overnight incubation, the cells were treated with various concentrations of magnolol derivatives (0.19 – 100 μM) for 72 h at 37 °C under 5% CO2. For reversion tests (sensitization), cells were simultaneously treated with a saturation concentration of 11 and 0.05 μM of SN-38 and incubated under the same conditions. After the treatment, the culture medium was removed and 100 μL of a 0.5 mg mL−1 of MTT solution was added. Cells were then incubated for 4 h at 37°C under 5% CO2. The formazan crystals were dissolved with a solution of DMSO/ethanol (1:1) and the absorbance was measured at 570 nm using a Multiscan FC microplate reader (Thermo Scientific). The results were expressed as percentage of viable cells versus control cells (0.1% DMSO, v/v) taken as 100%.

2.7. mRNA EXPRESSION LEVELS BY qPCR

Total RNA was obtained of HEK293-ABCG2 cells from cultures with approximately 90% of confluence after treatment for 72 h with 11 (50 μM). The total RNA isolation was performed using TRIzol (Invitrogen) protocol according to the manufacturer’s instructions. A NanoDrop Spectrophotometer was used to quantify RNA concentration and the integrity was evaluated by 1% agarose gel electrophoresis and, subsequently, RNA was stored at −80 °C. Two micrograms of total RNA were reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer’s instructions, and the resulting cDNA was stored at −20 °C. Using cDNAs as the template, quantitative real-time PCR (qPCR) was performed using the SYBR Green PCR Master Mix (Applied Biosystems) in a 7500 Real-Time PCR Detection System (Applied Biosystems). A dissociation cycle was performed after each run to check for non-specific amplification or contamination. The mRNA expression levels were normalized using the geNorm 3.4 software, and the corresponding housekeeping gene expression levels. Sets of specific primers were designed using Primer designing tool - NCBI and validated through BLAST and BLAT, and their respective sequences are shown in Table 1. Relative expression levels were estimated using the method described by Pfaffl [53].

TABLE 1 -.

NUCLEOTIDE SEQUENCES OF PRIMERS USED FOR qPCR.

Gene NCBI reference Sequence Reference
PPIA NM_021130.5 F- TAAAGCATACGGGTCCTGGC
R- TGCCATCCAACCACTCAGTC
[5458]
RPS13 NM_001017.3 F- CGTCCCCACTTGGTTGAAGT
R- TGAATCTCTCAGGATTACACCGA
[55,58,59]
HPRT1 NM_000194.3 F- CAGGGATTTGAATCATGTTTGTGT
R- ACTCCAGATGTTTCCAAACTCAAC
[54,58,60,61]
ABCG2 NM_001257386.2 F - ATGGTCTGTTGGTCAATCTCAC
R – TTATGCTGCAAAGCCGTAAATCC
[58]

2.8. ATPase ASSAY

The ATPase activity was determined as previously described [62]. High-Five insect cell total membranes overexpressing ABCG2 were used at a concentration of 5 μg protein/tube in a final volume of 100 μL. The membranes were incubated in assay buffer with the following composition: 50 mM Tris–HCl, pH 6.8, 150 mM N-methyl-D-glucamine (NMDG)-Cl, 5 mM sodium azide, 1 mM EGTA, 1 mM ouabain, 2 mM DTT, and 10 mM MgCl2, in the presence or absence of sodium orthovanadate (0.3 mM). The protein-buffer mix was treated with the inhibitor at increasing concentrations (0 – 50 μM) and incubated for 20 min at 37 °C in the presence of ATP (5 mM). The reaction was stopped with the addition of 100 μL of 5% SDS, 400 μL of Pi solution (sulfuric acid 36.2 N, water, ammonium molybdate and antimony potassium tartrate) and 200 μL of 1% ascorbic acid. After 10 min, the absorbance was measured at 880 nm using Ultrospec 3100 pro spectrophotometer (Amersham Biosciences, UK).

2.9. CONFORMATIONAL ANTIBODY BINDING (5D3)

HEK293-ABCG2 cells were seeded at a density of 2×105 cells/well in 24 well culture plates and incubated for 48 h at 37 °C under 5% CO2. After incubation the cells were washed with PBS, detached by trypsin, collected with 300 μL of PBS and centrifuged (1000×g for 3 min). The cell pellet was resuspended in 100 μL of PBS containing 4 μL of a BSA solution (1 mg/mL). Cells were treated with inhibitor at 50 μM for 10 min at 37 °C. The 5D3 primary antibody (Purified mouse anti-human CD338, BD Pharmigen - 1:100) was added and incubated at 37 °C for 30 min. After incubation, centrifugation was performed at 1000×g for 3 min and the cell pellet was resuspended in 100 μL of PBS containing the secondary antibody conjugated with phycoerythrin (PE Goat anti-mouse IgG, Abcam - 1:200) and incubated at 37 °C for 30 min. After incubation, centrifugation was performed at 1000×g for 3 min and the pellet was resuspended in 300 μL of ice-cold PBS. The flow cytometry analysis was performed as previously described, with a FACS Calibur cytometer (Becton Dickinson) using the blue laser (488 nm) and FL-2 filter.

2.10. THERMOSTABILITY ASSAY

The thermal stability assay was performed as previously described [63]. Total membrane prepared from High Five insect cells overexpressing ABCG2 were incubated (3 μg protein/tube) with assay buffer with the following composition: 50 mM Tris–HCl, pH 6.8, 150 mM N-methyl-d-glucamine (NMDG)-Cl, 5 mM sodium azide, 1 mM ouabain and 2 mM DTT, in the presence or absence of 0.3 mM orthovanadate at a final volume of 50 μL. To evaluate the effect of 11 over thermal stability, each sample was prepared with 12.5 mM MgCl2 or 6.25 mM ATP and incubated with a temperature range from 37 to 71 °C for 10 min using a thermocycler C1000 Touch (Bio-Rad, Hercules, CA). After incubation, 10 μL of 25 mM ATP or 50 mM MgCl2 (5 and 10 mM final concentration, respectively) was added and incubated at 37 °C/20 min to allow ATP hydrolysis. The reaction was stopped with the addition of 50 μL of Pi solution containing 1% ammonium molibdate, 2.5 N H2SO4 and 0.014% potassium-antimony tartrate. To evaluate the absorbance, the samples were transferred to a 96 well plate (50 μL/well) and added 150 μL of 0.33% sodium ascorbate solution. The absorbance was measured after 15 min of incubation at room temperature using the microplate reader Spectramax iD3 (Molecular Devices, San Jose, CA). The sensitive activity to vanadate (Vi) was calculated as the difference between the activity in the absence of Vi and the activity in the presence of Vi to each temperature.

2.11. DOCKING AND ADMET STUDIES

Molecular docking studies were performed using the ABCG2 structure deposited in the Protein Data Bank under the ID code 6VXI [64]. The inhibitors were structurally optimized by applying the Mopac 2016 program (MOPAC2016, James J. P. Stewart, Stewart Computational Chemistry, Colorado Springs, CO, USA, http://OpenMOPAC.net (2016) by using the PM7 method [65]. The structures for ABCG2 and inhibitors were prepared for use with AutoDock Vina [66] using the prepare_ligand.py script from AutoDock Tools (v.1.5.6). The protein structure had unsolved side chains completed and their protonation state estimated through Maestro PrepWizard. For molecular docking, an area of 29.41 × 30.33 × 32.55 Å and coordinates X= 0.201, Y= −0.921 and Z= −2.044 was delimited. Two initial strategies were used: first, docking on the apoprotein and then docking on the structure containing a redocked mitoxantrone molecule. After, the resulting structure with 11 was used to dock a second molecule of 11, to simulate possible interactions between ABCG2 and this compound at high concentrations. The exhaustiveness parameter was set to 75 and a maximum number of 9 binding modes was used. Docked models of the inhibitors, binding sites and amino acid interactions were visualized with ABCG2 using PYMOL (Molecular Graphics System, Version 1.3, Schrödinger, LLC) and PLIP web server [67], the latter being used to determine the intermolecular interactions between the molecules and the side chains of the transporter. Physicochemical, pharmacokinetic (absorption, distribution, metabolism and excretion), and toxicity properties of 11 and the reference inhibitor Ko143 were calculated using the ADMETlab 2.0 webtool [68], by inserting the molecules SMILES strings into the screening tab.

3. RESULTS

3.1. CHEMISTRY

A total of 13 magnolol derivatives were included in this study. Compounds 3 - 10 were resynthesized according to a chemo-enzymatic procedure previously reported by Pulvirenti et al. [38]. The detailed reaction conditions are summarized in Supplementary Material. The synthesis of 13 is reported for the first time herein (Scheme 1). This derivative was achieved by semi-synthesis into two steps: methylation of magnolol afforded the monomethyl derivative (11) with 89.4%, then, a selective hydroxylation carried out with IBX gave the expected compound 13 with 11.6% yield. The compound was characterized by HRMS spectrometry and by 1H and 13C NMR spectroscopy, thus confirming the obtained compound has the expected OH functionality in ortho position to OH.

3.2. IDENTIFICATION OF 11 AS A SELECTIVE AND NONCYTOTOXIC ABCG2 INHIBITOR

A total of 13 magnolol derivatives (Table 2) were evaluated as potential inhibitors of ABCG2 transporter by examining their effect on mitoxantrone ABCG2-mediated efflux.

TABLE 2 -.

SCREENING OF MAGNOLOL DERIVATIVES ON ABC TRANSPORTERS (ABCG2, P-GP AND MRP1)

Inhibition (% ± SD)

Compound ABCG2 (BCRP) ABCB1 (P-gp) ABCC1 (MRP1)

10 μM 50 μM 10 μM 50 μM 10 μM 50 μM

graphic file with name nihms-1981025-t0010.jpg 3 2.5 ± 3.6 6.9 ± 3.8 −0.3 ± 2.0 −0.3 ± 2.8 3.3 ± 2.8 6.2 ± 1.3
graphic file with name nihms-1981025-t0011.jpg 4 6.1 ± 7.9 12.8 ± 13.2 −0.8 ± 2.0 0.0 ± 2.4 2.7 ± 4.5 2.2 ± 1.5
graphic file with name nihms-1981025-t0012.jpg 5 0.6 ± 2.0 1.0 ± 0.5 0.4 ± 1.9 −1.0 ± 2.0 3.5 ± 4.0 2.2 ± 3.0
graphic file with name nihms-1981025-t0013.jpg 6 0.9 ± 2.7 3.6 ± 2.8 −0.3 ± 2.0 −0.5 ± 1.5 1.7 ± 2.0 3.2 ± 3.5
graphic file with name nihms-1981025-t0014.jpg 7 10.1 ± 2.7 21.9 ± 3.4 0.0 ± 1.2 −0.1 ± 1.6 3.8 ± 2.8 9.0 ± 5.8
graphic file with name nihms-1981025-t0015.jpg 8 7.0 ± 2.1 21.5 ± 4.7 0.3 ± 0.6 −0.4 ± 1.3 4.3 ± 3.4 9.9 ± 5.2
graphic file with name nihms-1981025-t0016.jpg 9 0.1 ± 1.8 2.7 ± 0.5 0.0 ± 2.3 −0.3 ± 1.6 2.5 ± 2.0 10.0 ± 6.8
graphic file with name nihms-1981025-t0017.jpg 10 21.8 ± 12.0 53.1 ± 8.5 −0.6 ± 1.4 −0.4 ± 1.6 1.0 ± 1.2 6.9 ± 3.2
graphic file with name nihms-1981025-t0018.jpg 11 62.0 ± 11.9 105.4 ± 13.8 −0.7 ± 1.2 2.8 ± 3.8 4.9 ± 7.0 11.5 ± 5.8
graphic file with name nihms-1981025-t0019.jpg 12 5.9 ± 10.9 32.8 ± 5.5 −1.1 ± 1.5 −0.5 ± 2.1 2.6 ± 1.8 9.1 ± 3.3
graphic file with name nihms-1981025-t0020.jpg 13 4.0 ± 4.4 19.5 ± 4.4 1.1 ± 4.6 −1.2 ± 1.8 2.9 ± 4.3 4.7 ± 6.4
graphic file with name nihms-1981025-t0021.jpg 14 1.8 ± 1.7 19.5 ± 4.5 0.5 ± 0.9 −6.4 ± 0.3 5.6 ± 5.5 16.0 ± 10.7
graphic file with name nihms-1981025-t0022.jpg 15 1.1 ± 5.4 20.4 ± 1.7 0.2 ± 0.8 2.0 ± 1.9 4.3 ± 3.9 5.8 ± 4.1

These bisphenolic neolignans were mainly obtained starting through enzymatic dimerization of simple natural phenols (eugenol, tyrosol and homovanillic alcohol) as well as through chemical modification of magnolol. The products differ from magnolol scaffold for various structural details: ortho insertion of hydroxyl (as in compound 3) and/or methoxy (4, 5) groups; simple side chain modifications through insertion of hydroxyl (6) or acetoxyl group (7); combination of acetylated side chain with the addition of methoxy (8), hydroxyl (9) or both (10) groups. In compounds 1113, the magnolol scaffold was decorated with hydroxyl or methoxy groups; 14 and 15 are the hydrogenated analogues of 1 and 11.

Stably transfected cells overexpressing ABCG2 (HEK293-ABCG2) were incubated with these compounds at concentrations of 10 and 50 μM for 30 min. The intracellular fluorescence of mitoxantrone was monitored by flow cytometry. One magnolol derivative (10) showed a partial inhibition (~50% of inhibition) at the higher concentration tested. Only compound 11 showed a total inhibition (~100% of inhibition) of mitoxantrone ABCG2-mediated efflux (Table 2).

Additionally, the selectivity toward ABCG2 was evaluated by comparing the effect of these magnolol derivatives on P-gp and MRP1 activity using rhodamine 123 and calcein-AM as fluorescent substrates, respectively. Stably transfected cells overexpressing P-gp (NIH3T3-ABCB1) and MRP1 (BHK21-ABCC1) were used. As shown in Table 2, none of these compounds inhibited neither P-gp nor MRP1 activities. These results suggest that magnolol derivatives are a class of compounds that exclusively affects the activity of ABCG2 transporter. Once the chemical structure of the two most potent compounds (10 and 11) are very different, the data of table 2 are not enough to perform a correct structure-activity relationship study with this class of compounds.

HEK293-ABCG2, NIH3T3-ABCB1 and BHK21-ABCC1 cells were exposed to mitoxantrone (5 μM), rhodamine 123 (5 μM) and calcein-AM (0.15 μM) respectively, and magnolol derivatives (10 and 50 μM). Ko143 (0.5 μM), GF120918 (0,5 μM) and verapamil (30 μM) were used as positive controls, which produce 100% inhibition, for ABCG2, P-gp and MRP1 respectively. Intracellular accumulation of the fluorescent substrates was monitored by flow cytometry using FL4-H (mitoxantrone) and FL1-H (rhodamine 123 and calcein-AM) channels. Results were expressed as percent of inhibition related to positive controls. The data represents the mean ± SD of, at least, three independent experiments.

The effect of these two most promising magnolol derivatives on ABCG2 was studied by different approaches. HEK293-ABCG2 cells were submitted to a short-term (30 min) treatment using increasing concentrations of 10 and 11 to determine the IC50 values (concentration that produce the half-maximal inhibition). Compounds 10 and 11 showed IC50 values of ABCG2 inhibition of 22.6 (Fig. 1A) and 9.5 μM (Fig. 1B), respectively. In addition, these data revealed that 10 is a partial ABCG2 inhibitor, in contrast to 11, that is a complete ABCG2 inhibitor, such as the reference inhibitor Ko143 (Fig. 1C).

Figure 1.

Figure 1.

Inhibition curves of magnolol derivatives and histogram overlays. IC50 curves of ABCG2 inhibition for 10 (A) and 11 (B). HEK293-ABCG2 cells were exposed to mitoxantrone (5 μM) and magnolol derivatives (10 and 11 at 0.039 – 50 μM). Ko143 (0.5 μM) was used as positive control (100% inhibition). Results were expressed as percent of inhibition related to the positive control. (C) Histograms of ABCG2 inhibition: 10, 11 and Ko143.

The cytotoxicity effect of drugs in parental and cells overexpressing the target ABC transporter can provide valuable information about a possible ABCG2-mediated cross-resistance or collateral sensitivity [69]. HEK293 and HEK293-ABCG2 cells were treated for 72 hours with increasing concentrations of 10 and 11 (Fig. 2). Compound 10 was cytotoxic at high concentrations (≥ 50 μM). The similar cytotoxicity pattern for both cell lines suggests an absence of cross-resistance, which means that 10 is not recognized as an ABCG2 substrate (Fig. 2A). In addition, 11 did not showed a cytotoxic effect even at 100 μM, the highest concentration tested (Fig. 2B).

Figure 2 -. Cell viability assay and therapeutic ratio representation.

Figure 2 -

Cytotoxic profile of the two best compounds, 10 (A) and 11 (B). HEK293 and HEK293-ABCG2 cells were submitted at a long-term treatment (72 hours) with increasing concentrations of magnolol derivatives (0.19 – 100 μM). (C) Inhibition potency and cytotoxicity of the compounds with their respective therapeutic ratios.

Considering the two most important parameters for identification of new ABCG2 inhibitors, potency of inhibition and intrinsic cell cytotoxicity, the therapeutic ratio (TR) values were calculated as the ratio between the IG50 value (concentration that reduces 50% of the cell viability) and IC50 value of inhibition. As shown in figure 2C, 11 was the best compound, showing a TR almost ten times greater than 10. Together, these data highlight that 11 is the most promising compound from this series.

3.3. STUDY OF 11 ON ABCG2 USING MEMBRANE-BASED APPROACHES

Substrates and inhibitors of ABC transporters commonly exert opposite effects on the ATPase activity, stimulating and inhibiting, respectively [70,71]. The effect of 11 on the ABCG2 ATPase activity was studied using total membranes from High-Five insect cells overexpressing the ABCG2 transporter. As shown in Fig. 3A, this magnolol derivative triggered a dual effect, stimulating (~60%) the ATPase activity of ABCG2 at low concentrations and inhibiting (~30%) at the higher concentration (50 μM).

Figure 3 -.

Figure 3 -

Effects of 11 on ABCG2 ATPase activity and protein thermostability. (A) Effect of 11 at increasing concentrations (0.001 – 50 μM) on basal ABCG2 ATPase activity. Thermostability assay in the absence (B) and the presence (C) of 11. The data represent mean ± SD of three independent experiments performed in duplicate.

Additionally, the effect of 11 on the thermostability of the protein was studied in membranes of insect cells overexpressing ABCG2. The thermostability of a protein is often altered due to conformational changes induced by a ligand [72]. To study the binding of 11 on ABCG2 and possible allosteric conformational changes, a thermostability assay in the presence and absence of ATP was performed. Interestingly, 11 decreased the IT50 values compared to the control (DMSO) (Fig. 3B and C), suggesting that the binding of this magnolol derivative destabilizes the protein structure.

3.4. STUDY OF 11 ON ABCG2 USING CELL-BASED APPROACHES

To additionally characterize the mechanism of inhibition caused by 11, the functional inhibition was studied using other substrates of ABCG2. The intracellular fluorescence of Hoechst 33342 was analyzed by confocal microscopy. The results obtained by compound 11 were compared with the effect caused by the reference inhibitor Ko143. A diffuse fluorescent pattern was observed in the absence of inhibitors (Fig. 4A). Whereas, similarly to Ko143, 11 promoted an increase in the intracellular levels of Hoechst 33342 (Fig. 4A), confirming that 11 is not a substrate-specific inhibitor.

Figure 4 –

Figure 4 –

Mechanism of ABCG2 inhibition caused by compound 11. (A) Intracellular accumulation of Hoechst 33342 (1 μM) in HEK293-ABCG2 cells by confocal microscopy. Ko143 (0.5 μM) was used as control and 11 was tested at 50 μM. (B) Effect of 11 on mRNA expression levels. (C and D) Histograms from the conformational 5D3 antibody shift assay. Overlay of untreated control and cells treated with Ko143 2 μM (C) and 11 50 μM (D). (E) Lineweaver-Burk plot using different concentrations of 11 and mitoxantrone as substrate.

To further explore the mechanism of inhibition, the effect of 11 on mRNA ABCG2 expression levels was studied by qPCR. As shown in figure 4B, 11 did not significantly affect the transcriptional levels of ABCG2, suggesting that this compound is not an ABCG2 expression modulator, but a functional ABCG2 inhibitor. In addition, the effect of 11 on protein conformation was investigated by the 5D3 shift assay. This assay consists in the use of the conformational antibody 5D3, which recognizes an epitope in the extracellular loop of ABCG2. As shown in Fig. 4C and D, the magnolol derivative triggered an increase of the 5D3 binding similar to the reference inhibitor Ko143, suggesting that the interaction of 11 on ABCG2 caused important conformational changes in the extracellular region of the transporter.

The absence of ABCG2-mediated transport of 11 suggests that this magnolol derivative does not share the same binding region or site with ABCG2 substrates. To pursue this hypothesis, the type of inhibition was investigated using increasing concentrations of both mitoxantrone and 11. The data showed an increasing of Vmax and Km while inhibitor concentration increased, suggesting a mixed type of inhibition, which can be visualized by the Lineweaver-Burk plot (Fig. 4E).

3.5. STUDY OF 11 USING in silico APPROACHES

A molecular docking study was performed to better understand the binding site of 10 and 11 on ABCG2. As shown in figure 5A, similarly to the reference inhibitor Ko143, 11 binds in the transmembrane region of ABCG2 (apo structure). To compare the binding of 10 and 11 on ABCG2, the inactive analogue of 11, that corresponds to compound 12, was also used. The difference between these two analogues corresponds to a methoxy group substitution (12) instead of a hydroxyl group (11), which leads to opposite inhibitory effects. The analysis using the ABCG2 apo structure revealed an overlap of the binding site for all three molecules (Fig. 5B), with a binding affinity of −8.5 kcal/mol for 10 and −9.7 kcal/mol for both 11-12. All molecules bound preferentially to the central pocket of drug binding site (drug binding cavity), and the pair of analogues 11-12 additionally presented identical binding conformation (Fig. 5B).

Figure 5 -. Docking of Ko143, magnolol derivatives and mitoxantrone on ABCG2.

Figure 5 -

(A) Binding site of Ko143 and 11 (spheres representations in purple and orange, respectively) and (B) sequential docking analysis of 10 (in yellow), 11 (in orange) and 12 (in green) on ABCG2 structure (PDB: 6VXI) without mitoxantrone (MTX). (C) Redocked MTX interactions with ABCG2. (D) Binding site comparison of mitoxantrone molecules (original MTX from 6VXI in light blue and redocked MTX in dark blue). (E) Sequential docking analysis and interactions of 10, 11 and 12 (in yellow, orange, and green, respectively) with ABCG2 structure containing MTX (in dark blue). 11 (F) and 12 (G) interactions with ABCG2 in the presence of MTX. (H) Sequential docking and interactions involving two molecules of 11. ABCG2 chains are light gray (A chain) and dark gray (B chain), hydrophobic interactions (C, F, G and H) displayed as dashed gray lines. Amino acids in B, D and E for spatial reference only. Figures were generated using PYMOL (Molecular Graphics System, Version 1.3, Schrödinger, LLC) and PLIP web server [67].

In addition, the docking analysis revealed that all molecules were stabilized through pi-stacking interactions between the F439 residues of the A and B chains and the aromatic rings of the biphenolic core (Fig. 5B), as observed for mitoxantrone alone (Fig. 5C). A docking analysis was also performed with two other small molecules that inhibit ABCG2, chalcone 27 [17] and stilbene 9 [16], which showed binding affinities of −8.2 and −9.2 kcal/mol, respectively (Fig. S1B and C). These compounds also presented pi-stacking interactions between their aromatic rings and F439 residues. Additionally, chalcone 27 binding was also supported by two H-bonds with N436A and T452B, such as Ko143 (Fig. S4A and C). In summary, an overlap in the ABCG2 binding site was observed for all these inhibitors (Fig. S4D).

Interestingly, the docking analysis using the ABCG2 structure containing the redocked substrate mitoxantrone, which presents the same binding region as the original molecule (Fig. 5D), revealed a shift of 10, 11 and 12 binding sites (Fig. 5E). This shift was different for 11 (Fig. 5F) when compared with 12 (Fig. 5G), which should implicate in a decreased binding affinity value (−7.1 vs −6.4 kcal/mol, respectively). This different binding mode in presence of the substrate could be related to the lack of a H-bond donor in 12, which is present on 11 through the hydroxyl group and a H-bond with Q398A sidechain (Fig. 5F). In addition, no specific intermolecular interactions other than hydrophobic contacts were identified in the docking of the structure in the presence of mitoxantrone. Curiously, the 11-11 sequential docking resulted in a second molecule binding in a similar conformation and identical energy (−7.1 kcal/mol) (Fig. 5H). Finally, the different binding sites of 11 and mitoxantrone (Fig. 5E) support the mixed type of inhibition caused by this inhibitor (Fig. 4E). Although we can assume that 11 occupies a different site of mitoxantrone, it should induce conformational changes on protein, which affects Km value of substrate.

Further, an in silico analysis to investigate physicochemical and ADMET (Absorption, Distribution, Metabolism, Excretion and Toxicity) features of 11 and Ko143 was also performed. The main parameters of interest regarding those properties are summarized in table 3.

TABLE 3 –

PHYSICOCHEMICAL AND ADMET CALCULATION


Compound Physicochemical Absorption Distribution

MW LogP F20% F30% PPB Fu

11 280.15 5.169 0.744 0.983 100.859% 0.668%
Ko143 469.26 3.768 0.012 0.034 95.423% 1.903%

Metabolism Excretion Toxicity

iCYP1A2 iCYP2C19 CL T ½ DILI RAO

11 0.968 0.930 10.798 0.298 0.078 0.042

Ko143 0.045 0.453 9.540 0.709 0.905 0.886

Physicochemical and ADMET properties of 11 and Ko143. MW = Molecular Weight; F20% and F30% represent the probability (0–1) of oral bioavailability lower than 20 and 30%, respectively; PPB = Plasma Protein Binding; Fu = Fraction unbounded; iCYP1A2 and iCYP2C19 = probability (0–1) to inhibit CYP1A2 and CYP2C19. CL = clearance (ml/min/kg); T ½ = probability (0–1) of having a half-life lower than 3 hours; DILI = probability (0–1) of inducing liver damage; RAO (Rat Oral Acute Toxicity) = probability (0–1) of being highly toxic.

3.6. SENSITIZATION STUDY OF 11 TO ANTICANCER DRUGS

To verify the potential utilization of magnolol derivatives as ABCG2 inhibitors in further pre-clinical studies, an in vitro chemosensitization assay using cells overexpressing ABCG2 was performed after 72 h of co-treatment using 11 and SN-38 (active metabolite of irinotecan which is transported by ABCG2).

As shown in Fig. 7, transfected cells (HEK293-ABCG2) are resistant to the treatment of SN-38 when compared to HEK293 cells. HEK293-ABCG2 cells exposed to the co-treatment (11 + SN-38) showed a significant decrease in the cell viability when compared to the treatment with SN-38 alone. Additionally, HEK293-ABCG2 cells co-treated with 11 + SN-38 or Ko143 (reference inhibitor) + SN-38 showed the same percentage of cell viability as the observed for HEK293 cells exposed to SN-38 alone. These findings demonstrate that 11 was able to completely revert the MDR phenotype mediated by ABCG2.

Figure 7 – Chemosensitization assay using of stably transfected cells overexpressing ABCG2.

Figure 7 –

Cell viability after 72 h of treatment. HEK293-ABCG2 and HEK293 cells treated with SN-38 alone and HEK293-ABCG2 cells in co-treatment with SN-38 and 11 at saturating concentration or SN-38 and Ko143 at 0.5 μM (positive control). Data represents mean ± SD of at least three independent experiments performed in triplicate. Groups were statistically compared using one-way ANOVA (Sidak’s multiple comparisons test). NS = non-significant; ***p<0.001 and ****p<0.0001.

4. DISCUSSION

Magnolol (1) core structure and its structural isomer honokiol (2) have been recently associated with a down-regulation of ABCG2 expression levels and ABCG2 functional inhibition [43]. Here, we screened 13 magnolol derivatives to verify their potential as specific ABCG2 inhibitors (Table 2). Unfortunately, the nature and the number of the substituents in the magnolol scaffold from this series of compounds did not allow us to establish a precise structure-activity relationship study. The best magnolol derivative was 11, which is structurally similar to the precursor scaffold. The single difference between 11 and the magnolol core structure was the replacement of the hydroxyl group of magnolol by a methoxy group.

In general, the presence of methoxy groups increases the ABCG2 inhibition effect, as reported by stilbenes [16,17]. Despite the increase of the ABCG2 inhibition observed by the replacement of a hydroxyl group with a methoxy group (9 versus 10), the presence of a second methoxy group decreased the inhibition effect (10 versus 8). The same negative effect of the replacement of a hydroxyl group by a methoxy group was also observed by 11 versus 12 (Table 2). This negative effect on ABCG2 inhibition was observed when replacing the two allyl groups (11) with two propyl groups (15), and the replacement of a methoxy group with a hydroxyl group did not produce any effect (15 versus 14). Interestingly, the presence of a second hydroxyl group (13) in the structure abrogates the inhibition effect. These data suggest that a single chemical change in the studied compounds can markedly modify their biological effects. These findings are not commonly observed for other classes of ABCG2 inhibitors, such as chalcones [17], stilbenes [16], indeno[1,2-b]indoles [73], and chromones [15], where a single substitution commonly shows a mild impact in the potential of inhibition.

Only 11 and 10 showed more than 50% of ABCG2 inhibition (Table 2), and 11 showed a lower IC50 value (Fig. 1) and a non-cytotoxic profile (Fig. 2). Compound 11 showed an IC50 value of 9.5 μM when mitoxantrone was used as substrate. In addition, 11 should be considered a complete inhibitor since it produced a saturation effect of inhibition at 100%, similar to the reference inhibitor Ko143 (Fig. 1C). For ABCG2, the maximal inhibition effect is an important characteristic to be considered during the screening of new inhibitors [74]. Another desirable feature is the selectivity toward one single ABC transporter [75,76]. The selectivity toward ABCG2 can reduce collateral effects due the interference on homeostasis processes and the pharmacokinetics of other drugs [77]. In this study, all magnolol derivatives were selective toward ABCG2, showing no inhibition on P-gp (Table 2).

A second important feature of ABC transporter inhibitors is the absence of transport mediated by these proteins [74]. Interestingly, magnolol and honokiol have been previously described as substrates of ABCG2 [43]. Here, a cell viability assay investigated the hypothesis of a transport mediated by ABCG2. As shown in Figure 2B, 11 was not cytotoxic even when using high concentrations (10-fold the IC50 value). However, 10 showed a similar cytotoxic effect in both parental and cells overexpressing ABCG2. These data suggest that this magnolol derivative is not recognized as a substrate of ABCG2 (Fig. 2A). Substrates of ABCG2 constitute a good scaffold resource for the development of new inhibitors, as described by stilbenes and porphyrins [16,22,74]. A third important feature of inhibitors is the therapeutic ratio, which consists of the ratio between the potency of inhibition (IC50 value) and cytotoxicity (IG50 value). In this study, 11 showed a lower IC50 value and an estimated cytotoxic effect > 100 μM, thus, 11 showed a TR at least 6-fold higher than 10. The TR observed for 11 was similar to the porphyrin 4B, recently described as a new selective ABCG2 inhibitor [22], but very lower than the observed for chromone 6g (MBL-II-141) [15] and Ko143 [78,79] (TR of ~ 2000 and ~2600, respectively). However, despite being more potent (IC50 = 0.01 μM) [79], Ko143 is more cytotoxic than 10 and 11 (IG50 = 18 – 34 μM) [80].

To better understand the mechanism of inhibition, membrane-based approaches were used to evaluate the effect of 11 on ATPase activity and thermostability of ABCG2. The efflux of substrates mediated by ABC transporters through the cellular membrane depends on the binding and hydrolysis of ATP [2] and, in general, functional inhibitors (compounds that inhibit the transport activity) also inhibit the ATPase activity, such as Ko143, a reference ABCG2 inhibitor [81]. However, differently of P-gp, it is not uncommon for ABCG2 that functional inhibitors stimulate the ATPase activity, such as stilbenes [16], tetrahydroquinoline/4,5-dihydroisoxazole molecular hybrids [82], indeno[1,2-b]indoles [20], Ulixertinib [83] and Rociletinib [84]. Here, we observed a rare and complex effect triggered by 11, a dual behavior: stimulation at low concentrations and inhibition at high concentrations (Fig. 3A). Despite rare, this effect already was described for nilotinib and gefitinib [85,86]. The thermostability assay showed a decrease in protein stability in the presence of 11 and ATP, since the IT50 decreased by approximately 10 °C. This result was similar to the observed for porphyrin 4B [22] and confirmed structural protein changes induced by 11 binding (Fig. 3C).

Cell-based approaches were also employed to better understand the inhibition mechanism of 11. Confocal microscopy allowed us to verify that this magnolol derivative was able to inhibit the ABCG2-mediated efflux of Hoechst 33342, similarly to Ko143 (Fig. 4A), and confirming that the ABCG2 inhibition caused by 11 is independent of the substrate. A kinetic experiment was conducted to better understand the type of inhibition caused by 11. Using increasing concentrations of the inhibitor and mitoxantrone as substrate, 11 showed a mixed type of inhibition (Fig. 4E). The same type of inhibition was recently observed for porphyrin 4B [22]. Another way to study the interaction of ligands on ABCG2 is by the 5D3 shift assay [74]. Generally, the binding of the conformation-sensitive antibody 5D3 on the extracellular loop of ABCG2 is increased by inhibitors, and not affected or even decreased by substrates [8789]. 11 showed the same behavior that functional inhibitors (Fig. 4C and D), confirming conformational changes due to 11 binding.

It was found that 11 binds to the transmembrane region that interacts with ABCG2 physiological substrate uric acid (Q398, N436, L539, T542 and V546) during translocation [90], and other ABCG2 inhibitor stravatinib (Q398, N436, V401) [91]. The docking analysis revealed that 11 shares the same ABCG2 binding site with the two others ABCG2 inhibitors that have a similar size: chalcone 27 [17] and stilbene 9 [16]. In addition, chalcone 27 and stilbene 9 showed a similar binding conformation as 11, suggesting that these inhibitors are stabilized inside the central pocket of ABCG2 mainly by pi-stacking interactions with F439A/B (Fig. S4). In the case of 12, the inactive analogue of 11, a significant smaller affinity was determined by the docking algorithm. It is possible that the presence of the hydroxyl in 11, acting as a hydrogen bond donor with Q398 and other amino acid residues of the protein, has a relevant role anchoring the compound and triggering inhibition. Although it is not possible to exclude the ability of 12 to interact through water-mediated hydrogen bonds with its methoxy groups, the stabilization promoted is possibly inferior to that present in 11, being insufficient for the molecule to be able to bind firmly to the transporter and sterically prevent the constriction of the transmembrane helices of the central cavity, characteristic of the progression from the catalytic cycle to the substrate transport step [92]. The docking analysis of 10 suggests that a neighboring methoxy group could promote a more stable H-bond with the protein side chains, possibly by decreasing the acidity of the hydrogen donor. This observation partially explains the inhibitory effect of 8 and 10 in contrast to 9. Additionally, the docking of two 11 molecules indicated that the molecules should preferentially bind to the F439 (substrate) region, due to the better binding affinity, with a second molecule able to bind to the Q398 region, when the first is occupied. This model fits the results obtained from the ATPase assay, with the first 11 molecule stimulating ATP hydrolysis (substrate site). As the concentration of 11 increases, the second site is filled, effectively preventing the necessary conformational steps for NBDs dimerization and hydrolytic activity.

The physicochemical and ADMET calculations estimated that 11 presented reduced toxicity in comparison to Ko143, showing a much lower probability of causing hepatotoxicity. However, the high LogP value of 11 might imposes potential difficulties in terms of the water solubility. In addition, the lower oral bioavailability and the high percentage of plasma protein binding suggests a difficult tissue penetration, which may be compensated by a slower excretion rate. Together, these data suggest that a drug delivery system is required for preclinical studies with 11.

Finally, the co-treatment of cells with 11 and SN-38 successfully chemosensitized cells overexpressing ABCG2 to the anticancer drug, confirming that 11 is an effective inhibitor to overcome MDR in cancer mediated by ABCG2. In summary, the magnolol derivative 11 is a promising complete ABCG2 inhibitor, that differently of the magnolol core structure does not affect the expression levels and is not transported by ABCG2 [43]. 11 is selective toward ABCG2 and trigger allosteric effects, binding in a different site that substrates. Finally, the absence of cytotoxicity observed for 11 and its ability to revert MDR phenotype make this inhibitor attractive for future pre-clinical studies.

Supplementary Material

1

HIGHLIGHTS.

  • 13 magnolol derivatives were tested as ABCG2 inhibitors.

  • The monomethoxylated magnolol derivative 11 showed complete ABCG2 inhibition.

  • Magnolol derivative 11 was not transported, noncytotoxic, and showed a specific ABCG2 inhibition.

Acknowledgments

This work was financed by MUR ITALY PRIN 2022 PNRR (Project No. P2022MWY3P). This work was also financed by the Brazilian Research Council (CNPq, grant number 404286/2021–6) and Fundação Araucária/PPSUS 2020/2021 (SUS2020131000003). ISZ, DHK and JPD were supported by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) – Finance Code 001. GS and MAP were supported by CNPq (scientific initiation fellows). DHK was also supported by the CAPES PrInt UFPR Program.

Footnotes

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have influenced the work reported.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

5 REFERENCES

  • [1].Gottesman MM, Lavi O, Hall MD, Gillet JP, Toward a Better Understanding of the Complexity of Cancer Drug Resistance, Annu. Rev. Pharmacol. Toxicol. 56 (2016) 85–102. 10.1146/annurev-pharmtox-010715-103111. [DOI] [PubMed] [Google Scholar]
  • [2].Robey RW, Pluchino KM, Hall MD, Fojo AT, Bates SE, Gottesman MM, Revisiting the role of ABC transporters in multidrug-resistant cancer, Nat. Rev. Cancer. 18 (2018) 452–464. 10.1038/s41568-018-0005-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Szakács G, Váradi A, Özvegy-Laczka C, Sarkadi B, The role of ABC transporters in drug absorption, distribution, metabolism, excretion and toxicity (ADME-Tox), Drug Discov. Today. 13 (2008) 379–393. 10.1016/j.drudis.2007.12.010. [DOI] [PubMed] [Google Scholar]
  • [4].Higgins CF, ABC Transporters: From microorganisms to man, Annu. Rev. Cell Biol. 8 (1992) 67–113. 10.1146/annurev.cb.08.110192.000435. [DOI] [PubMed] [Google Scholar]
  • [5].Aller SG, Yu J, Ward A, Weng Y, Chittaboina S, Zhuo R, Harrell PM, Trinh YT, Zhang Q, Urbatsch IL, Chang G, Structure of P-glycoprotein reveals a molecular basis for poly-specific drug binding., Science. 323 (2009) 1718–22. 10.1126/science.1168750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Fletcher JI, Haber M, Henderson MJ, Norris MD, ABC transporters in cancer: More than just drug efflux pumps, Nat. Rev. Cancer. 10 (2010) 147–156. 10.1038/nrc2789. [DOI] [PubMed] [Google Scholar]
  • [7].Stefan SM, Multi-target ABC transporter modulators: What next and where to go?, Future Med. Chem. 11 (2019) 2353–2358. 10.4155/fmc-2019-0185. [DOI] [PubMed] [Google Scholar]
  • [8].Juliano RL, Ling V, A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants, Biochim. Biophys. Acta. 455 (1976) 152–162. 10.1016/0005-2736(76)90160-7. [DOI] [PubMed] [Google Scholar]
  • [9].Tamaki A, Ierano C, Szakacs G, Robey RW, Bates SE, The controversial role of ABC transporters in clinical oncology., Essays Biochem. 50 (2011) 209–232. 10.1042/bse0500209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Fox E, Bates SE, Tariquidar (XR9576): A P-glycoprotein drug efflux pump inhibitor, Expert Rev. Anticancer Ther. 7 (2007) 447–459. 10.1586/14737140.7.4.447. [DOI] [PubMed] [Google Scholar]
  • [11].Chung FS, Santiago JS, De Jesus MFM, Trinidad CV, See MFE, Disrupting P-glycoprotein function in clinical settings: what can we learn from the fundamental aspects of this transporter?, Am. J. Cancer Res. 6 (2016) 1583–98. http://www.ncbi.nlm.nih.gov/pubmed/27648351. [PMC free article] [PubMed] [Google Scholar]
  • [12].Morschhauser F, Zinzani PL, Burgess M, Sloots L, Bouafia F, Dumontet C, Phase I/II trial of a P-glycoprotein inhibitor, Zosuquidar.3HCI trihydrochloride (LY335979), given orally in combination with the CHOP regimen in patients with non-Hodgkin’s lymphoma, Leuk. Lymphoma. 48 (2007) 708–715. 10.1080/10428190701190169. [DOI] [PubMed] [Google Scholar]
  • [13].Robey RW, Massey PR, Amiri-Kordestani L, Bates SE, ABC Transporters: Unvalidated Therapeutic Targets in Cancer and the CNS, Anticancer. Agents Med. Chem. 10 (2010) 625–633. 10.2174/187152010794473957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Valdameri G, Genoux-Bastide E, Gauthier C, Peres B, Terreux R, Winnischofer SMB, Rocha MEM, DiPietro A, Boumendjel A, 6-Halogenochromones Bearing Tryptamine: One-Step Access to Potent and Highly Selective Inhibitors of Breast Cancer Resistance Protein, ChemMedChem. 7 (2012) 1177–1180. 10.1002/cmdc.201200154. [DOI] [PubMed] [Google Scholar]
  • [15].Valdameri G, Genoux-Bastide E, Peres B, Gauthier C, Guitton J, Terreux R, Winnischofer SMB, Rocha MEM, Boumendjel A, Di Pietro A, Substituted Chromones as Highly Potent Nontoxic Inhibitors, Specific for the Breast Cancer Resistance Protein, J. Med. Chem. 55 (2012) 966–970. 10.1021/jm201404w. [DOI] [PubMed] [Google Scholar]
  • [16].Valdameri G, Pereira Rangel L, Spatafora C, Guitton J, Gauthier C, Arnaud O, Ferreira-Pereira A, Falson P, Winnischofer SMB, Rocha MEM, Tringali C, Di Pietro A, Methoxy Stilbenes as Potent, Specific, Untransported, and Noncytotoxic Inhibitors of Breast Cancer Resistance Protein, ACS Chem. Biol. 7 (2012) 322–330. 10.1021/cb200435y. [DOI] [PubMed] [Google Scholar]
  • [17].Valdameri G, Gauthier C, Terreux R, Kachadourian R, Day BJ, Winnischofer SMB, Rocha MEM, Frachet V, Ronot X, Di Pietro A, Boumendjel A, Investigation of Chalcones as Selective Inhibitors of the Breast Cancer Resistance Protein: Critical Role of Methoxylation in both Inhibition Potency and Cytotoxicity, J. Med. Chem. 55 (2012) 3193–3200. 10.1021/jm2016528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Jabor Gozzi G, Bouaziz Z, Winter E, Daflon-Yunes N, Aichele D, Nacereddine A, Marminon C, Valdameri G, Zeinyeh W, Bollacke A, Guillon J, Lacoudre A, Pinaud N, Cadena SM, Jose J, Le Borgne M, Di Pietro A, Converting Potent Indeno[1,2- b ]indole Inhibitors of Protein Kinase CK2 into Selective Inhibitors of the Breast Cancer Resistance Protein ABCG2, J. Med. Chem. 58 (2015) 265–277. 10.1021/jm500943z. [DOI] [PubMed] [Google Scholar]
  • [19].Gozzi GJ, Bouaziz Z, Winter E, Daflon-Yunes N, Honorat M, Guragossian N, Marminon C, Valdameri G, Bollacke A, Guillon J, Pinaud N, Marchivie M, Cadena SM, Jose J, Le Borgne M, Di Pietro A, Phenolic indeno[1,2-b]indoles as ABCG2-selective potent and non-toxic inhibitors stimulating basal ATPase activity., Drug Des. Devel. Ther. 9 (2015) 3481–95. 10.2147/DDDT.S84982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Kita DH, Guragossian N, Zattoni IF, Moure VR, de MRego FG, Lusvarghi S, Moulenat T, Belhani B, Picheth G, Bouacida S, Bouaziz Z, Marminon C, Berredjem M, Jose J, Gonçalves MB, Ambudkar SV, Valdameri G, Le Borgne M, Mechanistic basis of breast cancer resistance protein inhibition by new indeno[1,2-b]indoles, Sci. Rep. 11 (2021) 1788. 10.1038/s41598-020-79892-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Guragossian N, Belhani B, Moreno A, Nunes MT, Gonzalez-Lobato L, Marminon C, Berthier L, Do Rocio Andrade Pires A, Özvegy-Laczka C, Sarkadi B, Terreux R, Bouaziz Z, Berredjem M, Jose J, Di Pietro A, Falson P, Le Borgne M, Uncompetitive nanomolar dimeric indenoindole inhibitors of the human breast cancer resistance pump ABCG2., Eur. J. Med. Chem. 211 (2021) 113017. 10.1016/j.ejmech.2020.113017. [DOI] [PubMed] [Google Scholar]
  • [22].Zattoni IF, Kronenberger T, Kita DH, Guanaes LD, Guimarães MM, de Oliveira Prado L, Ziasch M, Vesga LC, Gomes de Moraes Rego F, Picheth G, Gonçalves MB, Noseda MD, Ducatti DRB, Poso A, Robey RW, Ambudkar SV, Moure VR, Gonçalves AG, Valdameri G, A new porphyrin as selective substrate-based inhibitor of breast cancer resistance protein (BCRP/ABCG2), Chem. Biol. Interact. 351 (2022) 109718. 10.1016/j.cbi.2021.109718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Zhang S, Yang X, Morris ME, Flavonoids are inhibitors of breast cancer resistance protein (ABCG2)-mediated transport., Mol. Pharmacol. 65 (2004) 1208–1216. 10.1124/mol.65.5.1208. [DOI] [PubMed] [Google Scholar]
  • [24].Henrich CJ, Robey RW, Takada K, Bokesch HR, Bates SE, Shukla S, V Ambudkar S, McMahon JB, Gustafson KR, Botryllamides: natural product inhibitors of ABCG2., ACS Chem. Biol. 4 (2009) 637–47. 10.1021/cb900134c. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Shukla S, Zaher H, Hartz A, Bauer B, Ware JA, Ambudkar SV, Curcumin inhibits the activity of ABCG2/BCRP1, a multidrug resistance-linked ABC drug transporter in mice, Pharm. Res. 26 (2009) 480–487. 10.1007/s11095-008-9735-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Sarrica A, Kirika N, Romeo M, Salmona M, Diomede L, Safety and Toxicology of Magnolol and Honokiol, Planta Med. 84 (2018) 1151–1164. 10.1055/a-0642-1966. [DOI] [PubMed] [Google Scholar]
  • [27].Maioli M, Basoli V, Carta P, Fabbri D, Dettori MA, Cruciani S, Serra PA, Delogu G, Synthesis of magnolol and honokiol derivatives and their effect against hepatocarcinoma cells, PLoS One. 13 (2018) e0192178. 10.1371/journal.pone.0192178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Shen J, Ma H, Zhang T, Liu H, Yu L, Li G, Li H, Hu M, Magnolol Inhibits the Growth of Non-Small Cell Lung Cancer via Inhibiting Microtubule Polymerization, Cell. Physiol. Biochem. 42 (2017) 1789–1801. 10.1159/000479458. [DOI] [PubMed] [Google Scholar]
  • [29].Chei S, Oh H-J, Song J-H, Seo Y-J, Lee K, Lee B-Y, Magnolol Suppresses TGF-β-Induced Epithelial-to-Mesenchymal Transition in Human Colorectal Cancer Cells., Front. Oncol. 9 (2019) 752. 10.3389/fonc.2019.00752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Chen H, Fu W, Chen H, You S, Liu X, Yang Y, Wei Y, Huang J, Rui W, Magnolol attenuates the inflammation and enhances phagocytosis through the activation of MAPK, NF-κB signal pathways in vitro and in vivo, Mol. Immunol. 105 (2019) 96–106. 10.1016/j.molimm.2018.11.008. [DOI] [PubMed] [Google Scholar]
  • [31].Cheng Y-C, Tsao M-J, Chiu C-Y, Kan P-C, Chen Y, Magnolol Inhibits Human Glioblastoma Cell Migration by Regulating N-Cadherin, J. Neuropathol. Exp. Neurol. 77 (2018) 426–436. 10.1093/jnen/nly021. [DOI] [PubMed] [Google Scholar]
  • [32].Ranaware A, Banik K, Deshpande V, Padmavathi G, Roy N, Sethi G, Fan L, Kumar A, Kunnumakkara A, Magnolol: A Neolignan from the Magnolia Family for the Prevention and Treatment of Cancer, Int. J. Mol. Sci. 19 (2018) 2362. 10.3390/ijms19082362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Li N, Song Y, Zhang W, Wang W, Chen J, Wong AW, Roberts A, Evaluation of the in vitro and in vivo genotoxicity of magnolia bark extract, Regul. Toxicol. Pharmacol. 49 (2007) 154–159. 10.1016/j.yrtph.2007.06.005. [DOI] [PubMed] [Google Scholar]
  • [34].Liu Z, Zhang X, Cui W, Zhang X, Li N, Chen J, Wong AW, Roberts A, Evaluation of short-term and subchronic toxicity of magnolia bark extract in rats, Regul. Toxicol. Pharmacol. 49 (2007) 160–171. 10.1016/j.yrtph.2007.06.006. [DOI] [PubMed] [Google Scholar]
  • [35].Lee Y-J, Lee YM, Lee C-K, Jung JK, Han SB, Hong JT, Therapeutic applications of compounds in the Magnolia family, Pharmacol. Ther. 130 (2011) 157–176. 10.1016/j.pharmthera.2011.01.010. [DOI] [PubMed] [Google Scholar]
  • [36].Li M, Zhang F, Wang X, Wu X, Zhang B, Zhang N, Wu W, Wang Z, Weng H, Liu S, Gao G, Mu J, Shu Y, Bao R, Cao Y, Lu J, Gu J, Zhu J, Liu Y, Magnolol inhibits growth of gallbladder cancer cells through the p53 pathway, Cancer Sci. 106 (2015) 1341–1350. 10.1111/cas.12762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Di Micco S, Pulvirenti L, Bruno I, Terracciano S, Russo A, Vaccaro MC, Ruggiero D, Muccilli V, Cardullo N, Tringali C, Riccio R, Bifulco G, Identification by Inverse Virtual Screening of magnolol-based scaffold as new tankyrase-2 inhibitors, Bioorg. Med. Chem. 26 (2018) 3953–3957. 10.1016/j.bmc.2018.06.019. [DOI] [PubMed] [Google Scholar]
  • [38].Pulvirenti L, Muccilli V, Cardullo N, Spatafora C, Tringali C, Chemoenzymatic Synthesis and α-Glucosidase Inhibitory Activity of Dimeric Neolignans Inspired by Magnolol, J. Nat. Prod. 80 (2017) 1648–1657. 10.1021/acs.jnatprod.7b00250. [DOI] [PubMed] [Google Scholar]
  • [39].Cardullo N, Monti F, Muccilli V, Amorati R, Baschieri A, Reaction with ROO• and HOO• Radicals of Honokiol-Related Neolignan Antioxidants, Molecules. 28 (2023) 735. 10.3390/molecules28020735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [40].Cardullo N, Barresi V, Muccilli V, Spampinato G, D’Amico M, Condorelli DF, Tringali C, Synthesis of Bisphenol Neolignans Inspired by Honokiol as Antiproliferative Agents, Molecules. 25 (2020) 733. 10.3390/molecules25030733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Sciacca C, Cardullo N, Pulvirenti L, Di Francesco A, Muccilli V, Evaluation of honokiol, magnolol and of a library of new nitrogenated neolignans as pancreatic lipase inhibitors, Bioorg. Chem. 134 (2023) 106455. 10.1016/j.bioorg.2023.106455. [DOI] [PubMed] [Google Scholar]
  • [42].Han H-K, Van Anh LT, Modulation of P-glycoprotein expression by honokiol, magnolol and 4-O-methylhonokiol, the bioactive components of Magnolia officinalis., Anticancer Res. 32 (2012) 4445–52. http://www.ncbi.nlm.nih.gov/pubmed/23060571. [PubMed] [Google Scholar]
  • [43].Yu C-P, Li P-Y, Chen S-Y, Lin S-P, Hou Y-C, Magnolol and Honokiol Inhibited the Function and Expression of BCRP with Mechanism Exploration, Molecules. 26 (2021) 7390. 10.3390/molecules26237390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Frigerio M, Santagostino M, Sputore S, A User-Friendly Entry to 2-Iodoxybenzoic Acid (IBX), J. Org. Chem. 64 (1999) 4537–4538. 10.1021/jo9824596. [DOI] [Google Scholar]
  • [45].Baschieri A, Pulvirenti L, Muccilli V, Amorati R, Tringali C, Chain-breaking antioxidant activity of hydroxylated and methoxylated magnolol derivatives: the role of H-bonds, Org. Biomol. Chem. 15 (2017) 6177–6184. 10.1039/C7OB01195D. [DOI] [PubMed] [Google Scholar]
  • [46].Sun X, Zhu M, Dai Y, Li H-M, Li B, Ma H, Zhang C, Wu C, Semi-Synthesis and In Vitro Anti-Cancer Evaluation of Magnolol Derivatives, Molecules. 26 (2021) 4302. 10.3390/molecules26144302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [47].Jin Y, Yang F, Zhang G, Yu Q, Wang G, Ling F, Liu T, Synthesized Magnolol Derivatives Improve Anti-Micropterus salmoides Rhabdovirus (MSRV) Activity In Vivo, Viruses. 14 (2022) 1421. 10.3390/v14071421. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [48].Fuchs A, Rempel V, Müller CE, The Natural Product Magnolol as a Lead Structure for the Development of Potent Cannabinoid Receptor Agonists, PLoS One. 8 (2013) e77739. 10.1371/journal.pone.0077739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [49].Robey RW, Honjo Y, Morisaki K, Nadjem TA, Runge S, Risbood M, Poruchynsky MS, Bates SE, Mutations at amino-acid 482 in the ABCG2 gene affect substrate and antagonist specificity, Br. J. Cancer. 89 (2003) 1971–1978. 10.1038/sj.bjc.6601370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [50].Cardarelli CO, Aksentijevich I, Pastan I, Gottesman MM, Differential effects of P-glycoprotein inhibitors on NIH3T3 cells transfected with wild-type (G185) or mutant (V185) multidrug transporters., Cancer Res. 55 (1995) 1086–91. http://www.ncbi.nlm.nih.gov/pubmed/7866993. [PubMed] [Google Scholar]
  • [51].Chang X-B, Hou Y-X, Riordan JR, ATPase Activity of Purified Multidrug Resistance-associated Protein, J. Biol. Chem. 272 (1997) 30962–30968. 10.1074/jbc.272.49.30962. [DOI] [PubMed] [Google Scholar]
  • [52].Heo DS, Park JG, Hata K, Day R, Herberman RB, Whiteside TL, Evaluation of tetrazolium-based semiautomatic colorimetric assay for measurement of human antitumor cytotoxicity., Cancer Res. 50 (1990) 3681–90. http://www.ncbi.nlm.nih.gov/pubmed/2340518. [PubMed] [Google Scholar]
  • [53].Pfaffl MW, A new mathematical model for relative quantification in real-time RT-PCR., Nucleic Acids Res. 29 (2001) e45. 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [54].Lemma S, Avnet S, Salerno M, Chano T, Baldini N, Identification and Validation of Housekeeping Genes for Gene Expression Analysis of Cancer Stem Cells, PLoS One. 11 (2016) e0149481. 10.1371/journal.pone.0149481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [55].Jacob F, Guertler R, Naim S, Nixdorf S, Fedier A, Hacker NF, Heinzelmann-Schwarz V, Careful Selection of Reference Genes Is Required for Reliable Performance of RT-qPCR in Human Normal and Cancer Cell Lines, PLoS One. 8 (2013) e59180. 10.1371/journal.pone.0059180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [56].ALI H, DU Z, LI X, YANG Q, ZHANG YC, WU M, LI Y, ZHANG G, Identification of suitable reference genes for gene expression studies using quantitative polymerase chain reaction in lung cancer in vitro, Mol. Med. Rep. 11 (2015) 3767–3773. 10.3892/mmr.2015.3159. [DOI] [PubMed] [Google Scholar]
  • [57].Sharan RN, Vaiphei ST, Nongrum S, Keppen J, Ksoo M, Consensus reference gene(s) for gene expression studies in human cancers: end of the tunnel visible?, Cell. Oncol. (Dordr). 38 (2015) 419–31. 10.1007/s13402-015-0244-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [58].de P Dutra J, Scheiffer G, Kronenberger T, Gomes LJC, Zanzarini I, Dos Santos KK, Tonduru AK, Poso A, de M. Rego FG, Picheth G, Valdameri G, Moure VR, Structural and molecular characterization of lopinavir and ivermectin as breast cancer resistance protein (BCRP/ABCG2) inhibitors., EXCLI J. 22 (2023) 1155–1172. 10.17179/excli2023-6427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [59].Zhang C, Wang Y, Jin G, Wu S, Cui J, Wang R, Selection of reference genes for gene expression studies in human bladder cancer using SYBR-Green quantitative polymerase chain reaction, Oncol. Lett. 14 (2017) 6001–6011. 10.3892/ol.2017.7002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [60].Potashnikova D, Gladkikh A, Vorobjev IA, Selection of superior reference genes’ combination for quantitative real-time PCR in B-cell lymphomas., Ann. Clin. Lab. Sci. 45 (2015) 64–72. http://www.ncbi.nlm.nih.gov/pubmed/25696013. [PubMed] [Google Scholar]
  • [61].Saidova AA, Potashnikova DM, Tvorogova AV, Maly IV, Hofmann WA, Vorobjev IA, Specific and reliable detection of Myosin 1C isoform A by RTqPCR in prostate cancer cells, PeerJ. 6 (2018) e5970. 10.7717/peerj.5970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [62].Ambudkar SV, Drug-stimulatable ATPase activity in crude membranes of human MDR1-transfected mammalian cells., Methods Enzymol. 292 (1998) 504–14. 10.1016/s0076-6879(98)92039-0. [DOI] [PubMed] [Google Scholar]
  • [63].Lusvarghi S, V Ambudkar S, ATP-dependent thermostabilization of human P-glycoprotein (ABCB1) is blocked by modulators, Biochem. J. 476 (2019) 3737–3750. 10.1042/BCJ20190736. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [64].Orlando BJ, Liao M, ABCG2 transports anticancer drugs via a closed-to-open switch., Nat. Commun. 11 (2020) 2264. 10.1038/s41467-020-16155-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [65].Stewart JJP, Optimization of parameters for semiempirical methods V: Modification of NDDO approximations and application to 70 elements, J. Mol. Model. 13 (2007) 1173–1213. 10.1007/s00894-007-0233-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [66].Trott O, Olson AJ, AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading, J. Comput. Chem. 31 (2010) 455–461. 10.1002/jcc.21334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [67].Salentin S, Schreiber S, Haupt VJ, Adasme MF, Schroeder M, PLIP: fully automated protein–ligand interaction profiler, Nucleic Acids Res. 43 (2015) W443–W447. 10.1093/nar/gkv315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [68].Xiong G, Wu Z, Yi J, Fu L, Yang Z, Hsieh C, Yin M, Zeng X, Wu C, Lu A, Chen X, Hou T, Cao D, ADMETlab 2.0: an integrated online platform for accurate and comprehensive predictions of ADMET properties., Nucleic Acids Res. 49 (2021) W5–W14. 10.1093/nar/gkab255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [69].Hall MD, Handley MD, Gottesman MM, Is resistance useless? Multidrug resistance and collateral sensitivity, Trends Pharmacol. Sci. 30 (2009) 546–556. 10.1016/j.tips.2009.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [70].Glavinas H, Kis E, Pál Á, Kovács R, Jani M, Vági E, Molnár É, Bánsághi S, Kele Z, Janáky T, Báthori G, von Richter O, Koomen G-J, Krajcsi P, ABCG2 (Breast Cancer Resistance Protein/Mitoxantrone Resistance-Associated Protein) ATPase Assay: A Useful Tool to Detect Drug-Transporter Interactions, Drug Metab. Dispos. 35 (2007) 1533–1542. 10.1124/dmd.106.014605. [DOI] [PubMed] [Google Scholar]
  • [71].Özvegy C, Litman T, Szakács G, Nagy Z, Bates S, Váradi A, Sarkadi B, Functional Characterization of the Human Multidrug Transporter, ABCG2, Expressed in Insect Cells, Biochem. Biophys. Res. Commun. 285 (2001) 111–117. 10.1006/bbrc.2001.5130. [DOI] [PubMed] [Google Scholar]
  • [72].Senisterra G, Chau I, Vedadi M, Thermal Denaturation Assays in Chemical Biology, Assay Drug Dev. Technol. 10 (2012) 128–136. 10.1089/adt.2011.0390. [DOI] [PubMed] [Google Scholar]
  • [73].Gozzi GJ, Bouaziz Z, Winter E, Daflon-Yunes N, Honorat M, Guragossian N, Marminon C, Valdameri G, Bollacke A, Guillon J, Pinaud N, Marchivie M, Cadena SM, Jose J, Le Borgne M, Di Pietro A, Phenolic indeno[1,2-b]indoles as ABCG2-selective potent and non-toxic inhibitors stimulating basal ATPase activity., Drug Des. Devel. Ther. 9 (2015) 3481–3495. 10.2147/DDDT.S84982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [74].Zattoni IF, Delabio LC, de PDutra J, Kita DH, Scheiffer G, Hembecker M, da S. Pereira G, Moure VR, Valdameri G, Targeting breast cancer resistance protein (BCRP/ABCG2): Functional inhibitors and expression modulators., Eur. J. Med. Chem. 237 (2022) 114346. 10.1016/j.ejmech.2022.114346. [DOI] [PubMed] [Google Scholar]
  • [75].Robey RW, To KKK, Polgar O, Dohse M, Fetsch P, Dean M, Bates SE, ABCG2: A perspective, Adv. Drug Deliv. Rev. 61 (2009) 3–13. 10.1016/j.addr.2008.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [76].Vlaming MLH, Lagas JS, Schinkel AH, Physiological and pharmacological roles of ABCG2 (BCRP): recent findings in Abcg2 knockout mice., Adv. Drug Deliv. Rev. 61 (2009) 14–25. 10.1016/j.addr.2008.08.007. [DOI] [PubMed] [Google Scholar]
  • [77].Teodori E, Dei S, Martelli C, Scapecchi S, Gualtieri F, The Functions and Structure of ABC Transporters: Implications for the Design of New Inhibitors of Pgp and MRP1 to Control Multidrug Resistance (MDR), Curr. Drug Targets. 7 (2006) 893–909. 10.2174/138945006777709520. [DOI] [PubMed] [Google Scholar]
  • [78].Allen JD, Van Loevezijn A, Lakhai JM, Van Der Valk M, Van Tellingen O, Reid G, Schellens JHM, Koomen GJ, Schinkel AH, Potent and specific inhibition of the breast cancer resistance protein multidrug transporter in vitro and in mouse intestine by a novel analogue of fumitremorgin C, Mol. Cancer Ther. 1 (2002) 417–425. [PubMed] [Google Scholar]
  • [79].Weiss J, Rose J, Storch CH, Ketabi-Kiyanvash N, Sauer A, Haefeli WE, Efferth T, Modulation of human BCRP (ABCG2) activity by anti-HIV drugs, J. Antimicrob. Chemother. 59 (2006) 238–245. 10.1093/jac/dkl474. [DOI] [PubMed] [Google Scholar]
  • [80].Allen JD, van Loevezijn A, Lakhai JM, van der Valk M, van Tellingen O, Reid G, Schellens JHM, Koomen G-J, Schinkel AH, Potent and specific inhibition of the breast cancer resistance protein multidrug transporter in vitro and in mouse intestine by a novel analogue of fumitremorgin C., Mol. Cancer Ther. 1 (2002) 417–25. http://www.ncbi.nlm.nih.gov/pubmed/12477054. [PubMed] [Google Scholar]
  • [81].Weidner LD, Zoghbi SS, Lu S, Shukla S, Ambudkar SV, Pike VW, Mulder J, Gottesman MM, Innis RB, Hall MD, The Inhibitor Ko143 Is Not Specific for ABCG2, J. Pharmacol. Exp. Ther. 354 (2015) 384–393. 10.1124/jpet.115.225482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [82].Vesga LC, Kronenberger T, Tonduru AK, Kita DH, Zattoni IF, Bernal CC, Bohórquez ARR, Mendez-Sánchez SC, Ambudkar SV, Valdameri G, Poso A, Tetrahydroquinoline/4,5-Dihydroisoxazole Molecular Hybrids as Inhibitors of Breast Cancer Resistance Protein (BCRP/ABCG2), ChemMedChem. 16 (2021) 2686–2694. 10.1002/cmdc.202100188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [83].Ji N, Yang Y, Lei Z-N, Cai C-Y, Wang J-Q, Gupta P, Xian X, Yang D-H, Kong D, Chen Z-S, Ulixertinib (BVD-523) antagonizes ABCB1- and ABCG2-mediated chemotherapeutic drug resistance, Biochem. Pharmacol. 158 (2018) 274–285. 10.1016/j.bcp.2018.10.028. [DOI] [PubMed] [Google Scholar]
  • [84].Zeng F, Wang F, Zheng Z, Chen Z, Wah To KK, Zhang H, Han Q, Fu L, Rociletinib (CO-1686) enhanced the efficacy of chemotherapeutic agents in ABCG2-overexpressing cancer cells in vitro and in vivo, Acta Pharm. Sin. B. 10 (2020) 799–811. 10.1016/j.apsb.2020.01.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [85].Hegedűs C, Özvegy-Laczka C, Apáti Á, Magócsi M, Német K, Őrfi L, Kéri G, Katona M, Takáts Z, Váradi A, Szakács G, Sarkadi B, Interaction of nilotinib, dasatinib and bosutinib with ABCB1 and ABCG2: implications for altered anti-cancer effects and pharmacological properties, Br. J. Pharmacol. 158 (2009) 1153–1164. 10.1111/j.1476-5381.2009.00383.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [86].Elkind NB, Szentpétery Z, Apáti A, Özvegy-Laczka C, Várady G, Ujhelly O, Szabó K, Homolya L, Váradi A, Buday L, Kéri G, Német K, Sarkadi B, Multidrug Transporter ABCG2 Prevents Tumor Cell Death Induced by the Epidermal Growth Factor Receptor Inhibitor Iressa (ZD1839, Gefitinib), Cancer Res. 65 (2005) 1770–1777. 10.1158/0008-5472.CAN-04-3303. [DOI] [PubMed] [Google Scholar]
  • [87].Telbisz Á, Hegedüs C, Özvegy-Laczka C, Goda K, Várady G, Takáts Z, Szabó E, Sorrentino BP, Váradi A, Sarkadi B, Antibody binding shift assay for rapid screening of drug interactions with the human ABCG2 multidrug transporter, Eur. J. Pharm. Sci. 45 (2012) 101–109. 10.1016/j.ejps.2011.10.021. [DOI] [PubMed] [Google Scholar]
  • [88].Özvegy-Laczka C, Várady G, Köblös G, Ujhelly O, Cervenak J, Schuetz JD, Sorrentino BP, Koomen G-J, Váradi A, Német K, Sarkadi B, Function-dependent Conformational Changes of the ABCG2 Multidrug Transporter Modify Its Interaction with a Monoclonal Antibody on the Cell Surface, J. Biol. Chem. 280 (2005) 4219–4227. 10.1074/jbc.M411338200. [DOI] [PubMed] [Google Scholar]
  • [89].Henrich CJ, Robey RW, Bokesch HR, Bates SE, Shukla S, Ambudkar SV, Dean M, McMahon JB, New inhibitors of ABCG2 identified by high-throughput screening, Mol. Cancer Ther. 6 (2007) 3271–3278. 10.1158/1535-7163.MCT-07-0352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [90].Nagy T, Tóth Á, Telbisz Á, Sarkadi B, Tordai H, Tordai A, Hegedűs T, The transport pathway in the ABCG2 protein and its regulation revealed by molecular dynamics simulations, Cell. Mol. Life Sci. 78 (2021) 2329–2339. 10.1007/s00018-020-03651-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [91].Yang Y, Ji N, Teng Q-X, Cai C-Y, Wang J-Q, Wu Z-X, Lei Z-N, Lusvarghi S, Ambudkar SV, Chen Z-S, Sitravatinib, a Tyrosine Kinase Inhibitor, Inhibits the Transport Function of ABCG2 and Restores Sensitivity to Chemotherapy-Resistant Cancer Cells in vitro., Front. Oncol. 10 (2020) 700. 10.3389/fonc.2020.00700. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [92].Yu Q, Ni D, Kowal J, Manolaridis I, Jackson SM, Stahlberg H, Locher KP, Structures of ABCG2 under turnover conditions reveal a key step in the drug transport mechanism, Nat. Commun. 12 (2021) 4376. 10.1038/s41467-021-24651-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES