SUMMARY
The Bloom Syndrome helicase (BLM) is critical for Alternative Lengthening of Telomeres (ALT), a homology directed repair (HDR) mediated telomere maintenance mechanism that is prevalent in cancers of mesenchymal origin. The DNA substrates that BLM engages to direct telomere recombination during ALT remain unknown. Here, we determine that BLM helicase acts on lagging strand telomere intermediates that occur specifically in ALT positive cells to assemble a replication-associated DNA damage response. Loss of ATRX was permissive for BLM localization to ALT telomeres in S and G2 commensurate with the appearance of telomere C-strand specific single-stranded DNA. DNA2 nuclease deficiency increased 5’-flap formation in a BLM dependent manner, while telomere C-strand, but not G-strand, nicks promoted ALT. These findings define the seminal events in the ALT DNA damage response, linking aberrant telomeric lagging strand DNA replication with a BLM directed HDR mechanism that sustains telomere length in a subset of human cancers.
eTOC Blurb
Jiang & Zhang et al. found BLM helicase promotes alternative lengthening of telomeres (ALT) by unwinding unligated Okazaki fragments to generate 5’-flaps. These events initiate the DNA damage response that underlies homology-directed repair mediated telomere maintenance.
Graphical Abstract

INTRODUCTION
Alternative Lengthening of Telomeres (ALT) is a telomerase independent mechanism of telomere maintenance that is prevalent in cancers of mesenchymal origin1–4. ALT utilizes several different homology-directed repair (HDR) pathways to lengthen telomeres2,5–9. Approximately 10–15% of human cancers exclusively rely on ALT for telomere maintenance10. Telomeres in ALT dependent tumors and cell lines display characteristic features that differentiate them from telomeres in telomerase positive cells, including the presence of extensive single-stranded DNA with 5’-overhangs, colocalization of DNA damage response proteins, and clustered telomeres that associate with PML proteins in subnuclear bodies (ALT-associated PML bodies, APBs) that undergo HDR- mediated DNA synthesis outside of S-phase2,5,9,11–13. These events contribute to telomere lengthening by HDR.
Replication stress and elevated chromosome instability are present in ALT positive cancers11,14. p53 mutations are also frequent in ALT cancers and cell lines, likely as a permissive event to tolerate the high degree of overall genomic instability and DNA damage responses at telomeres11,14. Histone chaperones ATRX and DAXX load histone H3.3 onto telomeres15,16. Loss of either ATRX or DAXX leads to increased expression of the telomere-associated noncoding RNA TERRA, which forms RNA-DNA hybrid R-loops with telomeres that are thought to promote recombination in ALT positive cells17. ATRX or DAXX deficiency frequently occurs in ALT positive cancers, and ATRX loss was shown to promote ALT during immortalization of primary fibroblast cultures and following differentiation of ATRX null pluripotent human stem cells14,18–21. In addition, ATRX loss in combination with telomere damage stimulates telomere clustering and other features of ALT in telomerase positive cells22. Conversely, reintroduction of ATRX suppresses ALT in U2OS cells, reducing telomere clustering, and DNA damage response protein colocalization with telomeres23,24.
Despite the link between ATRX-DAXX deficiency and ALT, little is understood regarding the basis for telomere selective increases in HDR. Extensive telomere recombination in ALT positive cells occurs spontaneously in the absence of exogenous DNA damaging agents11. BLM helicase has been implicated as a key factor in orchestrating the ALT damage response as it is required for telomere length maintenance and telomere clustering into APBs25–29. Telomere DNA double-strand breaks (DSBs) rapidly initiate ALT through a break induced replication- like mechanism that entails loading of the polymerase processivity replication clamp PCNA complex and DNA polymerase δ at damaged telomeres to perform unidirectional HDR telomere synthesis over many kilobases9,30,31. However, telomere DSBs bypass requirements for BLM, suggesting they are unlikely to be the primary source of genomic lesion that attracts the ALT dependent damage response.
Here, we demonstrate that BLM helicase orchestrates the ALT telomere DNA damage response through its helicase dependent genesis of 5’-single-stranded DNA flaps on lagging strand telomeres. The specific association of BLM with ALT telomeres was independent of DSB induction, and instead required loss of ATRX. BLM deficiency eliminated the basal telomere damage response in ALT positive cells commensurate with reductions in 5’-single-stranded DNA on the telomere C-rich strand but not on the G-rich strand. The source of this C-rich single-stranded DNA is 5’-flaps on unligated Okazaki fragments or nicked DNA. These findings implicate BLM helicase activity at lagging strand telomere lesions as the initiating event that orchestrates HDR during ALT.
RESULTS
BLM is required to assemble the ALT telomere DNA damage response
BLM deficiency reduced APBs, non-S phase EdU (5-Ethynyl-2’-deoxyuridine), and RPA2 colocalization with telomeres (Figures S1A–F), and led to telomere shortening in ALT cell lines in long-term cultures (Figure S1G), as expected6,8,25,26,29,32. To investigate how BLM helicase orchestrates telomere HDR during ALT, we purified the telomere-associated proteomes from U2OS cells that expressed CRISPR-Cas9 with sgRNAs targeting BLM (sgBLM) or control (sgCtrl). Telomere proteomes were obtained from three biological replicates using the Proteomics of Isolated Chromatin Segments (PICh) method33 (Figure 1A). Consistent results were observed in each experiment, demonstrating a nearly complete elimination of the BTR (BLM-Topo IIIα-RMI1-RMI2) complex, ATR, Fanconi Anemia (FA), and HDR damage response pathway proteins at U2OS telomeres in BLM deficient cells (Figures 1B and 1C). Approximately 67% reductions in peptide numbers occurred for all three subunits of the trimeric single-stranded DNA binding protein, RPA1-RPA2-RPA3, in agreement with prior reports that BLM deficiency reduces single-stranded DNA at ALT telomeres25–27. Notably Shelterin complex components remained at similar levels in sgCtrl and sgBLM U2OS telomeres (Figure 1C), demonstrating intact telomere protection in the absence of BLM.
Figure 1. BLM helicase is required for assembly of the ALT telomere DNA damage response.

(A) Schematic of Proteomics of Isolated Chromatin segments (PICh) to define the telomere proteome in control (sgRosa) and BLM knockout U2OS cells. Fractionated and pre-cleared chromatin was hybridized to a biotinylated telomeric probe and then captured on magnetic beads. Telomere-associated proteins were analyzed by Western blot and/or mass spectrometry. (B) Scatter plot comparing the telomere-associated proteomes of control and BLM knockout U2OS cells. The x-axis shows the Log2FC (Fold change) (1+ total peptide number of mass spectrometry of sgBLM samples)/(1+ total peptide number of mass spectrometry of sgRosa samples). The y-axis shows the −Log10(p-value) from three independent experiments. (C) Tabulated differences in telomere-associated DNA repair protein in control and BLM knockout U2OS from three independent experiments. Shelterin components are included to verify similar amounts of telomeric chromatin was captured in each replicate. (D) Venn diagram comparing the proteins with Log2FC(U2OS/HeLaS3) > 1 from Zhang. et al.34 or Log2FC(sgBLM/sgRosa) < −1 from the PICh results. The common proteins were selected for the STRING analysis. (E) STRING analysis of the common proteins in (D). The lines between the circles indicate protein interaction, or the proteins are involved in the same complex or the same pathway.
Telomeres in ALT positive cells exhibit a robust baseline replication stress-associated DNA damage response11,13,34. Indeed, plotting of recently reported telomere proteomes reveals enrichment of ATR, FA, and HDR repair factors at ALT positive U2OS telomeres in comparison to telomere-associated proteins in telomerase positive HeLa S3 cells (Figure S2A)34. Interestingly, BLM deficiency converted the telomere damage response proteomes in ALT positive U2OS cells to resemble that of telomeres in undamaged telomerase positive HeLa S3 cells (Figure S2B). U2OS telomere proteomes were significantly enriched for DSB repair, replication fork processing, and other factors associated with HDR compared to either HeLa S3 or BLM deficient U2OS telomeres (Figures 1D, 1E and S2). STRING analyses reveal BLM dependent networks of factors that recognize and resolve replication-associated DNA damage by HDR (Figure 1E). These findings are consistent with a basal, BLM dependent HDR network at telomeres in ALT positive cells.
ATRX deficiency promotes BLM recognition of ALT telomeres in S/G2
Analysis of reported PICh derived telomere proteomes revealed BLM specific association with ALT telomeres (Figure S2A)33,34. Notably, BLM remained absent from telomerase positive telomeres after DSB induction and did not increase at ALT telomeres, indicating that DSBs are not the lesion that attracts BLM to direct ALT34. We confirmed that BLM telomere localization is not stimulated by DSB by PICh coupled with Western blot in U2OS cells following induction of TRF1-FokI nuclease or its nuclease inactive D450A mutant (Figure 2A). We reasoned that ATRX deficiency could account for the specific association between BLM and telomeres in ALT positive cells. In agreement, Doxycycline inducible ATRX expression in U2OS cells diminished BLM localization to ALT telomeres along with reductions in telomere clustering into APBs, RPA2 colocalization, and single-stranded DNA generation assessed by telomere native FISH (also known as ALT-FISH35 (Figures 2B, 2C and S3A–C). Moreover, ATRX depletion by CRISPR/Cas9 in HeLa S3 cells resulted in detectable BLM colocalization with telomeres and increased RPA2 association (Figures 2D, 2E and S3D).
Figure 2. ATRX suppresses BLM recognition of ALT telomeres.

(A) PICh followed by Western blot to detect BLM localization at telomeres in U2OS cells following TRF1-FokI (D450A and WT) induction for 2 hrs. (B, C) Representative IF-FISH images and quantifications of BLM- (B) and RPA2- (C) telomere localization by IF-FISH, in the U2OS cells with/ without adding 400ng/ml doxycycline for 7 days to induce ATRX expression, respectively. The data represent the median (line in the box), 1st to 3rd quartile (box), and the 75th percentile plus 1.5 times interquartile range (IQR) by the top line. The data were from 8 and 6 independent experiments, respectively. (D, E) Representative IF-FISH images and quantifications of BLM- (D) and RPA2- (E) telomere localization in control or ATRX knockout HeLa S3 cells. The colocalization events were indicated by the arrowheads. The data represent the mean and the standard error of the mean (SEM) from 4 independent experiments. The ATRX knockout HeLa S3 cells were generated by a dual CRISPR/Cas9 strategy, which is shown in Figure S3D. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired two-tailed student’s t-test).
Cell cycle dependency of BLM-telomere colocalization was examined in interphase cells using cyclin A positivity as a marker of S/G2 populations (Figure 3A). BLM localization occurred primarily in cyclin A positive S/G2 cells in contrast to cyclin A negative G1 cells with consistent results across five different ALT positive cell lines. This corresponded to the appearance of C-rich single-stranded DNA at telomeres as assessed by native-FISH with Cy3-labeled telomeric G-probe (Figure 3B).
Figure 3. Requirements for BLM telomere recognition and ALT activity.

(A, B) BLM colocalization with telomeres (A) and the generation of C-rich single-stranded DNA (ssTeloC) at telomeres (B) was monitored in cyclin A positive (S/G2) and negative (G1) interphase cells. The data represent the median (line in the box), 1st to 3rd quartile (box), and the 75th percentile plus 1.5 times IQR (Top line). The data were from 4 independent experiments. (C) Schematic of BLM mutants used to determine requirements for BLM telomere recognition and ability to stimulate ALT. (D, E) Colocalization of GFP-tagged BLM (D) or RPA2 (E) and telomeres was quantified in cells expressing WT BLM or indicated mutants. (F) Cells that have at least 2 GFP-BLM positive telomere foci were considered as BLM-Telo colocalization positive cells. RPA2 colocalization with the GFP-BLM positive telomere foci was counted and cells with at least two colocalization events were considered as RPA2-BLM-Telo positive cells. The data in Tukey box plot represent the median (line in the box), 1st to 3rd quartile (box), and the 75th percentile plus 1.5 times IQR (Top line). The data in scatter plot with bar represent the mean and SEM. The data were from 5 independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired two-tailed student’s t-test).
The BLM helicase has several functions in DNA repair and replication that rely on distinct protein-protein interactions. The amino-terminal 133 amino acids of BLM mediate interaction with RMI1, RMI2, and Topo IIIα as the BTR complex, to execute branch migration dependent dissolution of Holliday junction recombination intermediates. This interaction can be disrupted by the mutation of 3 amino acids (lysines 38, 39, and 40 to alanine, “K3A”)36. The BLM N-terminus (amino acid 1 to 641) also interacts with the RPA complex as a critical part of its function in restarting stalled replication forks37. Enzymatic activity is encoded within the carboxy-terminal half and eliminated by mutation of K695 ATPase function38,39.
We mapped the domains in BLM required for telomere localization and ALT using the indicated panel of missense and deletion mutants (Figure 3C and S4A). ATPase inactive BLM K695R mutation severely reduced its telomere localization as well as the generation of single-stranded DNA as assessed by RPA signal at telomeres. Disruption of interaction with RMI1/2 and Topo IIIα in the BTR complex also reduced BLM telomere localization and RPA association with telomeres. Depletion of the N-terminus led to a further decrease of BLM localization at telomere, indicating additional regulators of BLM telomere localization (Figures 3C–E and S4B). Tethering the BLM mutants to telomeres by fusing BLM to shelterin component TRF1 restored RPA accumulation at telomeres, except for the K695R ATPase inactive mutant (Figures S4C and S4D). This indicates the ATPase activity of BLM but not assembly into the BTR complex is essential for the generation of single-stranded telomere DNA. Indeed, quantification of RPA2-telomere colocalization at GFP-BLM positive foci also showed robust RPA2 association at telomeres in the BLM mutants (Figure 3F, K3A and Δ1–133) but not the ATPase mutant. Deletion of the C-terminus removed the nuclear localization signal of BLM and led to cytoplasmic accumulation of GFP-BLMΔC and ΔHRDC+C. Despite a modest reduction of BLM-telomere localization (Figures 3C and 3D), these mutants still showed telomere colocalization possibly because association with other BLM-associated proteins such as the BTR complex can facilitate its nuclear entry26. Interestingly, deletion of the HRDC domain significantly enhanced the RPA2 association at telomere (Figures 3E and 3F). The HRDC domain is required for BLM-dependent double Holliday junction (dHJ) dissolvase activity40. However, HRDC deletion increases BLM ATPase activity in vitro41,42, suggesting the ATPase activity rather than the dissolution function of BLM is essential for the generation of single-stranded DNA at ALT telomere.
BLM helicase increases telomere C-rich single-stranded DNA with 5’ overhangs
We investigated the impact of BLM deficiency on telomere single-stranded DNA using a combination of telomere native FISH35 and Southern blot following one-dimensional (1D) and neutral-neutral two-dimensional (2D) gel electrophoresis. CRISPR deletion of BLM yielded reductions in both G- and C- rich telomere ssDNA by telomere native FISH (Figures 4A, 4B, S5A and S5B). We next probed nondenaturing/native Southern blots with 32P-labeled oligonucleotides that were complementary to the telomere G-rich or C-rich strands. BLM deficiency resulted in a striking decrease in C-rich single-stranded DNA at telomeres that was detected using a 32P-labeled telomeric G-rich probe (Figures 4C and S5C). No reduction in the G-rich single-stranded DNA was observed on the native telomere Southern blots in LM216J or U2OS cells (Figures 4D and S5C). The C-rich telomere single-strand DNA signal from BLM knockout LM216J cells was also nearly absent in 2D telomere Southern blots, with a notable reduction in the arc (dsDNA region) and in the T-complex region that represents telomere recombination intermediates in ALT positive cells34,43,44 (Figures 4E and 4F). In contrast, G-rich single-stranded DNA remained present at similar levels in the arc region of BLM depleted LM216J cells but was reduced at the T-complex region (Figures 4E and 4F). This indicates that BLM primarily affects the presence of C-rich single-stranded DNA in unrecombined telomeres, whereas the reductions in G-rich single-stranded DNA (Figures 4A–F and S5A–C) occur due to the loss of recombination in BLM deficient cells. In agreement, G-rich single-stranded DNA was diminished only at the top of the loading well on 1D Southern blots (Figure 4D), which likely represents the complex intermediates that migrate slowly into the gel. We next incubated genomic DNA from control or BLM deficient LM216J cells with either E. coli ExoI (3’-exonuclease) or with RecJf (5’-exonuclease). RecJf markedly reduced C-rich single-stranded DNA in control cells whereas E. coli ExoI had a minimal effect (Figure 4G and S5D). This indicates that BLM is required for the formation of 5’-single-stranded telomere overhangs, which are characteristic of ALT cells12,45.
Figure 4. BLM is required for the generation of 5’-C-rich single-stranded DNA at ALT telomeres.

(A, B) Representative telomere native FISH images and quantification of telomere native FISH in control (sgRosa) and BLM knockout LM216J cells. Single-stranded telomeric C-rich (A, ssTeloC) or G-rich (B, ssTeloG) DNA was recognized by Cy3-conjugated telomeric G-probe and C-probe, respectively. Two sgRNAs (#6, #7) were used separately to knockout BLM. The data represent the mean and SEM from 4 independent experiments. (C, D) Genomic DNA purified from control and BLM knockout LM216J cells were treated with HinfI and RsaI and subjected to Southern blot under native and denatured conditions. The data in scatter plot with bar represent the mean and SEM of the relative intensity of the native signal compared to the denatured signal from 6 independent experiments. (E) Schematic showing telomeric linear double-stranded DNA, circular DNA, and recombination intermediates in a 2D agarose gel. (F) 2D agarose gel electrophoresis of purified genomic DNA treated with HinfI and RsaI in control and BLM knockout LM216J cells that separates recombination intermediates with linear DNA. (G) Southern blot of purified genomic DNA treated with HinfI and RsaI are subjected to nuclease digestion using either E. coli Exonuclease I (ExoI) (3’-5’ exonuclease) or RecJf (5’-3’ exonuclease) at 37 °C for 2 hrs. For all the Southern blot, either 32P-labeled telomeric G-probe or C-probe was used as indicated. **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired two-tailed student’s t-test).
The specific requirement of BLM for the C-rich strand suggests an asymmetry in how BLM generates single-stranded DNA. Notably, 5’-flap DNA is generated on C-rich strand Okazaki fragments during lagging strand synthesis due to unidirectional telomere replication that originates in subtelomeric DNA46. Flap removal involves 5’-flap endonucleases FEN1 and DNA247. We had previously observed increased telomere single-stranded C-rich DNA in DNA2 depleted U2OS cells34. To determine if BLM could act on these unprocessed substrates, we deleted DNA2 using three independent CRISPR sgRNAs in ALT positive LM216J cells (Figure 5A). In control cells, DNA2 loss strongly increased telomere ssDNA as assessed by RPA2 localization and telomere clustering (Figures 5B and 5C). Notably, BLM depletion compromised the RPA2 localization and telomere clustering that are induced by DNA2 loss (Figures 5B and 5C). Accordingly, BLM deficiency prevented the increased ALT-associated telomere synthesis in DNA2-depleted LM216J cells (Figure 5D), suggesting that BLM acts upstream of DNA2 during ALT.
Figure 5. BLM helicase activity creates 5’-flap DNA substrates for DNA2 during ALT.

(A) Western blot verifying depletion of BLM and DNA2 protein by CRISPR/Cas9 in LM216J cells. (B, C) Representative IF-FISH images and quantification of RPA2 at telomere upon DNA2 knockout in WT and BLM knockout LM216J cells. The data represent the mean and SEM from 3 independent experiments. (D) Quantification of non-S phase EdU incorporation at telomere upon DNA2 knockout in WT and BLM knockout LM216J cells. The data represent the mean and SEM from 4 independent experiments. (E) Southern blot of HinfI and RsaI treated genomic DNA from control and BLM knockout LM216J cells with or without treatment of 2.5 nM recombinant WT or nuclease-dead (D277A) DNA2 at 37 °C for 2 hrs. (F) HinfI and RsaI treated genomic DNA from indicated U2OS cell lines were further incubated with recombinant BLM or helicase inactivated (K695R) BLM and DNA2, then subjected to Southern Blot with either 32P-labeled telomeric G-probe (Left) or C-probe (Right). **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired two-tailed student’s t-test).
We next determined if recombinant DNA2 protein could specifically reduce 5’-C-rich telomere ssDNA on native Southern blots. Genomic DNA was isolated from control or BLM-depleted LM216J cells and incubated with recombinant DNA2 following restriction enzymes digestion (Figure 5E). This treatment with recombinant DNA2, but not its nuclease inactive mutant (D277A), reduced telomeric C-rich ssDNA in the control cell, while left telomeric G-strand DNA levels unaffected. Telomere C-rich ssDNA in sgBLM-expressing cells was strongly reduced at baseline and showed minimal further reductions with DNA2 incubation (Figure 5E). We then determined if BLM helicase activity could generate telomeric 5’-C-rich single-stranded flap substrates for recombinant DNA2 on isolated genomic DNA. Purified genomic DNA was incubated with recombinant wild-type (WT) BLM or the BLM K695R ATPase/helicase inactive mutant following restriction enzymes digestion (Figures 5F and S6), and telomere single-stranded DNA was detected by native Southern blot. Recombinant WT BLM, but not the helicase inactive mutant, increased C-rich single-stranded telomere DNA isolated from either BLM proficient or deficient LM216J cells but not the telomerase positive HeLa S3 cells (Figures 5F and S6). Notably, incubation with recombinant DNA2 reduced the BLM helicase dependent C-rich single-stranded DNA signal but did not affect the G-rich telomere ssDNA signal (Figure 5F). Collectively, this reveals a hierarchical relationship of BLM-dependent generation of a 5’-flap substrate for cleavage by DNA2. The balance of these activities regulates the level of C-rich single-stranded DNA and HDR at ALT telomeres.
BLM acts specifically at nicks in the telomeric C-rich strand to induce ALT
Telomere DSBs induced by either TRF1-FokI or Cas9 elicit a process termed Break-Induced Telomere Synthesis that recapitulates many of the features of ALT9,30,31,48. However, telomere DSB induction bypasses requirements for BLM, suggesting that it is not the endogenous substrate for BLM directed HDR (Figure 2A). Given the BLM dependent increases in C-rich single-stranded DNA at lagging strand telomeres, we sought to understand if BLM actions at these lesions could promote ALT. In principle, BLM would act differentially at C- vs. G-rich telomere single-stranded nicks to affect telomere HDR and ALT. We designed sgRNAs that would be used in combination with the Cas9 D10 and H480 mutations that introduce single-strand nicks rather than DSBs in U2OS cells (Figures 6A and 6B). C-rich strand specific nicks produced by a sgRNA targeting telomeres and the D10A nickase increased BLM at telomeres, while G-rich strand specific nicks by H840A or WT Cas9-induced DSBs yielded similar levels of BLM association as the dCas9 nuclease inactive control and the scramble sgRNA (Figures 6C and 6D). Moreover, D10A nickase strongly stimulated telomeric C-rich single-stranded DNA, telomere lengthening and telomere length heterogeneity in contrast to other CRISPR/Cas9 constructions (Figures 6E and 6F).
Figure 6. Telomeric C-strand nicks initiate BLM telomere recognition and ALT.

(A) Schematic of CRISPR/Cas9 nickases. sgTelo is used to target the telomere C-rich sequence. In this context, WT Cas9 generates double strand breaks; Cas9 D10A mutant cleaves “targeting strand” (C-strand); H840A mutant cleaves “non-targeting strand” (G-strand); while dCas9 (catalytically dead Cas9) does not cleave DNA. (B) Western blot of U2OS cells expressing indicated sgRNA and Cas9 protein. (C, D) Representative IF-FISH images (C) and quantification (D) of BLM-telomere colocalization in U2OS cells expressing the indicated sgRNAs and Cas9 proteins. The data represent the mean and SEM from 4 independent experiments. (E) Genomic DNA purified from cells expressing indicated sgRNA and Cas9 were digested with HinfI and RsaI and subjected to Southern blot under native and denatured conditions with 32P-labeled telomeric G-probe. The data in scatter plot with bar represent the mean and SEM from 5 independent experiments. (F) TRF assay showing telomere length from cells expressing indicated sgRNA and Cas9 protein with 32P-labeled telomeric C-probe. (G, H) Representative IF-FISH images (G) and quantification (H) of ADP-ribose-telomere colocalization in U2OS cells expressing indicated sgRNA and Cas9 protein. The data represent the mean and SEM from 4 independent experiments. SCR, scrambled sgRNA. dCas9, catalytically dead Cas9. ns: p > 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired two-tailed student’s t-test).
PARP1 and PARP2-dependent PARylation arises at single- and double-stranded DNA breaks. It also primarily occurs at unligated Okazaki fragments in undamaged cells49,50. Interestingly, PARylation on C-strand specific nicks was increased in comparison to G-strand nicks (Figures 6G and 6H), raising the possibility that processing of the Cas9 nickase induced single-strand breaks on the C-strand accounts for this difference. To determine if these observations were representative of BLM activity at lagging strand telomeres, we monitored PARylation at telomeres and its colocalization with PCNA (Figures 7A–C). This revealed that telomere-associated PARylation during replication also required BLM activity (Figures 7A–C), while conversely, DNA2 loss dramatically increased telomere-associated PARylation during replication and was suppressed by BLM knockout in LM216J cells (Figures 7D and 7E). These findings support a model that lagging strand replication-associated nicks on telomere C-rich DNA represent the substrates that BLM acts on to assemble the ALT DNA damage response (Figure 7F).
Figure 7. BLM promotes a replication-associated ALT telomere damage response.

(A-C) Representative IF-FISH images of PCNA and ADP-ribose-telomere colocalization (A), quantification of ADP-ribose levels at telomere (B), and quantification of PCNA colocalization with ADP-ribose-telomere (C) in WT and BLM knockout LM216J cells. The data represent the mean and SEM from 4 independent experiments. (D, E) Representative IF-FISH images (D) and quantification (E) of ADP-ribose levels at telomeres upon DNA2 and BLM double knockout in LM216J cells. The data represent the median (line in the box), 1st to 3rd quartile (box), and the 75th percentile plus 1.5 times IQR (Top line) from 4 independent experiments. (F) Model. Inefficient Okazaki fragment maturation at lagging strand ALT telomeres provides DNA nicks/gaps as substrates for BLM recognition. BLM helicase activity on these lagging strand substrates generates telomeric C-rich strand 5’-flaps during strand displacement DNA synthesis by the replisome (indicated by Polδ-PCNA). The telomeric C-rich 5’-flaps induce replication-associated DNA damage responses to promote ALT-associated HDR. **p < 0.01, ***p < 0.001, ****p < 0.0001 (Unpaired two-tailed student’s t-test).
DISCUSSION
An extensive telomere-associated DNA damage response in unperturbed ALT-positive cells suggest the presence of endogenous lesions that elicit HDR-dependent telomere maintenance. ATRX deficiency and BLM helicase activity were known drivers of ALT. However, the nature of the DNA substrate that BLM acts on to direct ALT and its dependency on ATRX loss was undefined. Additionally, it was unclear how BLM helicase activity directs the necessary assembly of a damage response to promote ALT. Our findings provide details underlying many of these knowledge gaps. BLM recognizes single-stranded nicks on the C-rich telomere strand and acts on these lesions to promote 5’-flap formation. These substrates are increased at telomeres in ATRX deficient cells during S-phase. These findings support a model that BLM helicase acts on nicks/gaps in the C-rich telomere strand to generate 5’- single strand flaps that seed an extensive replication stress-associated damage response during ALT.
How ATRX deficiency leads to the genesis of this BLM specific telomere substrate remains unclear and an important area for future investigation given its causal role in ALT. ATRX binds to G-rich DNA to suppress G4-quadruplex structures51. ATRX deficiency may impede DNA replication, causing aberrant Okazaki fragment maturation and nicks/gaps in the C-strand that attract BLM. It is also unclear how the ensuing BLM-dependent damage response mediates ALT. BLM plays several important roles in telomere integrity in both ALT and telomerase positive cells. It escorts telomere replication by suppressing G4 structures at both the leading strand and the template of the lagging strand52,53. An interesting distinction is the ALT specific phenomenon of BLM dependent elevations in C-rich 5’-flaps. ALT represents a gain of function, non-canonical HDR mechanism that substantially differs from classical homologous recombination. BLM appears to promote a DNA damage response that is dominated by replication-associated factors that recognize single-stranded DNA, including ATR and FA proteins (Figures 1 and S2). Such factors mediate DNA strand annealing type HDR when single-stranded homology donors are employed in CRISPR/Cas9 experimental settings. Type II survivors in yeast are also thought to use annealing-mediated recombination for HDR synthesis54. We speculate similar mechanisms exist in human cells that utilize ALT following a BLM-directed single-stranded DNA damage response.
Our findings provide a framework to systematically address the question of BLM-dependent telomere recombination during ALT. BLM ATPase and helicase activities were required for ALT as was its amino-terminus, which was necessary for telomere recognition. Interestingly, interaction with the BTR complex was dispensable as was its HRDC domain, suggesting that dHJ dissolution is not a critical BLM function in generating telomere single-stranded DNA. Instead, BLM uses its DNA motor activities to generate substrates for DNA2 endonuclease activity, which in turn limits ALT recombination. In addition to BLM helicase activity, SUMOylation may also play an important role in directing ALT. Targeting SUMO interacting motifs (SIM domains) to telomeres through a TRF1-SIM interaction enacted telomere clustering specifically in ALT cells independent of the DNA damage response55. BLM may play a critical role in ALT through a combination of its helicase activity and via its known modification by SUMO25–27.
Aberrations in lagging strand synthesis activate PARP enzymes through recognition of unligated Okazaki fragments and are responsible for the majority of chromatin associated PARylation in replicating cells49,50. PARP inhibition is proposed to trap PARP1 and PARP2 at such endogenous lesions as the underlying basis for synthetic lethality in homologous recombination deficient cells. Interestingly, PARylation is abundant at telomeres in ALT positive cells and PARP inhibition has been reported to increase ALT activity56. ALT positive cells are also suggested to have aberrations in lagging strand telomere synthesis57. Our findings link inefficiencies in Okazaki fragment maturation to BLM-dependent ALT telomere recombination and implicate opposing functions of BLM helicase and DNA2 endonuclease activities on their steady-state levels.
Data mining on the Cancer Dependency Map (DepMap) Portal revealed that ALT cells are hypersensitive to replication stress and highlighted 14 genes that are preferentially essential in ALT cell lines58. Eleven out of the fourteen genes relied on BLM for localization at ALT telomeres (Figure S7). The BLM dependency of this response may indicate hierarchical events that determine the survival of ALT cells. FANCM deficiency is lethal specifically in ALT positive cells58–60. This occurs concomitantly with an increase in ALT activity and the generation of excessive extrachromosomal telomeres that are thought to arise from nucleolytic cleavage of telomere recombination intermediates. BLM deficiency restores viability upon FANCM loss59 in ALT positive cells, predicting that BLM loss would be a resistance mechanism to inhibitors of FANCM. We observed complete BLM dependency for FANCM or SMARCAL1 telomere association in PICh experiments (Figures 1B, 1C and S7). A parsimonious explanation is that ATRX deficiency increases the abundance of ALT telomere-specific lesions that attract a BLM helicase-dependent DNA damage response that executes ALT. We propose that FANCM and SMARCAL1 are required to prevent the accumulation of complex BLM-dependent recombination intermediates that become toxic in their absence. Deficiency in either FANCM or SMARCAL1 would lead to compensatory nucleolytic resolution of unresolved telomere recombination intermediates and cell death due to rampant genomic instability. How these BLM-dependent intermediates arise and what constitutes their unique dependencies on FANCM and SMARCAL1 will be an important question for future study.
Limitations of the Study
Our findings reveal that BLM helicase acts on unligated Okazaki fragment intermediates during lagging strand telomere synthesis to generate long 5’-flaps that seeds the ALT telomere DNA damage response. ATRX deficiency, a hallmark of ALT reliant cells, stimulated BLM recruitment to telomeres. A logical extension of these findings is that ATRX loss impairs Okazaki fragment maturation at telomeres. However, we have not formally tested this possibility. Therefore, how ATRX deficiency affects BLM telomere recruitment to telomeres is a subject for future investigation. We also propose that BLM generates complex recombination intermediates by producing C-rich 5’-flaps, which in turn initiate a DNA damage response. Indeed, BLM is required for the formation of telomere recombination intermediates and for telomere association. We do not currently know the structure of these putative BLM dependent intermediates. A deeper understanding of the structure of BLM-dependent recombination intermediates will be necessary to definitively test the proposed models.
STAR★Methods
RESOURCE AVAILABILITY
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Roger A. Greenberg (rogergr@pennmedicine.upenn.edu).
Materials availability
All cell lines and DNA constructs generated in this study will be made available upon request.
Data and code availability
PICh, Western blot, Southern blot, and immunofluorescence quantification raw data have been deposited at Mendeley and are publicly available as of the date of publication. The DOI is listed in the key resources table.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| BLM | Bethyl Laboratories | Cat No. A300-110A-M; RRID:AB_2779016 |
| Poly/Mono-ADP Ribose | Cell Signaling Technology | Cat No. 83732; RRID:AB_2749858 |
| PCNA | Cell Signaling Technology | Cat No. 2586S; RRID:AB_2160343 |
| Anti-phospho-Histone H2A.X (Ser139) Antibody | EMD Millipore | Cat No. 05-636-I; RRID:AB_2755003 |
| PML | Santa Cruz Biotechnology | Cat No. sc-966; RRID:AB_628162 |
| GFP | Thermo Fisher Scientific | Cat No. A-11122; RRID:AB_221569 |
| Cyclin A | Santa Cruz Biotechnology | Cat No. sc-271682; RRID:AB_10709300 |
| GAPDH | Cell Signaling Technology | Cat No. 2118S; RRID:AB_561053 |
| mCherry | Abcam | Cat No. ab183628; RRID:AB_2650480 |
| DNA2 | Abcam | Cat No. ab96488; RRID:AB_10677769 |
| RPA2 (Anti-RPA, clone RPA34-20) | EMD Millipore | Cat No. MABE285; RRID:AB_11213221 |
| α-Tubulin | Developmental Studies Hybridoma Bank | Cat No. 12G10; RRID:AB_528498 |
| KU86 (H-300) | Santa Cruz Biotechnology | Cat No. sc-9034; RRID:AB_2218743 |
| β-Actin | Santa Cruz Biotechnology | Cat No. sc-47778; RRID:AB_626632 |
| TRF1 | GeneTex | Cat No. GTX70304; RRID:AB_377594 |
| ATRX | Santa Cruz Biotechnology | Cat No. sc-15408; RRID:AB_2061023 |
| ATRX | Santa Cruz Biotechnology | Cat No. sc-55584; RRID:AB_831012 |
| Cas9 | Epigentek | Cat No. A9000-050; RRID:AB_2828022 |
| Bacterial and Virus Strains | ||
| DH10Bac | Invitrogen | 10361012 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Puromycin | Thermo Fisher | A1113803 |
| Hygromycin | Invivogen | ant-hg-1 |
| G418 Sulfate | Thermo Fisher Scientific | 11811031 |
| Blasticidin | Invivogen | ant-bl-1 |
| Polyethylenimine | Polysciences | 23966 |
| polybrene | Sigma-Aldrich | H9268 |
| RO-3306 | Selleck Chemicals | S7747 |
| Q5 Site-Directed Mutagenesis Kit | New England Biolabs | E0554S |
| NEBuilder® HiFi DNA Assembly Master Mix | New England Biolabs | E2621S |
| Avalanche®-Omni Transfection Reagent | EZ Biosystems | EZTOMNI-1 |
| Formaldehyde solution | Sigma-Aldrich | 252549 |
| RNAseA | Qiagen | 19101 |
| RNase H | New England Biolabs | M0297L |
| RsaI | New England Biolabs | R0167L |
| HinfI | New England Biolabs | R0155S |
| BsmBI-v2 | New England Biolabs | R0739S |
| Streptavidin Agarose | EMD Millipore | 69203-3 |
| Sephacryl S-400 HR column | GE Healthcare Life Sciences | 17060901 |
| Dynabeads™ MyOne™ Streptavidin C1 | Thermo Fisher Scientific | 65002 |
| D-biotin | Invitrogen | B20656 |
| poly-L-Lysine | Sigma-Aldrich | P4832 |
| PDD00017273 | Tocris | 59-521-0 |
| Click-iT EdU Cell Proliferation Kit | Thermo Scientific | C10337 |
| DAPI | Sigma-Aldrich | D9542 |
| ProLong Gold Antifade Mountant | Thermo Scientific | P36934 |
| cOmplete protein inhibitor cocktail | Roche | 11873580001 |
| Benzonase | EMD Millipore | 70746 |
| Protein Assay Dye Reagent | Bio-Rad | 5000006 |
| Western Lightning Plus-ECL | Perkins Elmer | NEL105001EA |
| Restore Western Blot Stripping Buffer | Thermo Fisher Scientific | 21059 |
| DNeasy Blood & Tissue Kit | Qiagen | 69506 |
| Qubit™ dsDNA Quantification Assay Kits | Thermo Fisher Scientific | Q32851 |
| Pulse field certified agarose | BioRad | 1620137 |
| Wizard Genomic DNA Purification Kit | Promega | A1120 |
| protease K | Qiagen | 19133 |
| TelC-Cy3 | PNA Bio | F1002 |
| TelG-Cy3 | PNA Bio | F1006 |
| Deposited Data | ||
| PICh of TRF1-Fork1D450A expressing U2OS vs HelaS3 | Zhang et al.34 | N/A |
| PICh of sgRosa vs sgBLM U2OS | This Paper | DOI: 10.17632/hbm2k47rnx.1 |
| Uncropped Images | This Paper | DOI: 10.17632/hbm2k47rnx.1 |
| Immunofluorescence quantification raw data | This Paper | DOI: 10.17632/hbm2k47rnx.1 |
| Experimental Models: Cell Lines | ||
| U2OS | ATCC | HTB-96 |
| LM216J | Dilley et al.9 | N/A |
| GM847 | Dilley et al.9 | N/A |
| WI-38 VA13 | ATCC | CCL-75.1 |
| HelaS3 | ATCC | CCL-2.2 |
| HEK293T | ATCC | CRL-3216 |
| Oligonucleotides | ||
| sgRosa sequence, see Method details | Zhang et al.34 | N/A |
| sgBLM sequence, see Method details | This paper | N/A |
| sgDNA2 sequence, see Method details | Zhang et al.34 | N/A |
| sgATRX sequence, see Method details | This paper | N/A |
| sgSCR sequence, see Method details | Zhang et al.45 | N/A |
| sgTelo sequence, see Method details | Zhang et al.45 | N/A |
| Primers for GFP-BLM cloning, see Method details | This paper | N/A |
| Primers for BLM-mCherry-TRF1 cloning, see Method details | This paper | N/A |
| Recombinant DNA | ||
| pLenti CMV TRE3G Puro FLAG-DD-ER-mCherry-TRF1-FokI WT | Dilley et al.9 | N/A |
| pLenti CMV TRE3G Puro FLAG-DD-ER-mCherry-TRF1-FokI D450A | Dilley et al.9 | N/A |
| GFP-BLM | Addgene | 80070 |
| GFP-BLM-EV | This paper | N/A |
| GFP-BLM-K3A | This paper | N/A |
| GFP-BLM-Δ133 | This paper | N/A |
| GFP-BLM-ΔN | This paper | N/A |
| GFP-BLM-ΔC | This paper | N/A |
| GFP-BLM-ΔHRDC+C | This paper | N/A |
| plenti-CMV-BSD | Addgene | 17486 |
| plenti-CMV-BLM-mCherry-TRF1-BSD | This paper | N/A |
| plenti-CMV-BLMK695R-mCherry-TRF1-BSD | This paper | N/A |
| plenti-CMV-BLMK3A-mCherry-TRF1-BSD | This paper | N/A |
| plenti-CMV-BLMΔ133-mCherry-TRF1-BSD | This paper | N/A |
| plenti-CMV-BLMΔN-mCherry-TRF1-BSD | This paper | N/A |
| lenti-SpCas9-hygro | Addgene | 104995 |
| lentiGuide-Puro | Addgene | 52963 |
| lentiGuide-sgRosa-Puro | This paper | N/A |
| lentiGuide-sgBLM#6-Puro | This paper | N/A |
| lentiGuide-sgBLM#7-Puro | This paper | N/A |
| lentiGuide-GFP | Addgene | 104374 |
| lentiGuide-sgRosa-GFP | This paper | N/A |
| lentiGuide-sgBLM#6-GFP | This paper | N/A |
| lentiGuide-sgBLM#7-GFP | This paper | N/A |
| lentiCRISPRv2-blast | Addgene | 98293 |
| lentiCRISPRv2-sgRosa-blast | This paper | N/A |
| lentiCRISPRv2-sgDNA2#7-blast | This paper | N/A |
| lentiCRISPRv2-sgDNA2#8-blast | This paper | N/A |
| lentiCRISPRv2-sgDNA2#9-blast | This paper | N/A |
| lentiSaCas9-sgRosa-neo | This paper | N/A |
| lentiSaCas9-sgATRX#2-neo | This paper | N/A |
| lentiCRISPRV2-sgRosa-hygro | This paper | N/A |
| lentiCRISPRV2-sgATRX#1-hygro | This paper | N/A |
| lentiCRISPRV2-sgATRX#11-hygro | This paper | N/A |
| pMD2.G | Addgene | 12259 |
| psPAX2 | Addgene | 12260 |
| Software and Algorithms | ||
| Image J | NIH | https://imagej.nih.gov/ij/ |
| Graphpad Prism 9 | GraphPad software Inc. | https://www.graphpad.com/ |
| Nikon NIS-Elements | Nikon | https://www.microscope.healthcare.nikon.com/products/software/nis-elements |
| EPSON Scan | EPSON | https://www.epson.com/usa |
| Cell Profiler | Broad Institute | https://cellprofiler.org/ |
| Snapgene | Snapgene | https://www.snapgene.com/ |
EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS
Cell lines
U2OS, HeLa S3, HEK 293T cell lines were grown in DMEM (Thermo Fisher) with 10% calf serum (Thermo Fisher) and 1% Penicillin/ Streptomycin (Thermo Fisher). VA13, GM847, LM216J, IIICF E6/E7 cell lines were grown in DMEM (Thermo Fisher) with 10% FBS (Bio-Techne) and 1% Penicillin/Streptomycin (Thermo Fisher). Cell lines were cultured in an incubator at 37°C and 5% CO2. Mycoplasma contaminations were tested to be negative using MycoAlert Plus Mycoplasma Detection Kit (Lonza).
METHOD DETAILS
Cloning and transient transfection
The BLM mutants were constructed by PCR mediated mutagenesis using Q5® Site-Directed Mutagenesis Kit (New England Biolabs, E0554S) or NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, E2621S) and the GFP-BLM (a gift from Nathan Ellis, Addgene plasmid #80070) as the template. Plasmid sequences were confirmed by whole plasmid sequencing (Plasmidsaurus). The PCR primers are listed as follows:
HJBLMmutBTR_FWD: 5’-TGCTACATCTTCAGATAACAATGTATC-3’
HJBLMmutBTR_REV: 5’-GCAGCAAAAGTGAAACCTGAAAATTTTG-3’
HJBLMK695R_FWD: 5’-TGGAGGTGGTAGAAGTTTGTGTTAC-3’
HJBLMK695_REV: 5’-GTCGGCATCAGGATAAAAC-3’
GBLMD133_FWD: 5’-ACTGCTCTCAAGAAATTAG-3’
GBLM1_REV: 5’-TCTACCCTCGATCTCG-3’
GBLMD641_FWD: 5’-GAGCGTTTCCAAAGTC-3’
GBLM1417FWD: 5’-TAACAACCGAATCTCAATG-3’
GBLMd1207_REV: 5’-TGCTACTAACGCTTTTTG-3’
GBLMd1291_REV: 5’-CGATGTCCATTCAGAG-3’
GB_BLMsg7RN _FWD: 5’-TACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTC-3’
GB_BLMsg7RN _REV: 5’-CCATTGTATCGCACTCTCGCCTGGAGAGGC-3’
GB_BLMsg7RC_ FWD: 5’-GCGAGAGTGCGATACAATGGCTGACACGTTACAG-3’
GB_BLMsg7RC_ REV: 5’-CCGGTGGATCCCGGGCCCGCGGTACCGTCGAGTTTTTTTTTTTTTTTTTTTG-3’
GBLMemp_FWD: 5’-TAACAACCGAATCTCAATG-3’
GBLMemp_REV: 5’-TCTACCCTCGATCTCG-3’
Plasmids expressing BLM-TRF1 fusion protein were constructed by assembling BLM (or mutants) fragments with mCherry-TRF1 fragments generated from pLVX-Ptuner-mCherry-TRF1-FokI and cloned into the pLenti CMV Blast (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid #17486) vector using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs,E2621s) or through PCR mediated mutagenesis using Q5® Site-Directed Mutagenesis Kit (New England Biolabs, E0554S). Plasmid sequences were confirmed by whole plasmid sequencing (Plasmidsaurus). The PCR primers or synthesized DNA fragments are listed as follows:
BLM_N_ FWD: 5’-CACCATGGGAACCAATTCAGATGGCTGCTGTTCCTCAAAATAATC-3’
BLM_N_REV: 5’-CTATTGGCTCCTGATGTCGCTTGAGAAGTATGTGAGGCTG-3’
BLM_mCheTRF1C_FWD: 5’-GCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAG-3’
BLM_mCheTRF1C_REV: 5’-CGGCCGCGAATTCGGTACCGTTAGTCTTCGCTGTCTGAGGAAATCAG-3’
LinkerFrag (synthesized): 5’-GCGACATCAGGAGCCAATAGCAAATTGGGGATTATGGCTCCACCGAAGCCTATAAATAGACCGTTTCTTAAGCCTTCATATGCATTCTCAGGAGGGAGCGGGGGAGGCTCTGGCGGATCCGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAG-3’
BLMmutBTR_ FWD: 5’-TGCTACATCTTCAGATAACAATGTATC-3’
BLMmutBTR_REV: 5’-GCAGCAAAAGTGAAACCTGAAAATTTTG-3’
BLMmutK695R_FWD: 5’-TGGAGGTGGTAGAAGTTTGTGTTAC-3’
BLMmutK695_REV: 5’-GTCGGCATCAGGATAAAAC-3’
BLMmut1417_ FWD: 5’-ACGCGTGTGAGCAAGGGC-3’
BLMmutd12071417_ REV: 5’-TGCTACTAACGCTTTTTGTTTTTTCACAC-3’
BLMmutd12911417_ REV: 5’-CGATGTCCATTCAGAGTATTTCTGTAATACTG-3’
mCherryMluI_FWD: 5’-ACGCGTGTGAGCAAGGGCGAGGAG-3’
pLentiCMVMulI_REV: 5’-CATCTGAATTGGTTCCCATGGTG-3’
MluIBLMWT_FWD: 5’-ATGGGAACCAATTCAGATGACGCGTATGGCTGCTGTTCCTCAA-3’
MluIBLMWT_REV: 5’-CCTCCTCGCCCTTGCTCACACGCGTTGAGAATGCATATGAAGGCTTAAG-3’
MluIBLMd1–133_FWD: 5’-ATGGGAACCAATTCAGATGACGCGTACTGCTCTCAAGAAATTAGAATTT-3’
MluIBLMd1–641_FWD: 5’-ATGGGAACCAATTCAGATGACGCGTGAGCGTTTCCAAAGTCTTAG-3’
HJBLMSg7RFrag1_FWD: 5’-GCCCGACTACGCCGGAGGACATGGCTGCTGTTCCTCAAAATAATC-3’
HJBLMSg7RFrag1_REV: 5’-CCATTGTATCGCACTCTCGCCTGGAGAGGC-3’
HJBLMSg7RFrag2_FWD: 5’-GCGAGAGTGCGATACAATGGCTGACACGTTACAG-3’
HJBLMSg7RFrag2_REV: 5’-GTCGAGCGGCCGCCACTGTGTTATGAGAATGCATATGAAGG-3’
The constructs were transiently transfected into target cell lines with Avalanche®-Omni Transfection Reagent (EZT-OMNI-1) according to the manufacture’s instruction.
CRISPR/Cas9 mediated gene deletions, lentivirus generation and transduction
SpCas9 was expressed with lenti-SpCas9-hygro (a gift from Brett Stringer, Addgene plasmid # 104995), while sgRNAs targeting candidate genes of interest were generated with lentiGuide-neo34 or lentiGuide-Puro (a gift from Feng Zhang, Addgene plasmid #52963) or lentiGuide-GFP (a gift from Richard Young, Addgene plasmid #104374). For U2OS cells, three BLM knockout clones expressing sgRNA#7 were isolated and validated. For LM216J cells, two individual sgRNAs (#6, #7) were used separately to knockout BLM. For BLM and DNA2 double knockout, BLM and DNA2 were sequentially knocked out with sgRNA cloned into the lentiGuide-GFP (Addgene plasmid #104374) vector and lentiCRISPRv2-blast (a gift from Brett Stringer, Addgene plasmid #98293) vector, respectively. SaCas9 and the sgRNAs targeting ATRX were cloned into a SaCas9 all-in-one vector as described61. The sgRNAs targeting telomere was cloned as described45. In brief, the vectors were digested with BsmBI-v2 (New England Biolabs, R0739S) and ligated with annealed sgRNA oligos. sgRNA sequences were listed as follows:
sgRosa26_FWD: 5’-CACCGGAAGATGGGCGGGAGTCTTC-3’
sgRosa26_REV: 5’-AAACGAAGACTCCCGCCCATCTTCC-3’
sgBLM#6_FWD: 5’-CACCGGGAACGAACTGCTTCAGCAG-3’
sgBLM#6_REV: 5’-AAACCTGCTGAAGCAGTTCGTTCCC-3’
sgBLM#7_FWD: 5’-CACCGCAGGCGAGAATGTGACACCA-3’
sgBLM#7_REV: 5’-AAACTGGTGTCACATTCTCGCCTGC-3’
sgDNA2#7_FWD: 5’-CACCGCCTGCCCATTTACAAAACGA-3’
sgDNA2#7_REV: 5’-AAACTCGTTTTGTAAATGGGCAGGC-3’
sgDNA2#8_FWD: 5’-CACCGTTGGTGTGAAAATACATCGA-3’
sgDNA2#8_REV: 5’-AAACTCGATGTATTTTCACACCAAC-3’
sgDNA2#9_FWD: 5’-CACCGGTTGGTGTGAAAATACATCG-3’
sgDNA2#9_REV: 5’-AAACCGATGTATTTTCACACCAACC-3’
sgATRX#1_FWD: 5’-CACCGGTGAATCCGAAGATGAACAG-3’
sgATRX#1_REV: 5’-AAACCTGTTCATCTTCGGATTCACC-3’
sgATRX#11_FWD: 5’-CACCGCAGGATCGTCACGATCAAAG-3’
sgATRX#11_REV: 5’-AAACCTTTGATCGTGACGATCCTGC-3’
sgATRX#2_FWD: 5’-CACCGACAAATAAGAACTTGCAATG-3’
sgATRX#2_REV: 5’-AAACCATTGCAAGTTCTTATTTGTC-3’
sgSCR _FWD: 5’-CACCGTGCTCCGTGCATCTGGCATC-3’
sgSCR _REV: 5’-AAACGATGCCAGATGCACGGAGCAC-3’
sgTelo_FWD: 5’-CACCGGTTAGGGTTAGGGTTAGGGTTA-3’
sgTelo_REV: 5’-AAACTAACCCTAACCCTAACCCTAACC-3’
Viral particles were used to deliver plasmids for gene depletion experiments. Briefly, plasmids and lentiviral packaging plasmids, psPAX2 and pMD2.G, were transfected into HEK 293T cells with Polyethylenimine (Polysciences, 23966). Fresh medium was changed 8hrs after transfection. The lentiviral supernatant was collected and combined at 48hrs and 72 hrs post transfection, then filtered through 0.45 μm PES filter. Spin-infection were done with 8 μg ml−1 polybrene (Sigma-Aldrich, H9268). Antibiotic selection for lentivirus infected cells were done using puromycin (2 μg ml−1, Thermo Fisher, A1113803), blasticidin (10 μg ml−1, Invivogen, ant-bl-1), hygromycin (100 μg ml−1, Invivogen, ant-hg-1) or neomycin (800 μg ml−1, Thermo Fisher, 11811031). Alternatively, when lentiGuide-GFP construction was used, the cells were sorted with flow cytometry.
Proteomics of isolated chromatin segments (PICh)
Telomere-associated proteins were isolated by PICh as described before 33,62 in sgRosa and sgBLM U2OS cells. Eighty-five 15 cm dishes of cells were fixed with 4% formaldehyde (Sigma-Aldrich, 252549) for 45 min at room temperature then washed three times with ice-cold 1× PBS and scrapped in pre-chilled 1× PBS+ 0.05% Tween 20. Cell pellets were then dounced in sucrose solution (0.3 M Sucrose, 10 mM HEPES-NaOH pH 7.9, 1% Triton-X 100, 2 mM Magnesium Acetate). Cell pellets were resuspended in 1× PBS, 0.5% Triton X-100, 1 mM PMSF and 0.25 mg ml−1 RNase A (Qiagen, 19101) and incubated on a rotator for 16 hrs at 4 °C. Cell pellets were then washed three times with ice-cold 1× PBS and two more times with LB4 buffer (50mM Tris-HCl pH 8.0, 200mM NaCl, 20 mM EDTA-NaOH pH 8.0, 1% SDS). Then cell pellets were resuspended in LB4 buffer supplemented with 1 mM PMSF (~2.5 folds to nuclei volume) and sonicated with BRANSON Digital Sonifier (Amplitude: 70%; Pulse cycle: 15 sec On, 45 sec Off; Total process time: 7.5 min). Soluble chromatin fractions were heated at 58 °C for 5min and centrifuged at 16,000 g for 10 min at room temperature. Soluble fraction was incubated with 1 mL Streptavidin Agarose (EMD Millipore, 69203–3) for 3hrs at room temperature on a rotator, and then collected by passing through Sephacryl S-400 HR column (GE Healthcare Life Sciences, 17060901) with centrifuge at 750 g for 5 min. Optical Density (OD260 and OD280) was measured with NanoDrop 1000 to confirm efficient RNA removal and quality of soluble chromatin. Soluble fractions were hybridized with 1500 pmol desthiobiotin labeled 2’-Fluor-RNA telomeric probes (t-Desthiobiotin TEG-Spacer18-Spacer18-UUAGGGUUAGGGUUAGGGUUAGGGUUAGGGUUAGGGUUAGGGt) in a PCR machine (25°C for 3 min; 80°C for 5 min; 37°C for 60 min; 60°C for 3 min; 37°C for 30 min; 60°C for 3 min; 37°C for 30 min; then keep at 25°C). Pooled hybridized chromatin was centrifuged at 16,000 g for 15 min at room temperature; and then incubated with 900 μL Dynabeads™ MyOne™ Streptavidin C1 (Thermo Fisher, 65002) overnight on a rotator at room temperature. Then bound chromatin was immobilized on a magnetic stand, followed by five times washes with LB3JD buffer (10 mM HEPES-NaOH pH 7.9, 100 mM NaCl, 2 mM EDTA-NaOH pH 8.0, 1 mM EGTA-NaOH pH 8.0, 0.2% SDS, 0.1% Sodium Sarkosyl), followed by washing with LB3JDS buffer (10 mM HEPES-NaOH pH 7.9, 30 mM NaCl, 2 mM EDTA-NaOH pH 8.0, 1 mM EGTA-NaOH pH 8.0, 0.2% SDS, 0.1% Sodium Sarkosyl) at 42 °C and 1000 rpm for 5 min. Telomere-associated proteins on beads were eluted twice with 450 μL elution buffer (75% LB3JD buffer + 25% D-biotin (Invitrogen, B20656)) by the following steps (37 °C and 65 °C for 30 min each). The eluted samples were precipitated with TCA precipitation protocol. Crosslinked proteins were reversed with decrosslinking buffer (250 mM Tris-HCl pH 8.8, 2% SDS, 0.1 M 2-Mercaptoethanol). NuPAGE LDS Sample Buffer (4×, Invitrogen) was added to boil samples. Then samples were analyzed by silver staining, and mass spectrometry (Taplin Biological Mass Spectrometry Facility at Harvard Medical School).
Immunofluorescence and Immunofluorescence- fluorescence in situ hybridization (IF-FISH)
For immunofluorescence, cells were grown on circular coverslips, poly-L-Lysine (Sigma-Aldrich, P4832) treatment was performed if necessary. Cells were first pre-extracted with CSK buffer+0.5% Triton X-100 (20mM HEPES pH8.0, 100mM NaCl, 3mM MgCl2 and 300mM Sucrose, 0.5% Triton X-100) for 10min on ice if necessary; then fixed with 3% (w/v) formaldehyde (Sigma-Aldrich) for 15 min. Cells were then permeabilized with pre-chilled 0.5% Triton X-100 in 1× PBS for 10 min on ice and blocked with blocking buffer (1× PBS, 0.1% Tween-20 and 5% goat serum) for 1 hr at room temperature. Primary antibodies were prepared in blocking buffer and incubated overnight at 4 °C in wet chamber. The coverslips were washed and incubated with corresponding secondary antibodies for 1 hr at room temperature in wet chamber.
Immunofluorescence of PARylation was done as described50. In brief, cells were treated with 10 μM PARG inhibitor (PDD00017273, Tocris, 59–521-0) for 30 min before processing. Then cells were rinsed with PBS and pre-extracted in CSK + 0.5% Triton X-100 (20mM HEPES pH8.0, 100mM NaCl, 3mM MgCl2 and 300mM Sucrose, 0.5% Triton X-100) supplemented with 10μM PARPi (Olaparib, Selleck Chemicals, S1060) and PARGi inhibitor (PDD0017273, Tocris, CAS: 1945950–21-9) on ice for 5 min. Then cells were fixed with cold 3% (w/v) formaldehyde for 15 min. Cells were then permeabilized using ice-cold methanol/acetone (1:1) mix for 5 min followed by another 5 min in pre-chilled 0.5% Triton X-100 in 1× PBS and blocked in 3% BSA in PBS for 1 hr at room temperature. Then primary antibodies and secondary antibodies were incubated as regular immunofluorescence.
EdU was labeled using the Click-iT EdU Cell Proliferation Kit (Thermo Scientific, C10337) following the manufacture’s instruction.
For IF-FISH, following immunofluorescence, coverslips were re-fixed with 3% (w/v) formaldehyde at room temperature for 10 min, washed with 1× PBS and dehydrated with ethanol (75%, 95%, 100%) and then air-dried. Coverslips were then heat-denatured at 80°C for 7 min and hybridized with a telomeric probe (TelC-Cy3) (PNA Bio, F1002) in hybridization solution (70% deionized formamide, 0.5% Roche blocking reagent, 10mM Tris-HCl pH 7.4) for 2 hrs (U2OS and LM216J) or overnight (HeLa S3, GM847, VA13 and IIICF E6/E7) at room temperature in wet chamber. Coverslips were then washed, stained with DAPI (Sigma-Aldrich, D9542) and mounted using ProLong Gold Antifade Mountant (Thermo Scientific, P36934). Images were acquired with a QImaging RETIGA-SRV camera connected to a Nikon Eclipse 80i microscope at 63x oil objective, or the Leica TCS SP5 II confocal microscope at 63x oil objective.
Primary antibodies used for immunofluorescence: RPA2 (Anti-RPA, clone RPA34–20, MABE285, EMD Millipore), BLM (A300–110A, Bethyl Laboratories), Poly/Mono-ADP Ribose (#83732, Cell Signaling Technology), PCNA (2586S, Cell Signaling Technology), GFP (A-11122, Thermo Fisher Scientific), mCherry (ab183628, Abcam), Cyclin A (sc-271682, Santa Cruz Biotechnology). Secondary antibodies used for immunofluorescence: Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 (A-11034, Thermo Fisher Scientific); Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 488 (A-11029, Thermo Fisher Scientific); Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647 (A-21236, Thermo Fisher Scientific); Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 647 (A21245, Thermo Fisher Scientific).
Telomere native FISH
Telomere native FISH was done as described35. In brief, cells were rinsed with PBS and fixed in pre-chilled (−20°C) 70% ethanol for 20 min at room temperature. The cells were then washed twice in washing buffer (100 mM Tris–HCl pH 8,150 mM NaCl, 0.05% Tween-20) and incubated at 37°C for 30 min with 50 ug/ml RNase A (Qiagen, 19101) and 10U/ml RNase H (New England Biolabs, M0297L) in PBS. Then cells were washed again in washing buffer. Followed by hybridization in the hybridization solution (2× SSC buffer, 8% de-ionized formamide, 5 nM fluorescent telomeric probe (TelC-Cy3, PNA Bio, F1002) or (TelG-Cy3, PNA Bio, F1006)) for 40 min at 37 °C. After hybridization, cells were rinsed twice in filtered 2xSSC buffer and one time in PBS. Then the nucleus was stained in 0.8ug/ml DAPI in 1× PBS for 10 min and dehydrated with ethanol (75%, 95%, 100%), air-dried and mounted using ProLong Gold Antifade Mountant (Thermo Fisher Scientific, P36934).
SDS-PAGE and Western blot
Cell pellets were lysed with RIPA buffer supplemented with cOmplete protein inhibitor cocktail (Roche) and Benzonase (EMD Millipore, 70746) for 30 min on ice. Soluble protein concentration was measured with Protein Assay Dye Reagent (Bio-Rad, 5000006). Proteins were separated by SDS-PAGE using 4–12% Bis–Tris gel (Invitrogen) and transferred to an Amersham Protran 0.2 μm nitrocellulose membrane (Amersham, 10600004). Membranes were blocked with 5% milk and sequentially incubated with primary antibodies overnight at 4 °C, corresponding secondary antibodies for 1 hr at room temperature, and developed using Western Lightning Plus-ECL (Perkins Elmer, NEL105001EA). When necessary, primary and secondary antibodies were stripped with Restore Western Blot Stripping Buffer (Pierce, 21059). Primary antibodies used for Western blot: BLM (A300–110A-M, Bethyl Laboratories), ATRX (sc-15408 or sc-55584, Santa Cruz Biotechnology), DNA2 (ab96488, Abcam), GFP (A-11122, Thermo Fisher Scientific), Cas9 (A9000–050, Epigentek), gamma-H2AX (05–636-I, EMD Millipore), KU86 (sc-9034, Santa Cruz Biotechnology), TRF1 (GeneTex, GTX70304), GAPDH (2118S, Cell Signaling Technology), α-Tubulin (12G10, Developmental Studies Hybridoma Bank), β-Actin (sc-47778, Santa Cruz Biotechnology). Secondary antibodies used for western blot: ECL Anti-Mouse IgG, horseradish peroxidase-linked whole antibody (from sheep) (Sigma-Aldrich/GE, NA931) or ECL Anti-Rabbit IgG, horseradish peroxidase-linked whole antibody (from donkey) (Sigma-Aldrich/GE, NA934).
Telomere restriction fragment (TRF) Assay
Telomere restriction fragment (TRF) assay with pulsed-field gel electrophoresis was performed as described34. Genomic DNA was extracted using DNeasy Blood & Tissue Kit (Qiagen, 69506), and concentration was measured by Qubit Fluorometric Quantification (Qubit™ dsDNA Quantification Assay Kits, Thermo Fisher Scientific, Q32851; Qubit 3.0 Fluorometer, Thermo Fisher Scientific). Five micrograms of genomic DNA were digested with HinfI (New England Biolabs, R0155S) and RsaI (New England Biolabs, R0167L) overnight at 37°C. The digested DNA was subjected to electrophoresis with the CHEF-DRII system (Bio-Rad). Samples were loaded in 1% pulse field (PFGE) certified agarose (1620137, BioRad) in pre-chilled 0.5× TBE buffer using following parameter: 4 V/cm; initial switch time 5 sec, final switch time 5 sec, for 20 hrs at 14 °C. Alternatively, constant-field gel electrophoresis was utilized to separate the digested DNA using the Owl A5 Large Gel System (Thermo Fisher) with 0.7% agarose gel in 1× TAE buffer at 2 V/cm for 20 hrs in the cold room.
The gel was dried for 4 hrs at 42 °C, and stained with Ethidium Bromide (Sigma-Aldrich, 2375), and subjected to denatured in-gel hybridization with 32P-labeled telomere C-probe as shown below.
Neutral-neutral two-dimensional gel electrophoresis
Neutral-neutral two-dimensional gel electrophoresis was performed as previously described43,63. Ten micrograms of genomic DNA were digested as for TRF assay. Restriction enzyme digested gDNA were first resolved with 0.4% agarose gel in 1× TBE at 1 V cm−1 at room temperature for 7 hrs (6 samples). The lanes with samples were cut and soaked in 1× TBE with 0.3 μg ml−1 Ethidium Bromide (EB) for 30 min, then casted into 1% agarose gel containing 0.3 μg ml−1 EB in 1× TBE. Second dimensional gel electrophoresis was operated at 3 V/cm for 3–3.5 hrs at 4°C. The gel was dried for at least 2 hrs at 42 °C and subjected to native and denatured in-gel hybridization with 32P-labeled telomere C-/ G-probe.
Native and denatured in-gel hybridization
For native hybridization, the dried gel was first prehybridized with Denhart’s hybridization buffer (5×SSC, 0.5% SDS, 10× Denhart’s buffer) then hybridized overnight at 42°C with 32P-labeled C- or G- telomeric probe prepared as shown before64. The hybridized gel was then washed 3 times with 2× SSC and 0.5% SDS and 3 times with 2× SSC + 0.1% SDS, then exposed to PhosphorImager screen (GE Healthcare) and scanned on Typhoon FLA 7000 with ImageQuant (Molecular Dynamics). For denatured hybridization, gel was first denatured with 0.5 M NaOH + 1.5 M NaCl for half hour; neutralized with 2 washes in 0.5 M Tris–HCl pH 8.0 + 1.5 M NaCl for half hour each; and then prehybridized and hybridized as shown above.
Purification of Human Recombinant Proteins
WT and nuclease-deficient (D277A) hDNA2 with C-terminal Flag epitope tag was introduced into 438A MacroBAC vector to create pJD177 and pJD73 respectively and bacmid DNA was generated in the Escherichia coli strain DH10Bac (Invitrogen). The bacmid was used to generate a recombinant virus in SF9 insect cells. HighFive insect cells at the density of 1 × 106 cells/ml were infected with the baculovirus, grown in shaking flask at 25°C and harvested after 48 hrs. All subsequent steps were carried between 0 and 4°C. An extract was prepared by sonication of a cell pellet derived from 800 ml of culture in 60 ml of K buffer (20 mM KH2PO4, 10% glycerol, 0.5 mM EDTA, 0.01% IGEPAL CA-630 (MilliporeSigma), 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 5 μg/ml each of aprotinin, chymostatin, leupeptin and pepstatin) containing 500 mM KCl. After ultracentrifugation (100 000 × g for 60 min), the clarified lysate was incubated with 3 ml of anti-Flag M2 agarose (Sigma) for 1 hr with constant agitation. The resin was washed with 15 ml of K buffer with 500 mM KCl, 100 ml of K buffer with 500 mM KCl, 1 mM ATP and 10 mM MgCl2 and 100 ml of K buffer with 150 mM KCl. To elute the bound proteins, the resin was treated for 10 min with 3 ml of K buffer containing 150 mM KCl and 250 ng/μl of Flag peptide (Sigma). This elution procedure was repeated four additional times. The pooled eluate was loaded onto a 1 ml HP Q column and eluted with a 50 ml gradient of 150–500 mM KCl. Fractions containing DNA2 were pooled, concentrated to 500 μl using Amicon centrifugal filter tubes (MilliporeSigma) and further fractioned on 24 ml Suprdex S200 column (GE Healthcare) in K buffer with 250 mM KCl. Fractions containing the DNA2 peak were combined, concentrated using Amicon filter tubes and stored in small portions at −80°C.
BLM with C-terminal His epitope tag was introduced into 438A MacroBAC vector and a bacmid was generated in the Escherichia coli strain DH10Bac (Invitrogen). The bacmid was used to generate a recombinant virus in SF9 insect cells. HighFive insect cells at the density of 1 × 106 cells/ml were infected with the baculovirus, grown in shaking flask at 25°C and harvested after 48 hrs. All subsequent steps were carried between 0 and 4°C. Cell extract was prepared by sonication of a cell pellet derived from 800 ml of culture in 60 ml of K buffer (20 mM KH2PO4, 10% glycerol, 0.5 mM EDTA, 0.01% IGEPAL CA-630, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride and 5 μg/ml each of aprotinin, chymostatin, leupeptin and pepstatin) containing 300 mM KCl and 25 mM imidazole. After ultracentrifugation (100 000 × g for 60 min), the clarified lysate was incubated with 3 ml of Ni-NTA resin (Qiagen) for 2 hrs with constant agitation. The resin was washed with 20 ml of K buffer with 300 mM KCl and 25 mM imidazole, 1000 ml of K buffer with 1M KCl and 25 mM imidazole, 1 mM ATP and 10 mM MgCl2 and 20 ml of K buffer with 150 mM KCl and 25 mM imidazole. To elute the bound proteins, the resin was treated for 10 min with 3 ml of K buffer containing 150 mM KCl and 250mM imidazole. This elution procedure was repeated four additional times. The pooled eluate was loaded onto a 1 ml heparin column (Amersham) and eluted with a 50 ml gradient of 150–600 mM KCl. Fractions containing BLM were pooled, concentrated to 500 μl using Amicon filter tubes and further fractioned on 24 ml Superdex 200 column (GE Healthcare) in K buffer with 300 mM KCl. Fractions containing the BLM peak were combined, concentrated using Amicon centrifugal filter tubes and stored in small portions at −80°C.
pYES2-BLM K695R was introduced into the protease-deficient S. cerevisiae strain JEL-1 and protein expression was induced by 2% galactose. Cells were harvested by centrifugation and stored at –80 °C. All the subsequent steps were carried out at 4 °C. To prepare extract, 50 g of frozen yeast paste was thawed in 50 ml of cell breakage buffer (50 mM Tris-HCl,pH 7.5, 500 mM KCl, 10% sucrose, 0.5 mM EDTA, 1 mM 2-mercaptoethanol, and the following protease inhibitors: aprotinin, chymostatin, leupeptin, and pepstatin A each at 5 μg/ml and 1 mM PMSF). Cells were lysed in a French press and the crude extract was subject to centrifugation (100,000 × g for 90 min). The supernatant was mixed gently with 5 ml of Ni-NTA resin (Qiagen) for 1 hr. The resin was poured into a column and washed with 50 ml of buffer K (20 mM K2HPO4, pH 7.4, 10% glycerol, 0.5 mM EDTA, 0.01% Igepal, and 1 mM DTT, and protease inhibitors) containing 500 mM KCl and 15 mM imidazole. Bound proteins were eluted with a 40 ml gradient of 15–250 mM imidazole in buffer K containing 500 mM KCl, with BLM eluting at ~100 mM imidazole. The peak fractions were pooled, diluted with 1.5 volumes of buffer T (20 mM Tris-HCl, pH 7.5, 10% glycerol, 0.5 mM EDTA, 0.01% IGEPAL CA-630, 1 mM DTT, and the protease inhibitors listed above), and applied onto an 8 ml Source Q column (GE Healthcare), which was washed with 20 ml of buffer T containing 200 mM KCl and then developed with a 65 ml gradient of 200–500 mM KCl in buffer K. Fractions containing BLM, which eluted at ~360 mM KCl, were pooled and applied onto a 1 ml column of macro-hydroxyapatite (Bio-Rad), which was eluted with a 30 ml gradient of 80–350 mM KH2PO4 in buffer K, with BLM eluting at ~250 mM KH2PO4. The peak fractions from this step were pooled, diluted with an equal volume of buffer K, and applied onto a 1 ml Mono S column, which was eluted with a 15 ml 100–700 mM KCl gradient in buffer K. Fractions that contained BLM, were concentrated using Amicon filter tubes and stored in small aliquots at −80°C.
In vitro recombinant BLM and DNA2 activity on telomeric DNA assay
Genomic DNA, from control or BLM knockout LM216J cells, was extracted using Wizard Genomic DNA Purification Kit (Promega, A1120), and the concentration was measured by Qubit Fluorometric Quantification (Qubit™ dsDNA Quantification Assay Kits, Thermo Fisher Scientific, Q32851; Qubit 3.0 Fluorometer, Thermo Fisher Scientific). gDNA was digested with HinfI (New England Biolabs, R0155S) and Rsa I (New England Biolabs, R0167L) as for TRF assay. Then 1 μg of the restriction enzyme-digested genomic DNA were aliquoted for the following assay. 15 nM WT or K695R human recombinant BLM, and 2.5 nM human DNA2 were added into the aliquoted reactions for another 2 hrs at 37°C, followed by adding 0.2% SDS and 0.25 μg/μl protease K (Qiagen, 19133) and incubate at 37°C for another 15 min. The samples were then subjected to agarose electrophoresis and native and denatured in-gel hybridization with 32P-labeled telomere C-/ G-probe as shown above separately.
QUANTIFICATION AND STATISTICAL ANALYSIS
All statistical analyses were performed using GraphPad Prism 9 software. Significance was calculated by the two-tailed Student’s t-test, unless otherwise specified. The scatter plot shows each data together with the mean and the SEM highlighted with red lines. In the scatter plot with bar, all data points are shown in red circles. The mean was indicated by the bar and the SEM was indicated by the lines. The Tukey whiskers plot displays the 25th to the 75th percentiles as a box with the median highlighted. The top line shows the 75th percentile plus 1.5 times interquartile range (IQR) and the bottom line shows the minimum value of the data set. All experiments were biologically repeated three times or more for confirmation. The significance was defined as follows: ns: p > 0.05, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. All of the statistical details of experiments can also be found in the figure legends.
Supplementary Material
Highlights.
BLM helicase is required for assembly of the ALT telomere DNA damage response
BLM promotes a replication-associated ALT telomere damage response.
BLM helicase activity generates 5’-flaps at telomere during lagging strand synthesis
DNA2 acts on BLM generated telomere 5’-flaps to limit ALT
Acknowledgments
We thank J. Déjardin (CNRS, France) for guidance on performing PICh experiments. We thank D. Clynes (University of Oxford), R. O’Sullivan (University of Pittsburgh) and J. Shi (University of Pennsylvania) for sharing critical reagents. We thank members of the Greenberg lab for critical discussion and support. This work was supported by NIH R01 GM1101149, R01 CA174904, R01 ES007061, R50CA265315, and R35 CA241801, and by a Bloom Syndrome Grant from the UPENN Orphan Disease Center, a Gray Foundation Team Science Award to R.A.G and P.S.; and an AFCRI funded postdoctoral fellowship to T.Z., and an ACS funded postdoctoral fellowship PF-23-1150186-01-DMC to H.J. P.S. is the holder of the Robert A. Welch Distinguished Chair in Chemistry (AQ-0012).
Footnotes
Declaration of Interests
RAG is a co-founder and scientific advisory board member of RADD Pharmaceuticals and a scientific advisory board member for Dong-A ST Co. Neither engagement directly relates to the substance of this study.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- 1.Dilley RL, and Greenberg RA (2015). ALTernative Telomere Maintenance and Cancer. Trends Cancer 1, 145–156. 10.1016/j.trecan.2015.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cesare AJ, and Reddel RR (2010). Alternative lengthening of telomeres: models, mechanisms and implications. Nat Rev Genet 11, 319–330. 10.1038/nrg2763. [DOI] [PubMed] [Google Scholar]
- 3.Sobinoff AP, and Pickett HA (2020). Mechanisms that drive telomere maintenance and recombination in human cancers. Curr Opin Genet Dev 60, 25–30. 10.1016/j.gde.2020.02.006. [DOI] [PubMed] [Google Scholar]
- 4.Arora R, and Azzalin CM (2015). Telomere elongation chooses TERRA ALTernatives. RNA Biol 12, 938–941. 10.1080/15476286.2015.1065374. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Zhang JM, and Zou L (2020). Alternative lengthening of telomeres: from molecular mechanisms to therapeutic outlooks. Cell Biosci 10, 30. 10.1186/s13578-020-00391-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Verma P, Dilley RL, Zhang T, Gyparaki MT, Li Y, and Greenberg RA (2019). RAD52 and SLX4 act nonepistatically to ensure telomere stability during alternative telomere lengthening. Genes Dev 33, 221–235. 10.1101/gad.319723.118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chen Q, Ijpma A, and Greider CW (2001). Two survivor pathways that allow growth in the absence of telomerase are generated by distinct telomere recombination events. Mol Cell Biol 21, 1819–1827. 10.1128/MCB.21.5.1819-1827.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhang JM, Yadav T, Ouyang J, Lan L, and Zou L (2019). Alternative Lengthening of Telomeres through Two Distinct Break-Induced Replication Pathways. Cell Rep 26, 955–968 e953. 10.1016/j.celrep.2018.12.102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Dilley RL, Verma P, Cho NW, Winters HD, Wondisford AR, and Greenberg RA (2016). Break-induced telomere synthesis underlies alternative telomere maintenance. Nature 539, 54–58. 10.1038/nature20099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Bryan TM, Englezou A, Gupta J, Bacchetti S, and Reddel RR (1995). Telomere elongation in immortal human cells without detectable telomerase activity. Embo J 14, 4240–4248. 10.1002/j.1460-2075.1995.tb00098.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Cesare AJ, Kaul Z, Cohen SB, Napier CE, Pickett HA, Neumann AA, and Reddel RR (2009). Spontaneous occurrence of telomeric DNA damage response in the absence of chromosome fusions. Nat Struct Mol Biol 16, 1244–1251. 10.1038/nsmb.1725. [DOI] [PubMed] [Google Scholar]
- 12.Oganesian L, and Karlseder J (2011). Mammalian 5’ C-rich telomeric overhangs are a mark of recombination-dependent telomere maintenance. Mol Cell 42, 224–236. 10.1016/j.molcel.2011.03.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Flynn RL, Cox KE, Jeitany M, Wakimoto H, Bryll AR, Ganem NJ, Bersani F, Pineda JR, Suva ML, Benes CH, et al. (2015). Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science 347, 273–277. 10.1126/science.1257216. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Lovejoy CA, Li W, Reisenweber S, Thongthip S, Bruno J, de Lange T, De S, Petrini JH, Sung PA, Jasin M, et al. (2012). Loss of ATRX, genome instability, and an altered DNA damage response are hallmarks of the alternative lengthening of telomeres pathway. PLoS Genet 8, e1002772. 10.1371/journal.pgen.1002772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Goldberg AD, Banaszynski LA, Noh KM, Lewis PW, Elsaesser SJ, Stadler S, Dewell S, Law M, Guo X, Li X, et al. (2010). Distinct factors control histone variant H3.3 localization at specific genomic regions. Cell 140, 678–691. 10.1016/j.cell.2010.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lewis PW, Elsaesser SJ, Noh KM, Stadler SC, and Allis CD (2010). Daxx is an H3.3-specific histone chaperone and cooperates with ATRX in replication-independent chromatin assembly at telomeres. Proc Natl Acad Sci U S A 107, 14075–14080. 10.1073/pnas.1008850107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Arora R, Lee Y, Wischnewski H, Brun CM, Schwarz T, and Azzalin CM (2014). RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nat Commun 5, 5220. 10.1038/ncomms6220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Heaphy CM, de Wilde RF, Jiao Y, Klein AP, Edil BH, Shi C, Bettegowda C, Rodriguez FJ, Eberhart CG, Hebbar S, et al. (2011). Altered telomeres in tumors with ATRX and DAXX mutations. Science 333, 425. 10.1126/science.1207313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Brosnan-Cashman JA, Yuan M, Graham MK, Rizzo AJ, Myers KM, Davis C, Zhang R, Esopi DM, Raabe EH, Eberhart CG, et al. (2018). ATRX loss induces multiple hallmarks of the alternative lengthening of telomeres (ALT) phenotype in human glioma cell lines in a cell line-specific manner. PLoS One 13, e0204159. 10.1371/journal.pone.0204159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Li F, Deng Z, Zhang L, Wu C, Jin Y, Hwang I, Vladimirova O, Xu L, Yang L, Lu B, et al. (2019). ATRX loss induces telomere dysfunction and necessitates induction of alternative lengthening of telomeres during human cell immortalization. Embo J 38, e96659. 10.15252/embj.201796659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Turkalo TK, Maffia A, Schabort JJ, Regalado SG, Bhakta M, Blanchette M, Spierings DCJ, Lansdorp PM, and Hockemeyer D (2023). A non-genetic switch triggers alternative telomere lengthening and cellular immortalization in ATRX deficient cells. Nat Commun 14, 939. 10.1038/s41467-023-36294-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Hu Y, Shi G, Zhang L, Li F, Jiang Y, Jiang S, Ma W, Zhao Y, Songyang Z, and Huang J (2016). Switch telomerase to ALT mechanism by inducing telomeric DNA damages and dysfunction of ATRX and DAXX. Sci Rep 6, 32280. 10.1038/srep32280. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Clynes D, Jelinska C, Xella B, Ayyub H, Scott C, Mitson M, Taylor S, Higgs DR, and Gibbons RJ (2015). Suppression of the alternative lengthening of telomere pathway by the chromatin remodelling factor ATRX. Nat Commun 6, 7538. 10.1038/ncomms8538. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ramamoorthy M, and Smith S (2015). Loss of ATRX Suppresses Resolution of Telomere Cohesion to Control Recombination in ALT Cancer Cells. Cancer Cell 28, 357–369. 10.1016/j.ccell.2015.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Zhang JM, Genois MM, Ouyang J, Lan L, and Zou L (2021). Alternative lengthening of telomeres is a self-perpetuating process in ALT-associated PML bodies. Mol Cell 81, 1027–1042 e1024. 10.1016/j.molcel.2020.12.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Loe TK, Li JSZ, Zhang Y, Azeroglu B, Boddy MN, and Denchi EL (2020). Telomere length heterogeneity in ALT cells is maintained by PML-dependent localization of the BTR complex to telomeres. Genes Dev 34, 650–662. 10.1101/gad.333963.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Min J, Wright WE, and Shay JW (2019). Clustered telomeres in phase-separated nuclear condensates engage mitotic DNA synthesis through BLM and RAD52. Genes Dev 33, 814–827. 10.1101/gad.324905.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Sobinoff AP, and Pickett HA (2017). Alternative Lengthening of Telomeres: DNA Repair Pathways Converge. Trends Genet 33, 921–932. 10.1016/j.tig.2017.09.003. [DOI] [PubMed] [Google Scholar]
- 29.Yang Z, Takai KK, Lovejoy CA, and de Lange T (2020). Break-induced replication promotes fragile telomere formation. Genes Dev 34, 1392–1405. 10.1101/gad.328575.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Cho NW, Dilley RL, Lampson MA, and Greenberg RA (2014). Interchromosomal homology searches drive directional ALT telomere movement and synapsis. Cell 159, 108–121. 10.1016/j.cell.2014.08.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Lydeard JR, Jain S, Yamaguchi M, and Haber JE (2007). Break-induced replication and telomerase-independent telomere maintenance require Pol32. Nature 448, 820–823. 10.1038/nature06047. [DOI] [PubMed] [Google Scholar]
- 32.Sobinoff AP, Allen JA, Neumann AA, Yang SF, Walsh ME, Henson JD, Reddel RR, and Pickett HA (2017). BLM and SLX4 play opposing roles in recombination-dependent replication at human telomeres. Embo J 36, 2907–2919. 10.15252/embj.201796889. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Dejardin J, and Kingston RE (2009). Purification of Proteins Associated with Specific Genomic Loci. Cell 136, 175–186. 10.1016/j.cell.2008.11.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhang T, Rawal Y, Jiang H, Kwon Y, Sung P, and Greenberg RA (2023). Break-induced replication orchestrates resection-dependent template switching. Nature 619, 201–208. 10.1038/s41586-023-06177-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Frank L, Rademacher A, Mucke N, Tirier SM, Koeleman E, Knotz C, Schumacher S, Stainczyk SA, Westermann F, Frohling S, et al. (2022). ALT-FISH quantifies alternative lengthening of telomeres activity by imaging of single-stranded repeats. Nucleic Acids Res 50, e61. 10.1093/nar/gkac113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Blackford AN, Nieminuszczy J, Schwab RA, Galanty Y, Jackson SP, and Niedzwiedz W (2015). TopBP1 interacts with BLM to maintain genome stability but is dispensable for preventing BLM degradation. Mol Cell 57, 1133–1141. 10.1016/j.molcel.2015.02.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Shorrocks AK, Jones SE, Tsukada K, Morrow CA, Belblidia Z, Shen J, Vendrell I, Fischer R, Kessler BM, and Blackford AN (2021). The Bloom syndrome complex senses RPA-coated single-stranded DNA to restart stalled replication forks. Nat Commun 12, 585. 10.1038/s41467-020-20818-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Bussen W, Raynard S, Busygina V, Singh AK, and Sung P (2007). Holliday junction processing activity of the BLM-Topo IIIalpha-BLAP75 complex. J Biol Chem 282, 31484–31492. 10.1074/jbc.M706116200. [DOI] [PubMed] [Google Scholar]
- 39.Karow JK, Chakraverty RK, and Hickson ID (1997). The Bloom’s syndrome gene product is a 3 ‘-5 ‘ DNA helicase. J Biol Chem 272, 30611–30614. DOI 10.1074/jbc.272.49.30611. [DOI] [PubMed] [Google Scholar]
- 40.Wu L, Chan KL, Ralf C, Bernstein DA, Garcia PL, Bohr VA, Vindigni A, Janscak P, Keck JL, and Hickson ID (2005). The HRDC domain of BLM is required for the dissolution of double Holliday junctions. Embo J 24, 2679–2687. 10.1038/sj.emboj.7600740. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Xue C, Salunkhe SJ, Tomimatsu N, Kawale AS, Kwon Y, Burma S, Sung P, and Greene EC (2022). Bloom helicase mediates formation of large single-stranded DNA loops during DNA end processing. Nat Commun 13, 2248. 10.1038/s41467-022-29937-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Swan MK, Legris V, Tanner A, Reaper PM, Vial S, Bordas R, Pollard JR, Charlton PA, Golec JM, and Bertrand JA (2014). Structure of human Bloom’s syndrome helicase in complex with ADP and duplex DNA. Acta Crystallogr D Biol Crystallogr 70, 1465–1475. 10.1107/S139900471400501X. [DOI] [PubMed] [Google Scholar]
- 43.Nabetani A, and Ishikawa F (2009). Unusual telomeric DNAs in human telomerase-negative immortalized cells. Mol Cell Biol 29, 703–713. 10.1128/MCB.00603-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Mazzucco G, Huda A, Galli M, Piccini D, Giannattasio M, Pessina F, and Doksani Y (2020). Telomere damage induces internal loops that generate telomeric circles. Nat Commun 11, 5297. 10.1038/s41467-020-19139-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Zhang T, Zhang Z, Shengzhao G, Li X, Liu H, and Zhao Y (2019). Strand break-induced replication fork collapse leads to C-circles, C-overhangs and telomeric recombination. PLoS Genet 15, e1007925. 10.1371/journal.pgen.1007925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Drosopoulos WC, Kosiyatrakul ST, Yan Z, Calderano SG, and Schildkraut CL (2012). Human telomeres replicate using chromosome-specific, rather than universal, replication programs. J Cell Biol 197, 253–266. 10.1083/jcb.201112083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Sun H, Ma L, Tsai YF, Abeywardana T, Shen B, and Zheng L (2023). Okazaki fragment maturation: DNA flap dynamics for cell proliferation and survival. Trends Cell Biol 33, 221–234. 10.1016/j.tcb.2022.06.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Verma P, Dilley RL, Zhang TP, Gyparaki MT, Li YW, and Greenberg RA (2019). RAD52 and SLX4 act nonepistatically to ensure telomere stability during alternative telomere lengthening. Gene Dev 33, 221–235. 10.1101/gad.319723.118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Hanzlikova H, Kalasova I, Demin AA, Pennicott LE, Cihlarova Z, and Caldecott KW (2018). The Importance of Poly(ADP-Ribose) Polymerase as a Sensor of Unligated Okazaki Fragments during DNA Replication. Mol Cell 71, 319–331 e313. 10.1016/j.molcel.2018.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Vaitsiankova A, Burdova K, Sobol M, Gautam A, Benada O, Hanzlikova H, and Caldecott KW (2022). PARP inhibition impedes the maturation of nascent DNA strands during DNA replication. Nat Struct Mol Biol 29, 329–338. 10.1038/s41594-022-00747-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Teng YC, Sundaresan A, O’Hara R, Gant VU, Li M, Martire S, Warshaw JN, Basu A, and Banaszynski LA (2021). ATRX promotes heterochromatin formation to protect cells from G-quadruplex DNA-mediated stress. Nat Commun 12, 3887. 10.1038/s41467-021-24206-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Sfeir A, Kosiyatrakul ST, Hockemeyer D, MacRae SL, Karlseder J, Schildkraut CL, and de Lange T (2009). Mammalian telomeres resemble fragile sites and require TRF1 for efficient replication. Cell 138, 90–103. 10.1016/j.cell.2009.06.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Drosopoulos WC, Kosiyatrakul ST, and Schildkraut CL (2015). BLM helicase facilitates telomere replication during leading strand synthesis of telomeres. J Cell Biol 210, 191–208. 10.1083/jcb.201410061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Ira G, and Haber JE (2002). Characterization of RAD51-independent break-induced replication that acts preferentially with short homologous sequences. Mol Cell Biol 22, 6384–6392. 10.1128/MCB.22.18.6384-6392.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Zhang H, Zhao R, Tones J, Liu M, Dilley RL, Chenoweth DM, Greenberg RA, and Lampson MA (2020). Nuclear body phase separation drives telomere clustering in ALT cancer cells. Mol Biol Cell 31, 2048–2056. 10.1091/mbc.E19-10-0589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Hoang SM, Kaminski N, Bhargava R, Barroso-Gonzalez J, Lynskey ML, Garcia-Exposito L, Roncaioli JL, Wondisford AR, Wallace CT, Watkins SC, et al. (2020). Regulation of ALT-associated homology-directed repair by polyADP-ribosylation. Nat Struct Mol Biol 27, 1152–1164. 10.1038/s41594-020-0512-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Min J, Wright WE, and Shay JW (2017). Alternative lengthening of telomeres can be maintained by preferential elongation of lagging strands. Nucleic Acids Res 45, 2615–2628. 10.1093/nar/gkw1295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Lu R, and Pickett HA (2022). Telomeric replication stress: the beginning and the end for alternative lengthening of telomeres cancers. Open Biol 12, 220011. 10.1098/rsob.220011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Silva B, Pentz R, Figueira AM, Arora R, Lee YW, Hodson C, Wischnewski H, Deans AJ, and Azzalin CM (2019). FANCM limits ALT activity by restricting telomeric replication stress induced by deregulated BLM and R-loops. Nat Commun 10, 2253. 10.1038/s41467-019-10179-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Lu R, O’Rourke JJ, Sobinoff AP, Allen JAM, Nelson CB, Tomlinson CG, Lee M, Reddel RR, Deans AJ, and Pickett HA (2019). The FANCM-BLM-TOP3A-RMI complex suppresses alternative lengthening of telomeres (ALT). Nat Commun 10, 2252. 10.1038/s41467-019-10180-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Verma P, Zhou Y, Cao Z, Deraska PV, Deb M, Arai E, Li W, Shao Y, Puentes L, Li Y, et al. (2021). ALC1 links chromatin accessibility to PARP inhibitor response in homologous recombination-deficient cells. Nat Cell Biol 23, 160–171. 10.1038/s41556-020-00624-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Kan SL, Saksouk N, and Dejardin J (2017). Proteome Characterization of a Chromatin Locus Using the Proteomics of Isolated Chromatin Segments Approach. Methods Mol Biol 1550, 19–33. 10.1007/978-1-4939-6747-6_3. [DOI] [PubMed] [Google Scholar]
- 63.Zhang T, Zhang Z, Li F, Hu Q, Liu H, Tang M, Ma W, Huang J, Songyang Z, Rong Y, et al. (2017). Looping-out mechanism for resolution of replicative stress at telomeres. Embo Rep 18, 1412–1428. 10.15252/embr.201643866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Zhao Y, Shay JW, and Wright WE (2011). Telomere G-overhang length measurement method 1: the DSN method. Methods Mol Biol 735, 47–54. 10.1007/978-1-61779-092-8_5. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
PICh, Western blot, Southern blot, and immunofluorescence quantification raw data have been deposited at Mendeley and are publicly available as of the date of publication. The DOI is listed in the key resources table.
This paper does not report original code.
Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| BLM | Bethyl Laboratories | Cat No. A300-110A-M; RRID:AB_2779016 |
| Poly/Mono-ADP Ribose | Cell Signaling Technology | Cat No. 83732; RRID:AB_2749858 |
| PCNA | Cell Signaling Technology | Cat No. 2586S; RRID:AB_2160343 |
| Anti-phospho-Histone H2A.X (Ser139) Antibody | EMD Millipore | Cat No. 05-636-I; RRID:AB_2755003 |
| PML | Santa Cruz Biotechnology | Cat No. sc-966; RRID:AB_628162 |
| GFP | Thermo Fisher Scientific | Cat No. A-11122; RRID:AB_221569 |
| Cyclin A | Santa Cruz Biotechnology | Cat No. sc-271682; RRID:AB_10709300 |
| GAPDH | Cell Signaling Technology | Cat No. 2118S; RRID:AB_561053 |
| mCherry | Abcam | Cat No. ab183628; RRID:AB_2650480 |
| DNA2 | Abcam | Cat No. ab96488; RRID:AB_10677769 |
| RPA2 (Anti-RPA, clone RPA34-20) | EMD Millipore | Cat No. MABE285; RRID:AB_11213221 |
| α-Tubulin | Developmental Studies Hybridoma Bank | Cat No. 12G10; RRID:AB_528498 |
| KU86 (H-300) | Santa Cruz Biotechnology | Cat No. sc-9034; RRID:AB_2218743 |
| β-Actin | Santa Cruz Biotechnology | Cat No. sc-47778; RRID:AB_626632 |
| TRF1 | GeneTex | Cat No. GTX70304; RRID:AB_377594 |
| ATRX | Santa Cruz Biotechnology | Cat No. sc-15408; RRID:AB_2061023 |
| ATRX | Santa Cruz Biotechnology | Cat No. sc-55584; RRID:AB_831012 |
| Cas9 | Epigentek | Cat No. A9000-050; RRID:AB_2828022 |
| Bacterial and Virus Strains | ||
| DH10Bac | Invitrogen | 10361012 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Puromycin | Thermo Fisher | A1113803 |
| Hygromycin | Invivogen | ant-hg-1 |
| G418 Sulfate | Thermo Fisher Scientific | 11811031 |
| Blasticidin | Invivogen | ant-bl-1 |
| Polyethylenimine | Polysciences | 23966 |
| polybrene | Sigma-Aldrich | H9268 |
| RO-3306 | Selleck Chemicals | S7747 |
| Q5 Site-Directed Mutagenesis Kit | New England Biolabs | E0554S |
| NEBuilder® HiFi DNA Assembly Master Mix | New England Biolabs | E2621S |
| Avalanche®-Omni Transfection Reagent | EZ Biosystems | EZTOMNI-1 |
| Formaldehyde solution | Sigma-Aldrich | 252549 |
| RNAseA | Qiagen | 19101 |
| RNase H | New England Biolabs | M0297L |
| RsaI | New England Biolabs | R0167L |
| HinfI | New England Biolabs | R0155S |
| BsmBI-v2 | New England Biolabs | R0739S |
| Streptavidin Agarose | EMD Millipore | 69203-3 |
| Sephacryl S-400 HR column | GE Healthcare Life Sciences | 17060901 |
| Dynabeads™ MyOne™ Streptavidin C1 | Thermo Fisher Scientific | 65002 |
| D-biotin | Invitrogen | B20656 |
| poly-L-Lysine | Sigma-Aldrich | P4832 |
| PDD00017273 | Tocris | 59-521-0 |
| Click-iT EdU Cell Proliferation Kit | Thermo Scientific | C10337 |
| DAPI | Sigma-Aldrich | D9542 |
| ProLong Gold Antifade Mountant | Thermo Scientific | P36934 |
| cOmplete protein inhibitor cocktail | Roche | 11873580001 |
| Benzonase | EMD Millipore | 70746 |
| Protein Assay Dye Reagent | Bio-Rad | 5000006 |
| Western Lightning Plus-ECL | Perkins Elmer | NEL105001EA |
| Restore Western Blot Stripping Buffer | Thermo Fisher Scientific | 21059 |
| DNeasy Blood & Tissue Kit | Qiagen | 69506 |
| Qubit™ dsDNA Quantification Assay Kits | Thermo Fisher Scientific | Q32851 |
| Pulse field certified agarose | BioRad | 1620137 |
| Wizard Genomic DNA Purification Kit | Promega | A1120 |
| protease K | Qiagen | 19133 |
| TelC-Cy3 | PNA Bio | F1002 |
| TelG-Cy3 | PNA Bio | F1006 |
| Deposited Data | ||
| PICh of TRF1-Fork1D450A expressing U2OS vs HelaS3 | Zhang et al.34 | N/A |
| PICh of sgRosa vs sgBLM U2OS | This Paper | DOI: 10.17632/hbm2k47rnx.1 |
| Uncropped Images | This Paper | DOI: 10.17632/hbm2k47rnx.1 |
| Immunofluorescence quantification raw data | This Paper | DOI: 10.17632/hbm2k47rnx.1 |
| Experimental Models: Cell Lines | ||
| U2OS | ATCC | HTB-96 |
| LM216J | Dilley et al.9 | N/A |
| GM847 | Dilley et al.9 | N/A |
| WI-38 VA13 | ATCC | CCL-75.1 |
| HelaS3 | ATCC | CCL-2.2 |
| HEK293T | ATCC | CRL-3216 |
| Oligonucleotides | ||
| sgRosa sequence, see Method details | Zhang et al.34 | N/A |
| sgBLM sequence, see Method details | This paper | N/A |
| sgDNA2 sequence, see Method details | Zhang et al.34 | N/A |
| sgATRX sequence, see Method details | This paper | N/A |
| sgSCR sequence, see Method details | Zhang et al.45 | N/A |
| sgTelo sequence, see Method details | Zhang et al.45 | N/A |
| Primers for GFP-BLM cloning, see Method details | This paper | N/A |
| Primers for BLM-mCherry-TRF1 cloning, see Method details | This paper | N/A |
| Recombinant DNA | ||
| pLenti CMV TRE3G Puro FLAG-DD-ER-mCherry-TRF1-FokI WT | Dilley et al.9 | N/A |
| pLenti CMV TRE3G Puro FLAG-DD-ER-mCherry-TRF1-FokI D450A | Dilley et al.9 | N/A |
| GFP-BLM | Addgene | 80070 |
| GFP-BLM-EV | This paper | N/A |
| GFP-BLM-K3A | This paper | N/A |
| GFP-BLM-Δ133 | This paper | N/A |
| GFP-BLM-ΔN | This paper | N/A |
| GFP-BLM-ΔC | This paper | N/A |
| GFP-BLM-ΔHRDC+C | This paper | N/A |
| plenti-CMV-BSD | Addgene | 17486 |
| plenti-CMV-BLM-mCherry-TRF1-BSD | This paper | N/A |
| plenti-CMV-BLMK695R-mCherry-TRF1-BSD | This paper | N/A |
| plenti-CMV-BLMK3A-mCherry-TRF1-BSD | This paper | N/A |
| plenti-CMV-BLMΔ133-mCherry-TRF1-BSD | This paper | N/A |
| plenti-CMV-BLMΔN-mCherry-TRF1-BSD | This paper | N/A |
| lenti-SpCas9-hygro | Addgene | 104995 |
| lentiGuide-Puro | Addgene | 52963 |
| lentiGuide-sgRosa-Puro | This paper | N/A |
| lentiGuide-sgBLM#6-Puro | This paper | N/A |
| lentiGuide-sgBLM#7-Puro | This paper | N/A |
| lentiGuide-GFP | Addgene | 104374 |
| lentiGuide-sgRosa-GFP | This paper | N/A |
| lentiGuide-sgBLM#6-GFP | This paper | N/A |
| lentiGuide-sgBLM#7-GFP | This paper | N/A |
| lentiCRISPRv2-blast | Addgene | 98293 |
| lentiCRISPRv2-sgRosa-blast | This paper | N/A |
| lentiCRISPRv2-sgDNA2#7-blast | This paper | N/A |
| lentiCRISPRv2-sgDNA2#8-blast | This paper | N/A |
| lentiCRISPRv2-sgDNA2#9-blast | This paper | N/A |
| lentiSaCas9-sgRosa-neo | This paper | N/A |
| lentiSaCas9-sgATRX#2-neo | This paper | N/A |
| lentiCRISPRV2-sgRosa-hygro | This paper | N/A |
| lentiCRISPRV2-sgATRX#1-hygro | This paper | N/A |
| lentiCRISPRV2-sgATRX#11-hygro | This paper | N/A |
| pMD2.G | Addgene | 12259 |
| psPAX2 | Addgene | 12260 |
| Software and Algorithms | ||
| Image J | NIH | https://imagej.nih.gov/ij/ |
| Graphpad Prism 9 | GraphPad software Inc. | https://www.graphpad.com/ |
| Nikon NIS-Elements | Nikon | https://www.microscope.healthcare.nikon.com/products/software/nis-elements |
| EPSON Scan | EPSON | https://www.epson.com/usa |
| Cell Profiler | Broad Institute | https://cellprofiler.org/ |
| Snapgene | Snapgene | https://www.snapgene.com/ |
