In Silico Identification and Characterization of Fatty Acid Desaturase (FAD) Genes in Argania spinosa L. Skeels: Implications for Oil Quality and Abiotic Stress

Abstract

Fatty acid desaturase (FAD) is the key enzyme that leads to the formation of unsaturated fatty acids by introducing double bonds into hydrocarbon chains, and it plays a critical role in plant lipid metabolism. However, no data are available on enzyme-associated genes in argan trees. In addition, a candidate gene approach was adopted to identify and characterize the gene sequences of interest that are potentially involved in oil quality and abiotic stress. Based on phylogenetic analyses, 18 putative FAD genes of Argania spinosa L. (AsFAD) were identified and assigned to three subfamilies: stearoyl-ACP desaturase (SAD), Δ-12 desaturase (FAD2/FAD6), and Δ-15 desaturase (FAD3/FAD7). Furthermore, gene structure and motif analyses revealed a conserved exon-intron organization among FAD members belonging to the various oil crops studied, and they exhibited conserved motifs within each subfamily. In addition, the gene structure shows a wide variation in intron numbers, ranging from 0 to 8, with two highly conserved intron phases (0 and 1). The AsFAD and AsSAD subfamilies consist of three (H(X)2-4H, H(X)2-3HH, and H/Q (X)2-3HH) and two (EEN(K)RHG and DEKRHE) conserved histidine boxes, respectively. A set of primer pairs were designed for each FAD gene, and tested on DNA extracted from argan leaves, in which all amplicons of the expected size were produced. These findings of candidate genes in A spinosa L. will provide valuable knowledge that further enhances our understanding of the potential roles of FAD genes in the quality of oil and abiotic stress in the argan tree.

Introduction

The argan tree (Argania spinosa L. Skeels) is a species endemic to Morocco in the Sapotaceae family. These species are known for their resistance to drought and heat because of their abundance in arid and semi-arid areas of southwest Morocco. ¹ It is a valuable resource for a country’s economy and environment.

Argan oil, now widely recognized as one of the most expensive woody oil plants, has traditionally been used in local cuisine, medicine, and cosmetics. It has also been used to prevent certain cardiovascular diseases. Its advantages are due to its balanced composition of fatty acids, principally oleic, linoleic, and palmitic acids, and other minor compounds, including polyphenols, tocopherols, and sterols, which confer antioxidant properties. ² However, linoleic and α-linolenic acids cannot be synthesized by the human body and must be obtained from dietary sources. ³

With their function as energy reserves and status as the primary components of plant cells, fatty acids serve numerous roles in plant metabolism, membrane function, hormonal signaling, and plant development. ⁴ The fatty acid composition of argan oil shows a predominance of oleic and linoleic acids. ⁵ According to its composition, argan oil is an oil of the oleic/linoleic type consisting of almost 80% unsaturated fatty acid. Palmitic acid constitutes the largest proportion of saturated fatty acids, whereas linolenic acid constitutes less than 0.25%. ⁶

Oil quality depends on the content of unsaturated fatty acids. ⁷ The biosynthesis of fatty acids represents the key step in the formation of the oil body, so the enzymes involved in elongation and desaturation play a major role in the formation of fat, which are regulated by several genes that give them a predisposition in terms of quality. ⁸ These genes belong to the family of fatty acid desaturases (FADs). ⁹ The desaturation reactions carried out by FADs are essential for the production of unsaturated fatty acids, because they lead to the formation of double bonds. ¹⁰ Based on their solubility, FADs are classified into two main groups: membrane-bound desaturases and soluble desaturases. ¹¹ Stearoyl-ACP-desaturase (SAD) is the only soluble FAD desaturase found in the plastid matrix, whereas membrane-bound FAD desaturases are present in a range of organisms including plants, algae, animals, and fungi. ¹² SAD, FAD4, FAD5, FAD6, FAD7, and FAD8 are groups of enzymes found in plastids that play vital roles in lipid desaturation reactions. ¹³ In contrast, FAD2 and FAD3 are located in the endoplasmic reticulum (ER) and are responsible for directing the desaturation of lipids that are not located in the chloroplast. ¹⁴ The conversion of oleic acid (18:1) to linoleic acid (18:2) is catalyzed by FAD2 in the ER and FAD6 in the plastid, while the desaturation of linoleic acid (18:2) to linolenic acid (C18:3, n6) takes place in the ER and plastids by FAD3 and FAD7/FAD8, respectively. ⁷ FAB2/SAD introduces a double bond to saturated stearic acid (18:0) to convert it into unsaturated oleic acid (18:1). ¹⁵ There are two electron donors that lead to the formation of the double bond: NADPH/ferredoxin, and NADH/cytochrome b5 found in the chloroplast and ER, respectively. ¹⁶

The plant FADs have equal significant functions in responding to abiotic stresses, including high temperatures, salt, and cold. ¹⁷ Specifically, studies have demonstrated that the overexpression of FAD2 and FAD6 in Arabidopsis significantly increased tolerance to salt stress.^18,19 Furthermore, overexpression of FAD7 contributes to the reduction of damage caused by cold stress in tobacco. ²⁰ Similarly, NtFAD3 and NtFAD8 can promote tobacco drought stress. ²¹ To date, numerous genome sequencing studies conducted on various plants have served as a crucial resource for the genome-wide analysis of the FAD gene family in these plant species. For instance, studies have identified 27 FAD genes in wild olives, ²² 23 in cucumbers, ²³ 27 in bananas, ⁴ and 21 in chickpeas. ²⁴ However, no information is available on this gene family in A spinosa L.

To gain a deeper understanding of their evolution and to improve their role in tolerance to abiotic stress, the identification and characterization of FAD genes from the published Argan genome are necessary. Therefore, in this study, we present the first genome-wide identification of FAD genes in A spinosa L. To this end, we investigated the in silico identification of FAD genes and subsequently characterized their phylogenetic relationships, gene structure, transmembrane (TM) domains, conserved motifs, and three-dimensional (3D) modeling. In addition, we developed specific primers from the identified Argan FAD genes and validated numerous DNA accessions of A spinosa L. species.

Materials and Methods

Identification of Argan FAD gene family and sequences analysis

To identify all members of the FAD and SAD genes in A spinosa L., 33 sequences encoding FAD and SAD proteins from oil plants, such as O europaea L., Sesamum indium L., and Arabidopsis thaliana L., were retrieved from the NCBI database (Supplemental Table S1). These sequences were used as queries to confront them with the Argan genome using the BLAST tool (tBLASTn) with the E-value set to 1 × 10⁻⁵. The contigs obtained from the BLAST results were analyzed using the AUGUSTUS tool to obtain the coding and complete sequences of the predicted FAD and SAD genes. All candidate sequences were further analyzed using the Pfam tool (http://pfam.xfam.org) to confirm all putative AsFAD members by the presence of the domain kept under the name “desaturase”. The physicochemical features of the AsFAD and AsSAD proteins were detected using the ProtParam tool ExPASy (http://web.expasy.org/protparam/). ²⁵ The subcellular localization of the proteins was analyzed using WoLFPSORT (https://wolfpsort.hgc.jp/) and Plant-mPLoc (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/).^26,27

Gene structure and protein motif analysis of AsFADs family

Intron-exon structures and the type of splicing of genes in the AsFAD family were visualized using the Gene Structure Display Server (http://gsds.cbi.pku.edu.cn/) by comparing the complementary DNA sequences with their corresponding genomic DNA sequences retrieved from the AUGUSTUS gene annotation file. ²⁸ The conserved motifs of all putative AsFAD proteins were predicted using MEME version 5.4.1 (https://meme-suite.org/tools/meme/), with the following parameters: maximum number of motifs of 6 and 10 for SAD and FADs, respectively; minimum motif width ranging from 5 to 50 residues; minimum number of sites as 2; and distribution of motifs as 0 or 1. ²⁹ The predicted functionality of the identified motifs was determined using the Pfam server (http://pfam.xfam.org). ³⁰

Multiple sequence alignment and phylogenetic analysis

Multi-alignment of the identified FADs from A spinosa L. with FADs from O europaea L., S indium L., Theobroma cacao L., Linum usitatissimum L., and A thaliana L. was performed using Clustal Omega. Additional analysis was conducted on the alignment files to identify any conserved histidine-rich boxes. A neighbor-joining phylogenetic tree was constructed using MEGAX. ³¹ Bootstrapping was carried out with 1000 replicates for statistical reliability. ³²

The prediction of cis-elements within the promoter regions of AsFAD genes

Using TBtools, the 1500 bp regions located before the ATG start codon of each AsFAD gene were retrieved from the Argan genome draft database, and subsequently evaluated for potential cis-acting elements and transcription factor-binding sites through the use of PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/). ³³

Predicted 3D structures of AsFAD proteins

The 3D structure model and the AsFAD template were performed by the Phyre2 Software server (http://www.sbg.bio.ic.ac.uk/~phyre2/html/page.cgi?id=index). The detection rate in the Phyre2 database was used to identify a homology model using hidden markov model (HMM) scanning. ³⁴ Templates with the highest-scoring crystal structure were selected for model building. The TM helices were predicted from the topology sequence analyzed using Phyre2.

Designing and validation of primers

The Primer3 online tool (https://bioinfo.ut.ee/primer3/) was used to design primers. All predicted argan gene sequences were used to design the primers flanking the desired parts according to the following thresholds: oligonucleotide length between 16 and 26 nucleotides, GC rate 40% to 70% (ideally around 55%), melting temperature (~60 °C), mononucleotide tracks shorter than 3, product length between 120 and 800 bp, and self-dimerization of primers—not acceptable. In addition, hairpin structure formation and cross-dimerization were verified using the PCR Primer Stats tools (https://www.bioinformatics.org/sms2/pcr_primer_stats.html).

The designed primer pairs were commercially synthesized and validated to test their effectiveness. To accomplish this, genomic DNA was extracted from young leaves of A spinosa L. using ISOLATE PLANT KIT (Bioline, London) following the manufacturer’s protocol. Subsequently, polymerase chain reaction (PCR) amplification was performed in a 25-μl reaction volume using MyTaq TM HS Mix (Bioline, London) according to the manufacturer’s guidelines. The PCR products were visualized on 2% agarose gel.

Results

Identification of FAD genes in A spinosa L

We identified 18 distinct AsFAD genes (non-redundant sequences) in the A spinosa L. genome (9 FADs and 9 SADs). They were named AsFAD and AsSAD according to their phylogenetic analysis results (Supplemental Table S1). Genomic DNA, CDS, and amino acid sequences are shown in Supplemental Figure S1. The full-length DNA sequences of the putative AsFAD genes ranged from 1398 (AsFAD2-a) to 8174 bp (AsFAD6). The shortest CoDing Sequence (CDS) length was 999 bp (AsSAD1-4), and the longest one contained 1371 bp (AsFAD7-b). The AsFAD and AsSAD peptide sequences contain 332 (AsSAD4) to 456 (AsFAD7-b) amino acids, with a predicted molecular weight of 38.06 kDa to 52.03 kDa and theoretical isoelectric points of 5.19 to 9.32 (Table 1). The cellular localization of proteins was investigated, and the findings indicated that AsSAD demonstrated activity in the ER, whereas AsFAD was found in the chloroplast, except for AsFAD6, which was located in the ER.

Table 1.

Information of the predicted FAD family in Argania spinosa L. (AsFAD).

Groups	Predicted genes	Contigs	Amino acid lengths(aa)	CoDing Sequence (CDS) length (bp)	Length of genomic DNA (bp)	Start positions (bp)	End positions (bp)	Intron numbers	Exon numbers	pI	MW (kDa)	Subcellular localizations
FAD	AsFAD2-a	QLOD01000980.1	383	1152	1398	6900	8298	0	1	7.34	44.3	ER
	AsFAD2-b	QLOD01014567.1	387	1164	1795	42836	44631	0	1	8.72	44.91	ER
	AsFAD2-c	QLOD01063726.1	384	1155	6497	3826	10323	0	1	8.57	44.09	ER
	AsFAD3-a	QLOD01071667.1	434	1305	6098	33786	39884	8	9	8.49	49.52	ER
	AsFAD3-b	QLOD01024743.1	412	1239	5464	168226	173690	8	9	8.79	47.72	ER
	AsFAD6	QLOD01003815.1	376	1131	8174	91847	100021	8	9	9.32	42.96	Chlo
	AsFAD7-a	QLOD01071352.1	450	1353	3005	65746	68751	7	8	8.45	51.2	ER
	AsFAD7-b	QLOD01003562.1	456	1371	2961	84316	87277	7	8	8.57	52.03	ER
	AsFAD2-d	QLOD01063727.1	440	1323	2645	5836	8481	1	2	8.87	50.24	ER
SAD	AsSAD1	QLOD01074982.1	332	999	2228	1543	3771	1	2	5.32	38.14	Chlo
	AsSAD2	QLOD01074982.1	449	1350	4600	13591	18191	4	5	7.68	50.49	Chlo
	AsSAD3	QLOD01074982.1	405	1218	4123	24498	28621	2	3	7.66	46.24	Chlo
	AsSAD4	QLOD01075084.1	332	999	3504	80117	83621	1	2	5.19	38.06	Chlo
	AsSAD5	QLOD01075084.1	390	1173	4539	100972	105511	2	3	6.24	44.6	Chlo
	AsSAD6	QLOD01062571.1	427	1284	3193	22728	25921	3	4	5.71	48.34	Chlo
	AsSAD7	QLOD01062447.1	390	1173	4114	1927	6041	2	3	7.66	44.65	Chlo
	AsSAD8	QLOD01022196.1	387	1164	2112	3232	5344	1	2	6.15	43.61	Chlo
	AsSAD9	QLOD01071541.1	399	1200	6035	936	6971	2	3	6.68	45.74	Chlo

Abbreviations: Chlo, chloroplast; ER, endoplasmic reticulum; MW, molecular weight; pI, theoretical isoelectric point.

Phylogenetic analysis of AsFAD proteins

A neighbor-joining phylogenetic tree was constructed using FADs from various oilseed species, such as Olive, Sesame, Cacao, Flax, and a model plant Arabidopsis, to determine the evolutionary relationship among AsFADs. The results of the phylogenetic tree construction based on multiple sequence alignments indicated that the AsFAD gene has high homology with other oilseed genes.

Based on the phylogenetic tree, the AsFAD proteins were categorized into three separate subfamilies according to their desaturation group (Figure 1). The Δ-15 desaturase group consisted of 14 members, including the FAD3 and FAD7 families, in which A spinosa L. comprised four members. Both FAD7 and FAD3 members were in the same group because of the high homology of their sequences. The Δ-12 desaturase group consisted only of FAD2 and FAD6 proteins, and was observed in all oilseed plants included in this study. Furthermore, all the FAD5 members were present in the front-end desaturase group. However, members of the SAD protein group were primarily found in the SAD group.

Figure 1.

Phylogenetic analysis of A. spinosa L., FAD and SAD genes. Phylogenetic tree for FAD gene family was constructed by the “Neighbour-Joining” method using MEGA X with 500 bootstraps using orthologs from Olea europaea L., Sesamum indium L., Theobroma cacao L., Linum usitatissimum L., and Arabidopsis thaliana L.

Different clusters of tree are marked with different colors: Δ-12 desaturase (blue), Δ-15 desaturase (purple), stearoyl-ACP desaturase (green), and front-end desaturase (orange).

Analysis of gene structure and conserved motifs of AsFAD proteins

To gain further insight into the structural diversity of FADs, we investigated the structures of AsFAD genes. Figure 2 shows the exon-intron organization of the AsFAD and AsSAD genes, and varying positions and lengths were observed among all the genes. The number of exons ranged from 1 to 9. The AsFAD3 and AsFAD6 subfamilies were characterized by nine exons, whereas the AsFAD7 subfamily contained eight exons. However, AsFAD2 contains one and two exons. The number of exons in the AsSAD subfamily ranged from two to four. Most of the AsSAD subfamily contains three exons, with the exception of AsSAD1/4/8, AsSAD6, and AsSAD2 with two, four, and five exons, respectively. All splicing phases (phases 0, 1, and 2) were observed for the AsFAD gene family; AsFAD3, AsFAD6, and AsSAD2 showed all three intron splicing phases, whereas AsFAD7 and AsSAD9 subfamilies had phases 0 and 2. Similarly, AsSAD3, AsSAD5, AsSAD6, and AsSAD7 demonstrated phases 0 and 1.

Figure 2.

Exon-intron structure of A. spinosa L. FADs using a Gene Structure Display Server.

Yellow represents exons; blue represents the 3′ and 5′ untranslated region (UTR) regions; and the gray lines represent introns.

Using the MEME web server, we identified 10 and 6 conserved motifs in the AsFAD and AsSAD subfamilies, respectively (Figures 3 and 4). Subsequent analysis with Pfam revealed that both conserved motifs 1 and 2 of AsFAD belonged to the “FA_desaturase,” and the function of other motifs was not detected (Supplemental Table S4). Moreover, all six conserved motifs in the AsSAD subfamily are associated with the “FA_desaturase_2” (Figure 3). The AsFAD2 subfamily is composed of eight motifs 1, 2, 3, 4, 5, 6, and 10, while motifs 1 to 9 were harbored in AsFAD3 and AsFAD7. Both the AsFAD6 and AsFAD8 subfamily members had only two motifs, 1 and 2. In addition, motif 10 characterized AsFAD2 members, whereas motifs 8 and 9 were found just in AsFAD3/7 members (Figure 4).

Figure 3.

Identification of conserved motifs in A. spinosa L. FADs.

Ten conserved motifs are presented in different colors. The identified motifs were detected by MEME online tool.

Figure 4.

Identification of conserved motifs in A. spinosa L. SADs.

Ten conserved motifs are presented in different colors. The identified motifs were detected by MEME online tool.

Based on the multiple sequence alignment (Figures 5 and 6) of the Arabidopsis homologs and the AsFAD proteins, three conserved histidine-rich boxes of membrane-bound FADs H(X)2-4H (His-Box1), H(X)2-3HH (His-Box2), and H/Q (X)2-3HH (His-Box3) were observed, except for AsFAD6, which contains only two His-boxes (1 and 2). All AsFAD2 proteins contained three conserved His-boxes, HECGH, HRRHH, and HVAHH. However, AsFAD3/7 showed a variable second residue with the E residue replaced by D in His-Box1, whereas the third R and A residues were replaced by T and I residues in His-Box2 and His-Box3, respectively (Table 2). The members of the AsSAD family were quite divergent in residues in both His-Box1 and His-Box2 when compared with AsFAD members. They contained two conserved histidine boxes: EENRHG and DEKRHE (Table 2).

Figure 5.

Multiple sequence alignment of A. spinosa L. SAD genes.

The red rectangles represent conserved motifs (EENRHG, DEKRHE), which represent two His-boxes.

Figure 6.

Multiple sequence alignment of A. spinosa L. FAD genes.

The red rectangles represent conserved motifs (H(X)2-4H, H(X)2-3HH, and H/Q(X)2-3HH), which represent three His-boxes.

Table 2.

The conserved histidine boxes of the FAD family proteins in Argania spinosa L.

Type	Protein	His-Box1		His-Box2		His-Box3
		Sequence	Position	Sequence	Position	Sequence	Position
ω-3/Δ-5	AsFAD3-a	HDCGH	151-155	HRTHH	187-191	HVIHH	354-358
	AsFAD7-a	HDCGH	168-172	HRTHH	204-208	HVIHH	371-375
	AsFAD3-b	HDCGH	128-132	HRTHH	164-168	HVIHH	332-336
	AsFAD7-b	HDCGH	175-179	HRTHH	211-215	HVIHH	378-382
ω-6/Δ-12	AsFAD2-a	HECGH	105-109	HRRHH	141-145	HVAHH	315-319
	AsFAD2-b	HECGH	107-112	HRRHH	143-147	HVAHH	317-321
	AsFAD2-c	HECGH	106-111	HRRHH	142-146	HVAHH	316-320
	AsFAD2-d	HDSGH	151-155	HNAHH	188-192	QVEHH	365-369
	AsFAD6	HDCAH	168-172	HDQHH	204-208	—	—
Δ-9	AsSAD1	EENRHG	111-116	DEKRHE	198-203	—	—
	AsSAD2	EENRHG	184-189	DEKRHE	270-275	—	—
	AsSAD3	EENRHG	184-189	DEKRHE	270-198	—	—
	AsSAD4	EENRHG	111-116	DEKRHE	197-202	—	—
	AsSAD5	EEKRHG	170-175	DEKRHE	256-261	—	—
	AsSAD6	EENRHG	206-211	DEKRHE	292-297	—	—
	AsSAD7	EEKRHG	170-175	DEKRHE	256-261	—	—
	AsSAD8	EENRHG	163-168	DEKRHE	249-254	—	—
	AsSAD9	EENRHG	177-182	DEKRHE	263-268	—	—

Cis elements in the promoters of AsFAD genes

We conducted additional research on cis-regulatory elements found in the promoter regions of AsFADs. Our findings revealed that the AsFAD gene family contains 79 cis-elements that can control gene expression in response to four categories: light, hormone-responsive, stress, and plant growth and development (Figure 7, Supplemental Material). The findings showed that the AsFADs promoters shared similar cis-regulatory components, such as CAAT-box, TATA-box, and MYC. Multiple cis-regulatory elements associated with plant hormone responses, including methyl jasmonate (MeJA)-, salicylic acid (SA)-, abscisic acid (ABA)-, gibberellin-, auxin-, and ethylene-responsive elements, were identified in the AsFADs promoters, with ABA-responsive elements (28) within the highest number. In addition, all AsFADs promoters were found to contain light-responsive elements, with Box 4 being the most abundant element (48), present in all the promoters except for AsFAD2-d, AsFAD7-a, AsSAD1, AsSAD2, and AsSAD9. Several stress-responsive elements were present in the AsFADs promoters. Of these, the largest number (52) belonged to the drought-responsive elements (MYC). In addition, certain cis-regulatory elements related to plant growth and development were discovered in AsFADs promoters, such as the A-box for specific day length, O2-site for zein metabolism, CCGTCC-box for meristem-specific gene activation, CCAAT-box for MYBHv1 binding, and AAGAA-motif for seed-specific expression.

Figure 7.

Distribution of cis-acting regulatory elements in the AsFAD promoter.

Predicted 3D structures of AsFAD proteins

The 3D and TM structures of the AsFADs were predicted by Phyre2 tool (Figure 8). The percentage of modeled residues ranged from 14% to 91% at >98% CI (Supplemental Table S2). The crystal structure of the human integral membrane stearoyl-CoA desaturase-2 was used for the protein model as the template structure for the AsFAD2 subfamily, while the crystal structure of stearoyl-coenzyme A desaturase-1 was used for other AsFAD members. All members of the AsSAD subfamily have ribonucleotide reductase-like template structures. The modeled structure of AsFADs showed two protein secondary structures: alpha helices and beta sheets. Common characteristics of all members of the AsFAD family include six TM helices (TM1-6; Figure 9).

Figure 8.

Predicted 3D structures of A. spinosa L. FAD proteins.

The 3D structure model and the template of AsFADs were performed by the Phyre2 Software server (http://www.sbg.bio.ic.ac.uk/~phyre2/html/page.cgi?id=index).

Figure 9.

The predicted transmembrane topology of A. spinosa L. FAD from Phyre2.

Designing and validation of primers

The details of the primer sets are summarized in Table 3, Supplemental Table S3. Nine FAD and nine SAD gene sequences, predicted from Argan genome, were analyzed to identify candidate primer sequences. Five primer pairs were designed for each gene, resulting in 90 primer pairs. Of these, 14 primers were selected based on the best characteristics, were commercially synthesized by Biologicio, and were successfully tested by PCR on three samples of genomic DNA extracted from Argan leaves. After numerous optimizations of the PCR amplification process, 11 primer pairs were found to amplify the expected genomic DNA in all samples (as shown in Figure 10). The expected product ranged from 197 (AsSAD7) to 1743 bp (AsSAD9).

Table 3.

The 11 pair primers successfully amplified the expected size of gDNA in A. spinosa L.

Primer name	Primer sequence	PCR product	Annealing TM
AspSAD1 p1	5′ AACTAAGGGCAAGGGCAAAT 3′ 3′ TCATGTCTACGCGTCCAGAG 5′	243	55.6
AspSAD2 p5	5′ TTCTTCGAGAAAGCCAAGGA 3′ 3′ CATGTCGGTTCTCTTCAGCA 5′	214	55.25
AspSAD4 p2	5′ GGAAAGGGCAAAGGAGATTC 3′ 3′ GGTCACCATGCCTGTTTTCT 5′	194	53.3
AspSAD6 p2	5′ GCTGCGAGAAAGATCAAAGG 3′ 3′ GCTTCATGTCAACTCGTCCA 5′	245	55.4
AspSAD7 p2	5′ ATTCCATGCCACCTGAAAAG 3′ 3′ CAAACAATCGTCCGGAATCT 5′	197	53.1
AspSAD9 p1	5′ AGCCTCAATCCTTGGGCTAT 3′ 3′ AAGCCTCGCTGTGTTTCTGT 5′	246	56.3
AspFAD2-a p2	3′ CAAGTCCCAAATCTCGTGGT 5′ 5′ CCGACATCCGAAACGTAGAT 3′	210	54.4
AspFAD2-b p1	3′ GCAGTAAAAGGGCTTGCTTG 5′ 5′ GAGGGATCGTGGAGAACAAA 3′	247	54.5
AspFAD2-c p2	3′ GACTTCGCCATCGTTTTCAT 5′ 5′ GTAAGGGACGAGGAGGGAAG 3′	228	54.7
AspFAD3-a p2	5′ GAGCTGCTATTCCCAAGCAC 3′ 3′ TGCAAGAGATGTCCAACAGC 5′	250	55.95
AspFAD3-b p5	5′ AGGGGAGGGCTTACAACAGT 3′ 3′ AAAGTGGTCTTGCCTGATGC 5′	237	55.3

Abbreviation: PCR, polymerase chain reaction; TM, melting temperature

Figure 10.

An example of PCR amplification of DNA of three samples (1, 2, 3) extracted from argan leaves by three specific primers (FAD2-a, FAD2-b, and FAD2-c) on 2% agarose gel. M: 100 bp DNA marker. PCR indicates polymerase chain reaction.

Discussion

With the increasing number of plant genome sequences being generated, there are greater opportunities to explore the field of functional genomics and improve the accuracy of annotating newly discovered genes. Accordingly, genome-wide identification methods provide higher accuracy for characterizing multiple gene families, including the FAD gene family. To date, a large number of FAD homologs have been identified and characterized in several plant species, including 29 FADs in soybean, ¹⁵ 33 in sunflower, ³⁵ 17 in Arabidopsis, ³⁶ 36 in peanuts, ³⁷ and 41 in Raymond cotton. ³⁸ In the current study, we performed the first investigation of FAD in Argan and identified 18 putative members of the FAD gene family in A spinosa L. This number was consistent with the Kabuli chickpea genome, as predicted by Saini and Kumar, ³⁶ and higher than that identified in Arabidopsis (17). The SAD subfamily in A spinosa L. has the highest number with nine members in comparison with other oil crop species such as O europaea L. and S indium L. Therefore, numerous species showed variety in their number of FAD gene families, as a result of species-specific process expansion induced by gene duplication events. ³⁹ Moreover, this expansion may be associated with the large genome size of each species. ⁴⁰

There are two distinct pathways in plants that lead to the biosynthesis of polyunsaturated fatty acids in the plastid and ER. ⁴¹ According to our results, the subcellular localization of AsFAD and AsSAD is chloroplast/ER and chloroplast, respectively, which is in agreement with a previous study.^9,42 Desaturation reactions are divided into two major classes: soluble FAD proteins and membrane-bound FAD. ⁴ As per the findings of the phylogenetic analysis, four subfamilies of desaturases have been identified, namely Δ-12 desaturase (FAD2/FAD6), Δ-15 desaturase (FAD3/FAD7), SAD, and front-end desaturase (FAD5). This clustering of AsFAD proteins is in agreement with that observed in other plants, including O europaea L., ⁴³ Triticum aestivum L., ⁴⁴ and A thaliana L. ⁴⁵ It could be suggested that the distribution of Argan FAD proteins throughout evolution is linked to their motif content, as the amino acid compositions within each cluster were similar. SAD is the only identified soluble desaturase present in plants and is responsible for the conversion of stearic acid (18:0-ACP) to oleic acid (18:1 Δ9-ACP). ⁴⁶ Similarly, our results showed that A spinosa L. contains this type of gene, which could have the possibility of desaturation. The AsSAD subfamily was clustered close to the SAD protein from olive. On the other hand, the membrane-bound FAD known as FAD2/6 genes encoding Δ-12 desaturase/ω-6 enzyme, which catalyzed the desaturation of oleic acid (18:1 Δ9) to linoleic acid (18:2 Δ9,12), The FAD3/7/8 genes encoding Δ-12 desaturase/ω-6 enzyme, which performed the conversion of linoleic acid (18:2 Δ9, 12) to linolenic acid (18:3 Δ9, 12, 15), The FAD5 genes encoding front-end desaturase enzymes that convert palmitic acid (16:0) to palmitoleic acid (16:1) were grouped into the same clusters with an exact distinction in the phylogenetic tree.

The splicing phase and exon-intron structures play an important role in the evolution of gene families. ⁴⁷ The two intron phases (0 and 1) in AsFAD were highly conserved, whereas intron phase 2 exhibited the lowest level of conservation. The same result for the splicing phase was observed in other plants, demonstrating that FAD genes have been highly conserved throughout evolution. ¹⁵ Analysis of the structure of AsFAD genes revealed a similar intron-exon distribution pattern within the AsFAD subfamily in terms of length. Eg, AsFAD2, AsFAD3, AsFAD6, and AsFAD7 are highly conserved. Motif analysis showed that all AsFAD genes contained motifs 1 and 2. The AsFAD3/7 subfamily had all motifs, except motif 10, which is why they were clustered into the same group. The AsFAD2 subfamily was clustered into one group because of the presence of similar motif content. The AsFAD6 and AsFAD2-d subfamilies had only two motifs. In contrast, the AsSAD subfamily contained all six motifs; thus, it was grouped in a separate cluster from the AsFAD subfamily. AsFAD and AsSAD showed the presence of FA_desaturase and FA_desaturase_2 domains, respectively. Three histidine boxes were observed in the AsFAD subfamily, with the exception of AsFAD6, which had two His-boxes. AsFAD proteins contained a consensus sequence of H/Q(X)2HH for their third His-box, which was situated at their carboxy terminus. This sequence was found in FAD protein sequences across different plant species, suggesting a relationship between them. ¹⁶ With the exception of AsFAD2-d, the number of residues between the first and second His-boxes remained consistently conserved among members of the AsFAD subfamily. Histidine boxes are significantly involved in the development of the di-iron center, which is responsible for both oxygen activation and substrate oxidation. ²³ The histidine-rich regions of FAD proteins exhibit a high degree of conservation in their amino acid sequence. ⁴⁸

To enhance our comprehension of the transcriptional regulation and potential functional roles of AsFAD genes, we conducted a gene promoter analysis, which showed that most of the AsFAD genes contain a cis-element that plays a role in responding to different types of stress within their promoter regions, including light, hormone-responsive (such as ethylene, ABA, and SA), stress (such as defense, wound, and cold/dehydration), and plant growth and development. This suggests that AsFAD genes have various functions in different stress regulatory networks. ⁴⁹ Regulation of signaling pathways in response to abiotic stress is crucial, and transcription factors are key players in this process. ⁵⁰ This is achieved by binding to the promoters of specific genes and controlling their activation or inhibition. Desaturases are known to respond to various types of stress, such as low temperatures, where the expression of FAD genes is modified, leading to alterations in the fluidity of membrane lipids and ultimately enhancing the ability of plants to withstand cold conditions. ⁵¹

Desaturation reactions by FADs are necessary for the biosynthesis of fatty acids because they lead to the formation of double bonds in the hydrocarbon chains of fatty acids. The presence of unsaturated fatty acids in vegetable oils is directly linked to their nutritional value and resistance to oxidation. Discovering AsFAD genes will facilitate the creation of enhanced A spinosa L. plants, which will not only have improved nutritional value but also greater resistance to diverse environmental factors. The current study contributes to the understanding of the potential functions and evolution of the AsFAD genes. Dar et al ⁵² clarified the importance and key role of FAD2 in cold and salt tolerance, plant development, and fatty acid biosynthesis in plants. Research has demonstrated that the linolenic acid content of plants is closely linked to the activity of the FAD3 gene, and plays a vital role in regulating plant fatty acid composition, which directly affects oil quality. Furthermore, Zhang et al ⁵³ showed that MsFAD3 is involved in the synthesis of α-linolenic acid and that the α-linolenic acid content was significantly increased in MsFAD3 overexpression transgenic alfalfa lines. In our study, AsSAD presented the highest number of gene copies (9), which may be related to the highest percentage of oleic acid in argan oil. ⁵⁴

Recognizing the central role of FAD genes in plant development, stress response, quality oil, and other physiological processes, it is important to develop molecular markers (candidate primers) for FAD and SAD genes in A spinosa L. These markers can be useful for identifying and selecting desirable traits such as increased oil content, improved nutritional quality, and enhanced stress tolerance, all of which are critical for sustainable agriculture and food security. To achieve this, 14 specific primer pairs were developed for both FAD and SAD genes in the Argan genome, which were validated to identify the presence of these genes. Most of these primer pairs (11) showed reliable amplification of the expected size. Based on these results, the identified candidate primers could be considered as potential markers for the selection of valuable ecotypes in Argan. Furthermore, it would be helpful to conduct studies on the functional genomics of A spinosa L., such as gene expression studies, to improve the quality of its oil.

Conclusion

In conclusion, we presented a comprehensive in silico study of FAD-encoding genes in the Argan genome. To the best of our knowledge, this is the first genome-wide study on the Argan FAD gene family. Overall, 18 putative FAD genes (AsFAD and AsSAD) in A spinosa L. were phylogenetically clustered into two main classes (membrane-bound desaturases and soluble desaturases). In addition, each subfamily demonstrated a high degree of consistency in subcellular localization, motif composition, and exon-intron organization. Eleven pairs of primers were designed, tested, and validated on genomic DNA extracted from three accessions of argan leaves. Our comprehensive analysis of FAD genes in this study not only screened candidate genes for functional validation but also provided resources and references to enhance the abiotic stress and oil quality of A. spinosa L. oil.