Skip to main content
NCBI home page
International Journal of Ophthalmology logoLink to International Journal of Ophthalmology
. 2024 Mar 18;17(3):444–453. doi: 10.18240/ijo.2024.03.05

Semaphorin 7A impairs barrier function in cultured human corneal epithelial cells in a manner dependent on nuclear factor-kappa B

Cheng-Cheng Yang 1, Xiu-Xia Yang 1, Xiao-Jing Zhao 1, Heng Wang 2, Zi-Han Guo 3, Kai Jin 1, Yang Liu 1,✉, Bin-Hui Li 1,✉
PMCID: PMC11074170  PMID: 38721522

Abstract

AIM

To evaluate the role of semaphorin 7A (Sema7A) and its associated regulatory mechanisms in modulating the barrier function of cultured human corneal epithelial cells (HCEs).

METHODS

Barrier models of HCEs were treated with recombinant human Sema7A at concentrations of 0, 125, 250, or 500 ng/mL for 24, 48, or 72h in vitro. Transepithelial electrical resistance (TEER) as well as Dextran-fluorescein isothiocyanate (FITC) permeability assays were conducted to assess barrier function. To quantify tight junctions (TJs) such as occludin and zonula occludens-1 (ZO-1) at the mRNA level, reverse transcription-polymerase chain reaction (RT-PCR) analysis was performed. Immunoblotting was used to examine the activity of the nuclear factor-kappa B (NF-κB) signaling pathway and the production of TJs proteins. Immunofluorescence analyses were employed to localize the TJs. Enzyme-linked immunosorbent assay (ELISA) and RT-PCR were utilized to observe changes in interleukin (IL)-1β levels. To investigate the role of NF-κB signaling activation and IL-1β in Sema7A's anti-barrier mechanism, we employed 0.1 µmol/L IκB kinase 2 (IKK2) inhibitor IV or 500 ng/mL IL-1 receptor (IL-1R) antagonist.

RESULTS

Treatment with Sema7A resulted in decreased TEER and increased permeability of Dextran-FITC in HCEs through down-regulating mRNA and protein levels of TJs in a time- and dose-dependent manner, as well as altering the localization of TJs. Furthermore, Sema7A stimulated the activation of inhibitor of kappa B alpha (IκBα) and expression of IL-1β. The anti-barrier function of Sema7A was significantly suppressed by treatment with IKK2 inhibitor IV or IL-1R antagonists.

CONCLUSION

Sema7A disrupts barrier function through its influence on NF-κB-mediated expression of TJ proteins, as well as the expression of IL-1β. These findings suggest that Sema7A could be a potential therapeutic target for the diseases in corneal epithelium.

Keywords: human corneal epithelial, barrier function, transepithelial electrical resistance, zonula occludens-1, occludin, nuclear factor-kappa B

INTRODUCTION

The corneal epithelium is a protective barrier between the outside world and the eyes[1]–[2]. The epithelial barrier and its integrity are essential for corneal homeostasis and resistant to environmental contaminants[3]–[4]. Disruptions in the epithelial barrier function and increased permeability have been associated with various eye disorders[1],[4], including diabetic keratopathy[5]–[6] and dry eye disease[7]. Human corneal epithelial cells (HCEs) exert their protective effect on eyes by through their barrier function, which is largely regulated by tight junctions (TJs)[8]. TJs, consisting of signaling molecules such as zonula occludens-1 (ZO-1), claudins, and occludin, are located on the surface of the corneal epithelium and contribute to enhancing the cornea's barrier function[9]–[10]. Dysregulated expression of these genes often serves as diagnostic markers for impaired epithelial barrier function[10].

Semaphorins represent a diverse family of membrane-anchored or released proteins, divided into eight subclasses based on structural characteristics and sequence similarity[11]. Although our understanding of the role of semaphorins in epithelial barrier function, particularly their direct impact on TJs, remains limited[12], certain semaphorins, such as 3A, 3B, 3C, and 3F, have been found to enhance epithelial barrier function, while others, like 4D and 3E, promote barrier disruption, particularly in cancer progression[12]. Among the semaphorins, semaphorin 7A (Sema7A) stands out as the sole member of class VII due to its unique glycosylphosphatidylinositol (GPI) anchoring on the cell membrane[13]. Initially discovered as neuronal guidance proteins[14], Sema7A also exhibits various immunoregulatory and tumor-related actions, including influencing cell infiltration, interaction[15], and angiogenesis[16]. Previous research has primarily focused on the relationship between Sema7A and junctions in tumors. Sema7A has been shown to be necessary for transforming growth factor (TGF)-β-mediated epithelial-to-mesenchymal transition by downregulating E-cadherin in mammary epithelial cells[17].

Sema7A is constitutively expressed in the cornea and is known to stimulate neuronal regeneration, inflammatory cell influx[18], and corneal neovascularization[19]. However, its impact on the barrier function of HCEs has not yet been established. Thus, we explored the involvement of Sema7A in the dysfunction of the corneal epithelial barrier and elucidate its underlying mechanisms. These results may enhance our knowledge of the pathophysiology of Sema7A in corneal epithelial barrier dysfunction.

MATERIALS AND METHODS

Ethical Approval

All experiments were approved by the Ethics Committee of the Fifth Affiliated Hospital of Sun Yat-sen University, Guangdong, China (Project identification code k27-1).

Materials

Dulbecco's modified Eagle medium-nutrient mixture F12 (DMEM-F12), gentamicin, trypsin-EDTA, phosphate-buffered saline (PBS), and fetal bovine serum (FBS) were obtained from Invitrogen-Gibco (Rockville, MD, USA). 4-kilodalton (kDa) Dextran-fluorescein isothiocyanate (FITC), bovine recombinant insulin, bovine serum albumin (BSA), human recombinant epidermal growth factor, and cholera toxin were provided by Sigma-Aldrich (St. Louis, MO, USA). Corning (Corning, NY, USA) supplied 24-well transwell plates as well as 6-, 24-, or 96-well culture plates. ZO-1 mouse monoclonal antibody was obtained from Invitrogen (Carlsbad, CA, USA), while occludin rabbit monoclonal antibody was obtained from Cell Signaling Technology (Beverly, MA, USA). Rabbit monoclonal antibodies to phosphorylated (p-) and unphosphorylated forms of inhibitor of kappa B alpha (IκBα) were obtained from Abcam (Beverly, MA, USA). Antibody to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was obtained from Protein Tech Group (Pearl Street, Rosemont, USA). Mouse or rabbit IgG-specific horseradish peroxidase conjugated goat antibodies were supplied by the Beyotime Institute of Biotechnology. Recombinant human Sema7A was provided by R&D Systems (Minneapolis, MN, USA). IκB kinase 2 (IKK2) inhibitor IV was supplied by Calbiochem (Merck, Darmstadt, Germany). Enhanced chemiluminescence was obtained from Amersham Pharmacia Biotech (Uppsala, Sweden). Alexa Fluor 488-labeled goat antibodies to mouse or rabbit IgG were from Molecular Probes (Eugene, OR). The 4′,6-diamidino-2-phenylindole (DAPI) solution was obtained from Abcam (Beverly, MA, USA). The human interleukin (IL)-1β enzyme-linked immunosorbent assay (ELISA) kit was offered by RayBio Corporation (California, CA, USA), and the IL-1 receptor (IL-1R) antagonist (Anakinra) was purchased from MedChemExpress (Wisconsin, WI, USA).

Cell Culture and Treatment

Simian Virus 40 (SV40)-HCEs were immortalized by Araki-Sasaki et al[20] using an SV40-adenovirus recombinant vector lacking the origin of replication. They were provided by RIKEN Biosource Center (Tokyo, Japan). HCEs were grown in DMEM-F12 medium with 15% heat-inactivated FBS, 10 ng/mL recombinant human epidermal growth factor, 40 µg/mL gentamicin, 0.1 µg/mL cholera toxin, and 5 µg/mL bovine insulin, referred to as supplement hormonal epithelial medium (SHEM), at 37°C and 5% CO2. Experiments were performed by plating HCEs at 1×105 cells/well in 24-transwell plates or at 5×105 cells/well, 5×104 cells/well, or 3×103 cells/well in 6-, 24-, or 96-well culture plates, respectively. HCEs were grown in SHEM for 2d and then in unsupplemented DMEM-F12 (DMEM-F12 with 40 µg/mL gentamicin) for 1d before being exposed to 0, 125, 250, or 500 ng/mL recombinant human Sema7A[21]–[22] or 0.1 µmol/L IKK2 inhibitor IV[23] or 500 ng/mL IL-1R antagonist[24] for the indicated time in the latter medium. All experiments were repeated three times.

Cell Proliferation Assay

For the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay, HCEs were plated on 96-well plates and treated with 0, 125, 250, or 500 ng/mL of Sema7A for 72h. Afterward, the cells were mixed with 20 µL of MTS assay solution and incubated for 4h. Cell proliferation was determined by measuring absorbance at 490 nm using a microplate reader.

Measurement of Transepithelial Electrical Resistance

Transepithelial electrical resistance (TEER) was measured using an EVOM voltameter (World Precision Instruments) to examine the integrity of the corneal epithelial barrier[4],[25]. After 48h of growth on a 0.4 µm filter in 24-transwell plates with SHEM as well as another 24h of growth in unsupplemented DMEM-F12, the HCEs were exposed to 0, 125, 250, or 500 ng/mL Sema7A for 72h. The TEER value (Ω•cm2) was obtained after multiplying the observed resistance by the surface area of the transwell filter. The TEER for each group was then adjusted by subtracting the background value for the blank transwell insert. The final TEER value was used for barrier function analysis.

Dextran-fluorescein Isothiocyanate Permeability Assay

The paracellular permeability of corneal epithelia was evaluated by the flow of 4 kDa Dextran-FITC, as previously reported[4],[25]–[26]. Briefly, after cells were exposed to 0, 125, 250, or 500 ng/mL Sema7A for 72h, a 2-hour incubation with 200 µL Dextran-FITC (3 mg/mL) in the apical chamber at the temperature of 37°C was performed. The supernatant was obtained from the bottom chamber. Next, the Envision microplate reader (PerkinElmer) with an excitation wavelength of 485 nm as well as an emission wavelength of 528 nm was used to determine the amount of Dextran-FITC.

Immunoblot Analysis

The production of proteins, such as TJs and the nuclear factor-kappa B (NF-κB)-related components, in HCEs was evaluated utilizing immunoblot analysis. For the analysis of ZO-1 and occludin, HCEs were cultured in 6-well plates with SHEM for 2d, followed by an additional day in unsupplemented DMEM-F12. Subsequently, the cells were administered with 0, 125, 250, or 500 ng/mL Sema7A for 24, 48, or 72h. For IκBα and p-IκBα analysis, HCEs were cultured in 6-well plates with SHEM containing only 0.5% FBS, followed by another day in unsupplemented DMEM-F12. Cells were then administered with 500 ng/mL Sema7A for 0, 5, 15, 30, 60, or 120min. To obtain cell extracts, cell lysis buffer radioimmunoprecipitation assay containing 1% protease inhibitors was used, following the provided instructions[27]–[28]. Samples were subjected to centrifugation at 15 000 g for 10min at 4°C, and total protein concentrations were further measured and calculated. Approximately 20 µg of protein was separated from each sample using a 12.5% SDS-PAGE gel. The separated proteins were transferred onto polyvinylidene difluoride (PVDF) membranes (Merck Millipore). After blocking with 5% skim milk at room temperature (RT) for 1h, the membranes were incubated overnight at 4°C with primary antibodies against ZO-1 (1:1000), occludin (1:1000), IκBα (1:1000), p-IκBα (1:1000), and GAPDH (1:4000). The membranes were then exposed to species-specific secondary antibodies (1:4000) for 1h. Protein bands were visualized using ECL reagents and recorded with the Tanon-5200 Multi-imaging System (Tanon Science and Technology). The relative expression of the target proteins compared to GAPDH was analyzed using Image J.

Quantitative Reverse Transcription-Polymerase Chain Reaction Analysis

To examine Sema7A's effects on the gene expression of TJs, HCEs were cultured in 6-well plates with SHEM for 2d, followed by an additional day in unsupplemented DMEM-F12. The cells were administered with 0, 125, 250, or 500 ng/mL Sema7A for 24, 48, or 72h. To assess Sema7A's effects on the gene expression of IL-1β, HCEs were cultured in 6-well plates with SHEM for 2d, followed by another day in unsupplemented DMEM-F12. Cells were then treated with 500 ng/mL Sema7A for 24 or 48h. Total RNA was extracted from HCEs using the RNAprep pure Cell/Bacteria Kit (Tiangen). Subsequently, cDNA synthesis was conducted utilizing the Primescript RT Master Kit (Takara Bio Inc.) with 500 ng of RNA. Quantitative reverse transcription-polymerase chain reaction analysis (RT-PCR) detection was carried out utilizing the Bio-Rad (Hercules, CA) CFX96 optical reaction system. The relative fold changes in target gene expression were determined using the 2−ΔΔCT method. The primer sequences used in this study are presented in Table 1[1].

Table 1. Sequences of primers.

Genes Nucleotide sequence (5′-3′)
GAPDH
 Forward ACTCCTCCACCTTTGACGCT
 Reverse GGTCTCTCTCTTCCTCTTGTGC
ZO-1
 Forward AGCCTGCAAAGCCAGCTCA
 Reverse AGTGGCCTGGATGGGTTCATAG
Occludin
 Forward TCAGGGAATATCCACCTATCACTTCAG
 Reverse CATCAGCAGCAGCCATGTACTCTTCAC
IL-1β
 Forward CCACAGACCTTCCAGGAGAATG
 Reverse GTGCAGTTCAGTGATCGTACAGG
Open in a new tab

GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; ZO-1: Zonula occludens-1; IL: Interleukin.

Immunofluorescent Staining

For ZO-1 and occludin staining, HCEs were cultured on coverslips in 24-well culture plates with SHEM for 2d, followed by an additional day in unsupplemented DMEM-F12. Subsequently, the cells were exposed to 500 ng/mL Sema7A for 72h with or without 0.1 µmol/L IKK2 inhibitor IV. After fixing the HCEs with 100% methanol at RT for a duration of 20min, the cells were rinsed three times for 5min each with PBS with 0.1% Tween 20 (PBST). Following that, the HCEs were blocked with 1% BSA in PBS (BSA-PBS) at RT for 1h, and then incubated overnight at 4°C with antibodies against ZO-1 (1:100 in 1% BSA-PBS) and occludin (1:100 in 1% BSA-PBS). The next morning, the coverslips were washed three times with PBST, incubated at RT for 1h with Alexa Fluor 488-conjugated secondary antibodies (1:500 in 1% BSA-PBS), washed again three times with PBST, and stained with DAPI staining solution for 10min to visualize the nuclei. The results were observed and recorded using a fluorescent microscope (Oberkochen, Germany).

Measurement of IL-1β Secretion

After exposure to Sema7A (500 ng/mL) for different durations, supernatants were harvested and subjected to centrifugation at 120×g for a duration of 5min, with the resulting supernatant stored at the temperature of -80°C[28]. The released IL-1β in the supernatant was quantified using ELISA kits.

Statistical Analysis

Data analysis was carried out using GraphPad Prism program version 9.0 (GraphPad Software, Inc.). Data were presented with mean±standard deviation (SD). Comparisons between variables were assessed utilizing Student's t-test. One-way analysis of variance (ANOVA) as well as Dunnett's multiple comparisons were employed to determine intergroup variability. P values of less than 0.05 indicated to be statistically significant.

RESULTS

Impairment of Barrier Function by Sema7A in Cultured Human Corneal Epithelial Cells

To evaluate the effect of Sema7A on the barrier function of HCEs, the TEER and flow of Dextran-FITC assay were carried out. The results revealed a statistically significant decrease in TEER among HCEs exposed to Sema7A (125-500 ng/mL) at 24, 48, and 72h compared to the control group at the corresponding time points in ANOVA analysis (P<0.05). Notably, the group treated with 500 ng/mL exhibited significantly lower TEER than the groups treated with 0, 125, and 250 ng/mL at 48h and 72h in ANOVA analysis (P<0.05). However, no significant difference was observed between the groups treated with 125 and 250 ng/mL at 24, 48, and 72h (P>0.05; Figure 1A). The impact of Sema7A was evident at 24h and showed the maximum decrease at 72h. A time-dependent trend in Sema7A's inhibitory effect on TEER was observed, with a significantly stronger inhibition at 48h compared to 24h (P<0.05), while no significant change was observed between 48h and 72h (P>0.05). Additionally, the increased permeability of Dextran-FITC further confirmed the decreased barrier function induced by Sema7A (Figure 1B). Both experiments collectively demonstrate that Sema7A negatively affects the barrier function of HCEs. Moreover, the MTS assay indicated that Sema7A had no cytotoxic effect on HCEs.

Figure 1. Effects of Sema7A on the barrier function of HCEs.

Figure 1

Open in a new tab

A: Concentration- and time-dependent effects of Sema7A on the barrier function of HCEs. HCEs were cultured in 24-well transwell plates for 2d, followed by incubation in unsupplemented DMEM-F12 for an additional day. Then, HCEs were administrated with various concentrations (0, 125, 250, 500 ng/mL) of Sema7A for 24, 48, or 72h, and TEER was measured to assess the barrier function. aP<0.05 compared to the control at the same time point. The data is presented as mean±SD; n=3. B: To evaluate the paracellular permeability of HCEs, the fluorescent intensity of 4 kDa Dextran-FITC in the basal chambers was examined after 72-hour treatment with different concentrations (0, 125, 250, 500 ng/mL) of Sema7A. aP<0.05 compared to the control. The data is presented as mean±SD; n=3. Sema7A: Semaphorin 7A; HCEs: Human corneal epithelial cells; DMEM-F12: Dulbecco's modified eagle medium/nutrient mixture F-12; TEER: Transepithelial electrical resistance; FITC: Fluorescein isothiocyanate; SD: Standard deviation.

Reduction of Protein Concentrations of Tight Junctions by Sema7A in Human Corneal Epithelial Cells

To elucidate the effect of Sema7A on barrier function in HCEs, we measured the protein levels of ZO-1 and occludin. We observed a dose-dependent reduction in the expression of ZO-1 and occludin proteins in HCEs (Figure 2A). The protein levels of ZO-1 showed a statistically significant decrease only at 500 ng/mL (Figure 2B) in ANOVA analysis (P<0.05), while occludin protein levels significantly decreased at both 250 ng/mL and 500 ng/mL (P<0.05; Figure 2C). Moreover, both ZO-1 and occludin protein levels decreased over time (Figure 2D) in ANOVA analysis (P<0.05), but the inhibitory effect of 500 ng/mL Sema7A on ZO-1 and occludin proteins was only statistically significant at 72h (P<0.05; Figure 2E, 2F).

Figure 2. Concentration-dependent and time-dependent inhibition effects of Sema7A on the protein levels of the TJs in HCEs.

Figure 2

Open in a new tab

A-C: HCEs were cultured in SHEM for 2d, followed by a day in unsupplemented DMEM-F12. Then, HCEs were treated with different concentrations (0, 125, 250, 500 ng/mL) of Sema7A for 72h. Representative immunoblots (A) and quantitative analysis (B, C) were used to quantify the protein levels of ZO-1 and occludin in HCEs. aP<0.05 compared to the control. The data is presented as mean±SD; n=3. D-F: HCEs were treated with 500 ng/mL Sema7A for 24, 48, or 72h after being cultured in SHEM for 2d and then unsupplemented DMEM-F12 for another day. Representative immunoblots (D) and quantitative analysis (E, F) were performed to assess the protein levels of ZO-1 and occludin in HCEs. aP<0.05 compared to the control. The data is presented as mean±SD; n=3. Sema7A: Semaphorin 7A; TJ: Tight junction; HCEs: Human corneal epithelial cells; SHEM: Supplement hormonal epithelial medium; DMEM-F12: Dulbecco's modified eagle medium/nutrient mixture F-12; ZO-1: Zonula occludens-1; SD: Standard deviation.

Reduction of Tight Junctions mRNA Levels by Sema7A in Human Corneal Epithelial Cells

Using RT-PCR, we observed a dramatical decrease in the mRNA fold changes of ZO-1 and occludin among HCEs following Sema7A treatment in a time- and dose-dependent manner (Figure 3). Consistent with the protein level analysis, a statistically significant decrease in the mRNA levels of ZO-1 (Figure 3A) and occludin (Figure 3B) was only observed at 500 ng/mL (P<0.05), and these effects became apparent after 24h (P<0.05; Figure 3C, 3D) in ANOVA analysis.

Figure 3. Effects of Sema7A on the mRNA levels of the TJs in HCEs.

Figure 3

Open in a new tab

HCEs were cultured in SHEM for 2d, followed by a day in unsupplemented DMEM-F12. Subsequently, HCEs were treated with various concentrations (0, 125, 250, 500 ng/mL) of Sema7A for 72h (A, B) or with 500 ng/mL Sema7A for 24, 48, or 72h (C, D). RT-PCR was used to quantify the mRNA expression levels of ZO-1 and occludin. GAPDH was used as a reference gene. aP<0.05 compared to the control. The data is presented as mean±SD; n=3. Sema7A: Semaphorin 7A; TJ: Tight junction; HCEs: Human corneal epithelial cells; SHEM: Supplement hormonal epithelial medium; DMEM-F12: Dulbecco's modified eagle medium/nutrient mixture F-12; RT-PCR: Reverse transcription quantitative polymerase chain reaction; ZO-1: Zonula occludens-1; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; SD: Standard deviation.

Promotion of Phosphorylation of NF-κB Inhibitory Protein IκBα by Sema7A in Human Corneal Epithelial Cells

To further clarify the mechanism underlying the anti-barrier function of Sema7A, HCEs were stimulated with 500 ng/mL Sema7A for various durations (ranging from 0 to 120min) to evaluate IκBα activity through phosphorylation. Results of Western blot analysis (Figure 4A) and quantitative analysis (Figure 4B) showed that the levels of p-IκBα/IκBα significantly increased upon exposure to Sema7A, reaching a peak at 5min (P<0.05).

Figure 4. Effects of Sema7A on the phosphorylation of IκBα stimulated by Sema7A in HCEs.

Figure 4

Open in a new tab

HCEs were cultured in SHEM containing 0.5% FBS for 1d, followed by an additional day in unsupplemented DMEM-F12. Then, HCEs were treated with 500 ng/mL Sema7A for different time intervals ranging from 0 to 120min. A: Immunoblots were performed to assess the protein levels of p-IκBα, IκBα, as well as GAPDH. Equal loading was confirmed by GAPDH. B: IκBα and p-IκBα proteins underwent densitometric analysis. Subsequently, the ratio of p-IκBα to IκBα in HCEs at various time points was calculated and compared using ANOVA analysis. aP<0.05 compared to the control; bP<0.05 compared to cells incubated with 500 ng/mL Sema7A for 5min. The data is presented as mean±SD; n=3. Sema7A: Semaphorin 7A; HCEs: Human corneal epithelial cells; FBS: Fetal bovine serum; SHEM: Supplement hormonal epithelial medium; DMEM-F12: Dulbecco's modified eagle medium/nutrient mixture F-12; p-: Phosphorylated; IκBα: Inhibitor of kappa B alpha; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; SD: Standard deviation.

Inhibition of NF-κB Signaling Pathway Alleviated Sema7A-induced Negative Influences on Barrier Function

Subsequently, pre-incubation with 0.1 µmol/L IKK2 inhibitor IV for 2h successfully reversed the decreased TEER induced by 500 ng/mL Sema7A at 72h utilizing Student's t-test (P<0.05; Figure 5A). This finding was further supported by a decrease in Dextran-FITC permeability (P<0.05; Figure 5B).

Figure 5. Effects of Sema7A on the tight junctions of HCEs after treatment with IKK2 inhibitor IV.

Figure 5

Open in a new tab

HCEs were pre-incubated with or without 0.1 µmol/L IKK2 inhibitor IV for 2h, and then incubated for 72h with/without 500 ng/mL Sema7A. TEER (A) and permeability of 4 kDa Dextran-FITC (B) were measured to evaluate the barrier function of HCEs. aP<0.05 compared to the control; bP<0.05 compared to cells incubated with 500 ng/mL Sema7A alone. The data is presented as mean±SD; n=3. Sema7A: Semaphorin 7A; HCEs: Human corneal epithelial cells; IKK2: IκB kinase 2 inhibitor; TEER: Transepithelial electrical resistance; FITC: Fluorescein isothiocyanate; SD: Standard deviation.

Inhibition of NF-κB Signaling Pathway Alleviated Sema7A-induced Negative Influences on the Degradation of Tight Junctions

In addition, Western blot analysis (Figure 6A) and quantitative analysis (Figure 6B, 6C) revealed that pretreatment with IKK2 inhibitor IV significantly restored the decreased protein levels of ZO-1 and occludin caused by Sema7A utilizing Student's t-test (P<0.05). Immunostaining assay (Figure 6D) revealed that in contrast with the control group, HCEs treated with 500 ng/mL Sema7A exhibited obviously less intense and discontinuous localization of ZO-1 and occludin. However, these effects were blocked by pretreatment with 0.1 µmol/L IKK2 inhibitor IV.

Figure 6. Effects of Sema7A on the expression of ZO-1 and occludin in HCEs.

Figure 6

Open in a new tab

HCEs were pre-incubated with or without 0.1 µmol/L IKK2 inhibitor IV for 2h and then incubated for an additional 72-hour with/without 500 ng/mL Sema7A. Representative immunoblots (A) and quantitative analysis (B, C) were performed to assess the protein levels of ZO-1 and occludin in HCEs after 72-hour different treatments. aP<0.05 compared to the control; bP<0.05 compared to cells incubated with 500 ng/mL Sema7A alone. The data is presented as mean±SD; n=3. Additionally, HCEs were fixed and immunofluorescence analyses (D) were performed using antibodies against ZO-1 (green)/occludin (green). DAPI staining was performed for nuclei (blue). Scale bar: 20 µm. Sema7A: Semaphorin 7A; ZO-1: Zonula occludens-1; HCEs: Human corneal epithelial cells; IKK2: IκB kinase 2 inhibitor; SD: Standard deviation; DAPI: 4′,6-Diamidino-2-phenylindole.

Sema7A-induced IL-1β Secretion Promotion and Barrier Function Impairment Reversal via IL-1R Inhibition

Finally, RT-PCR (Figure 7A) and ELISA (Figure 7B) revealed that treatment with 500 ng/mL Sema7A significantly increased the mRNA and protein levels of IL-1β in HCEs at 48h, as indicated by ANOVA analysis (P<0.05). Pre-incubation of HCEs with 500 ng/mL IL-1R antagonist for 2h successfully reversed the decreased TEER induced by 500 ng/mL Sema7A at 48h (P<0.05; Figure 7C). This finding was further supported by a decrease in Dextran-FITC permeability by Student's t-test (P<0.05; Figure 7D).

Figure 7. Sema7A-induced IL-1β secretion and barrier function impairment reversal via IL-1R inhibition in HCEs.

Figure 7

Open in a new tab

RT-PCR (A) and ELISA (B) demonstrated that 500 ng/mL of Sema7A significantly increased the mRNA and protein levels of IL-1β in HCEs at 48-hour. HCEs were pre-incubated with/without 500 ng/mL of an IL-1R antagonist for 2h, followed by incubation with or without 500 ng/mL of Sema7A. TEER (C) and permeability of the Dextran-FITC (D) were detected to evaluate the barrier function of HCEs after 48h of different treatments. aP<0.05 compared to the control; bP<0.05 compared to cells treated with 500 ng/mL of Sema7A alone. The data is presented as mean±SD; n=3. Sema7A: Semaphorin 7A; IL: Interleukin; IL-1R: Interleukin-1 receptor; HCEs: Human corneal epithelial cells; ELISA: Enzyme-linked immunosorbent assay; RT-PCR: Reverse transcription quantitative polymerase chain reaction; TEER: Transepithelial electrical resistance; FITC: Fluorescein isothiocyanate; SD: Standard deviation.

DISCUSSION

In this study, we have demonstrated that Sema7A impairs the barrier function of HCEs in vitro. This impairment was assessed by measuring TEER and Dextran-FITC permeability. We observed a time- and dose-dependent downregulation of ZO-1 and occluding at both the protein and mRNA levels, suggesting their involvement in the disruption of the barrier function. Our findings also indicated that the anti-barrier function of Sema7A might be mediated through the activation of the NF-κB signaling pathway. Additionally, we found that Sema7A promoted the expression of IL-1β, while inhibiting IL-1R partially reversed the detrimental effects of Sema7A on barrier function.

TJs, located beneath the apical surface, are responsible for maintaining the integrity of the paracellular route and preventing uncontrolled passage of macromolecules, cells, electrolytes and fluid[29]. The TJ complex is composed of integral transmembrane proteins such as junctional adhesion molecules, occluding, and claudins. Furthermore, TJs includes membrane-associated proteins ZO-1, ZO-2, and ZO-3, which interact with cytoplasmic transmembrane proteins and bind them to the actin cytoskeleton[30]. The proteins of claudin-1, occluding as well as ZO-1 are detected in vivo within the superficial/sub-superficial HCEs and related to the improvement of the barrier function[9],[29].

The cornea is densely innervated to maintain the ocular surface's integrity. Nerve growth factors play a pivotal role in orchestrating the regeneration of corneal nerves and modulating inflammatory responses within the cornea. Recent studies have demonstrated the significant role of nerve growth factors in corneal epithelial wound healing progress, such as Netrin-1. Netrin-1 has been shown to reduce apoptosis, enhance proliferation and migration of HCEs in vitro and in vivo[31]. Recombinant human nerve growth factor has also been found to promote corneal epithelial wound healing and nerve regeneration[32]. Sema7A, as a neuronal guidance protein, is constitutively expressed in the cornea. In neurotrophic keratitis models of mice, Sema7A expression was increased in corneal epithelial cells by day 8. Furthermore, anti-Sema7A resulted in decreased corneal sensitivity and impaired reinnervation[33]. These findings suggest that Sema7A may play a role in corneal disease. However, its exact impact on the corneal barrier function remains unclear. Our study discovered that Sema7A decreased the barrier function of HCEs, as evidenced by reduced TEER and increased Dextran-FITC permeability. Concurrently, we observed decreased transcription and translation of ZO-1 and occluding. This finding was consistent with previous studies on the barrier function of Sema7A in various diseases. For example, mice lacking Sema7A exhibited reduced blood-brain barrier permeability during West Nile virus infection[34]. Additionally, Sema7A significantly promoted monolayer permeability during acute airway inflammation[35]. These observations suggest that inflammation responses mediated by Sema7A contribute to the decline of barrier function in the brain and lung. Therefore, it is reasonable to propose that inflammation responses mediated by Sema7A may likewise lead to a decrease in barrier function in HCEs.

Previous studies have shown that Sema7A is activated during inflammation and has a potential in promoting inflammation, facilitating the dissemination of deleterious alterations essential for pulmonary inflammation in lung injury[36]. The involvement of Sema7A in corneal inflammation has been investigated in previous research. Namavari et al[18] found that Sema7A significantly increased inflammatory cell influx into the cornea. Ghanem et al[19] observed an increase in corneal neovascularization and the presence of F4/80, a macrophage marker, in Sema7A-injected corneas, indicating that Sema7A might mediate an inflammatory response and recruit infiltrating cells such as macrophages. In our study, we observed that Sema7A increased IL-1β secretion in HCEs, which could potentially attract inflammatory cells by regulating the production of other inflammatory cytokines. Additionally, Sema7A has been shown to mediate inflammation in endothelial cells through the activation of integrin β1/FAK/MEK1/2/NF-κB signaling pathway[37]–[38]. NF-κB activation is linked to the generation of various cytokines and growth factors and has been implicated in diminishing epithelial barrier function in other tissues[36]. Based on these findings and previous research, we hypothesized that Sema7A may affect the barrier function by playing a role in NF-κB activation.

We also found that Sema7A induced the phosphorylation of the NF-κB-inhibitory protein IκBα. To further investigate the involvement of NF-κB signaling pathway within Sema7A-mediated disruption of the barrier function in cultured HCEs, we inhibited this pathway using an IKK2 inhibitor IV. IKK2 inhibitor IV effectively suppressed NF-κB activation by degrading NF-κB inhibitor proteins in animal models and in culture conditions[39]. We found that IKK2 inhibitor IV blocked the negative effects of Sema7A on TEER and Dextran-FITC flux. Furthermore, the recovery of barrier function was linked to an elevation in the protein levels of ZO-1 and occluding. Immunostaining assay demonstrated that IKK2 inhibitor IV prevented the loss of the immunoreactivity of ZO-1/occluding detected at the cellular boundaries induced by Sema7A at 72h. These results provide evidence that disruption of corneal epithelial barrier function mediated by Sema7A in cultured HCEs is associated with the activation of the NF-κB signaling pathway.

As a major pro-inflammatory cytokine, IL-1β plays a crucial role in regulating inflammation and wound healing in the cornea[40]. NF-κB positively regulates the expression of IL-1β[41], and IL-1β has been implicated in the disruption of ZO-1 and occludin at the junctions between adjacent HCEs, leading to impairment of corneal epithelial function[42]. In our study, we observed that Sema7A promotes the secretion of IL-1β at both the protein and mRNA levels. This effect became more pronounced after 48h, although it was not significant at 24h. Importantly, the use of an IL-1R antagonist effectively suppressed the Sema7A-induced decrease in TEER as well as the increase in permeability. Based on these findings, we hypothesize that IL-1β likely plays a crucial role in the anti-barrier function of Sema7A in HCEs. However, since the inhibitory effect of Sema7A on barrier function occurs at 24h, it is reasonable to assume that factors other than IL-1β may also be related to the early regulation of HCEs barrier function by Sema7A.

In conclusion, our study demonstrated that Sema7A might affect corneal barrier function by decreasing the expressions of ZO-1 as well as occludin at the translational/transcriptional levels, activating the NF-κB inhibitory protein IκBα, and enhancing the expression of IL-1β in vitro. The disruption of barrier function caused by Sema7A could be reversed by the IKK2 inhibitor IV and IL-1R antagonists. These findings suggest Sema7A to be a potential therapeutic target for regulating corneal epithelial barrier function.

Footnotes

Foundations: Supported by the National Natural Science Foundation of China (No.81770889); Zhuhai Science and Technology Program (No.ZH22036201210134PWC).

Conflicts of Interest: Yang CC, None; Yang XX, None; Zhao XJ, None; Wang H, None; Guo ZH, None; Jin K, None; Liu Y, None; Li BH, None.

REFERENCES

  • 1.Xiang P, Jia Y, Wang K, Li MY, Qin YS, He RW, Gao P, Liu YG, Liu X, Ma LQ. Water extract of indoor dust induces tight junction disruption in normal human corneal epithelial cells. Environ Pollut. 2018;243(Pt A):301–307. doi: 10.1016/j.envpol.2018.08.085. [DOI] [PubMed] [Google Scholar]
  • 2.Zhang Y, Li JM, Lu R, Liu Z, Chen X, de Paiva CS, Pflugfelder SC, Li DQ. Imbalanced IL-37/TNF-α/CTSS signaling disrupts corneal epithelial barrier in a dry eye model in vitro. Ocul Surf. 2022;26:234–243. doi: 10.1016/j.jtos.2022.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.NaPier E, Camacho M, McDevitt TF, Sweeney AR. Neurotrophic keratopathy: current challenges and future prospects. Ann Med. 2022;54(1):666–673. doi: 10.1080/07853890.2022.2045035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Li Y, Wang YW, Li CW, Zhao DP, Hu QY, Zhou M, Du M, Li J, Wan PX. The role of elastase in corneal epithelial barrier dysfunction caused by pseudomonas aeruginosa exoproteins. Invest Ophthalmol Vis Sci. 2021;62(9):7. doi: 10.1167/iovs.62.9.7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Zhao H, He Y, Ren YR, Chen BH. Corneal alteration and pathogenesis in diabetes mellitus. Int J Ophthalmol. 2019;12(12):1939–1950. doi: 10.18240/ijo.2019.12.17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hwang SB, Park JH, Park JY, Kang SS, Chung HS, Lee H, Kim JY, Tchah H. Anti-inflammatory and anti-apoptotic effects of N-acetylcysteine in diabetic rat corneal epithelium. Int J Ophthalmol. 2021;14(12):1805–1812. doi: 10.18240/ijo.2021.12.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhang Y, Yang M, Zhao SX, Nie L, Shen LJ, Han W. Hyperosmolarity disrupts tight junction via TNF-α/MMP pathway in primary human corneal epithelial cells. Int J Ophthalmol. 2022;15(5):683–689. doi: 10.18240/ijo.2022.05.01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wang F, Wang DM, Song M, Zhou Q, Liao RF, Wang Y. MiRNA-155-5p reduces corneal epithelial permeability by remodeling epithelial tight junctions during corneal wound healing. Curr Eye Res. 2020;45(8):904–913. doi: 10.1080/02713683.2019.1707229. [DOI] [PubMed] [Google Scholar]
  • 9.Ban Y, Dota A, Cooper LJ, Fullwood NJ, Nakamura T, Tsuzuki M, Mochida C, Kinoshita S. Tight junction-related protein expression and distribution in human corneal epithelium. Exp Eye Res. 2003;76(6):663–669. doi: 10.1016/s0014-4835(03)00054-x. [DOI] [PubMed] [Google Scholar]
  • 10.Li JM, Lu R, Zhang Y, Lin J, Hua X, Pflugfelder SC, Li DQ. IL-36α/IL-36RA/IL-38 signaling mediates inflammation and barrier disruption in human corneal epithelial cells under hyperosmotic stress. Ocul Surf. 2021;22:163–171. doi: 10.1016/j.jtos.2021.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Fard D, Tamagnone L. Semaphorins in health and disease. Cytokine Growth Factor Rev. 2021;57:55–63. doi: 10.1016/j.cytogfr.2020.05.006. [DOI] [PubMed] [Google Scholar]
  • 12.Treps L, Le Guelte A, Gavard J. Emerging roles of Semaphorins in the regulation of epithelial and endothelial junctions. Tissue Barriers. 2013;1(1):e23272. doi: 10.4161/tisb.23272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Xu X, Ng S, Wu ZL, Nguyen D, Homburger S, Seidel-Dugan C, Ebens A, Luo Y. Human semaphorin K1 is glycosylphosphatidylinositol-linked and defines a new subfamily of viral-related semaphorins. J Biol Chem. 1998;273(35):22428–22434. doi: 10.1074/jbc.273.35.22428. [DOI] [PubMed] [Google Scholar]
  • 14.Kolodkin AL, Matthes DJ, Goodman CS. The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cell. 1993;75(7):1389–1399. doi: 10.1016/0092-8674(93)90625-z. [DOI] [PubMed] [Google Scholar]
  • 15.Tarullo SE, Hill RC, Hansen KC, Behbod F, Borges VF, Nelson AC, Lyons TR. Postpartum breast cancer progression is driven by semaphorin 7a-mediated invasion and survival. Oncogene. 2020;39(13):2772–2785. doi: 10.1038/s41388-020-1192-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Song Y, Wang L, Zhang L, Huang DM. The involvement of semaphorin 7A in tumorigenic and immunoinflammatory regulation. J Cell Physiol. 2021;236(9):6235–6248. doi: 10.1002/jcp.30340. [DOI] [PubMed] [Google Scholar]
  • 17.Allegra M, Zaragkoulias A, Vorgia E, Ioannou M, Litos G, Beug H, Mavrothalassitis G. Semaphorin-7a reverses the ERF-induced inhibition of EMT in Ras-dependent mouse mammary epithelial cells. Mol Biol Cell. 2012;23(19):3873–3881. doi: 10.1091/mbc.E12-04-0276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Namavari A, Chaudhary S, Ozturk O, Chang JH, Yco L, Sonawane S, Katam N, Khanolkar V, Hallak J, Sarkar J, Jain S. Semaphorin 7a links nerve regeneration and inflammation in the cornea. Invest Ophthalmol Vis Sci. 2012;53(8):4575–4585. doi: 10.1167/iovs.12-9760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ghanem RC, Han KY, Rojas J, Ozturk O, Kim DJ, Jain S, Chang JH, Azar DT. Semaphorin 7A promotes angiogenesis in an experimental corneal neovascularization model. Curr Eye Res. 2011;36(11):989–996. doi: 10.3109/02713683.2011.593730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Araki-Sasaki K, Ohashi Y, Sasabe T, Hayashi K, Watanabe H, Tano Y, Handa H. An SV40-immortalized human corneal epithelial cell line and its characterization. Invest Ophthalmol Vis Sci. 1995;36(3):614–621. [PubMed] [Google Scholar]
  • 21.Parkash J, Messina A, Langlet F, Cimino I, Loyens A, Mazur D, Gallet S, Balland E, Malone SA, Pralong F, Cagnoni G, Schellino R, De Marchis S, Mazzone M, Pasterkamp RJ, Tamagnone L, Prevot V, Giacobini P. Semaphorin7A regulates neuroglial plasticity in the adult hypothalamic Median eminence. Nat Commun. 2015;6:6385. doi: 10.1038/ncomms7385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Messina A, Ferraris N, Wray S, Cagnoni G, Donohue DE, Casoni F, Kramer PR, Derijck AA, Adolfs Y, Fasolo A, Pasterkamp RJ, Giacobini P. Dysregulation of Semaphorin7A/β1-integrin signaling leads to defective GnRH-1 cell migration, abnormal gonadal development and altered fertility. Hum Mol Genet. 2011;20(24):4759–4774. doi: 10.1093/hmg/ddr403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chen D, Ireland SJ, Remington G, Alvarez E, Racke MK, Greenberg B, Frohman EM, Monson NL. CD40-mediated NF-κB activation in B cells is increased in multiple sclerosis and modulated by therapeutics. J Immunol. 2016;197(11):4257–4265. doi: 10.4049/jimmunol.1600782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Schunk SJ, Triem S, Schmit D, Zewinger S, Sarakpi T, Becker E, Hütter G, Wrublewsky S, Küting F, Hohl M, Alansary D, Roma LP, Lipp P, Möllmann J, Lehrke M, Laschke MW, Menger MD, Kramann R, Boor P, Jahnen-Dechent W, März W, Böhm M, Laufs U, Niemeyer BA, Fliser D, Ampofo E, Speer T. Interleukin-1α is a central regulator of leukocyte-endothelial adhesion in myocardial infarction and in chronic kidney disease. Circulation. 2021;144(11):893–908. doi: 10.1161/CIRCULATIONAHA.121.053547. [DOI] [PubMed] [Google Scholar]
  • 25.Yang CC, Li Y, Liu Y, Xu ZH, Li W, Cao WW, Jin K, Liu Y. Protection of barrier function in cultured human corneal epithelial cells by semaphorin 4D. Curr Eye Res. 2023;48(10):894–903. doi: 10.1080/02713683.2023.2232572. [DOI] [PubMed] [Google Scholar]
  • 26.Jiao J, Yang J, Li JY, Li Y, Zhang L. Hypertonic saline and seawater solutions damage sinonasal epithelial cell air-liquid interface cultures. Int Forum Allergy Rhinol. 2020;10(1):59–68. doi: 10.1002/alr.22459. [DOI] [PubMed] [Google Scholar]
  • 27.Yang XX, Liu PP, Zhao XJ, Yang CC, Li BH, Liu Y, Liu Y. Sulforaphane inhibits cytokine-stimulated chemokine and adhesion molecule expressions in human corneal fibroblasts: involvement of the MAPK, STAT, and NF-κB signaling pathways. Exp Eye Res. 2022;216:108946. doi: 10.1016/j.exer.2022.108946. [DOI] [PubMed] [Google Scholar]
  • 28.Yang CC, Liu MJ, Li YZP, Xu ZH, Liu Y, Guo ZH, Li BH, Yang XX. 17β-estradiol inhibits TGF-β-induced collagen gel contraction mediated by human Tenon fibroblasts via Smads and MAPK signaling pathways. Int J Ophthalmol. 2023;16(9):1441–1449. doi: 10.18240/ijo.2023.09.10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sugrue SP, Zieske JD. ZO1 in corneal epithelium: association to the zonula occludens and adherens junctions. Exp Eye Res. 1997;64(1):11–20. doi: 10.1006/exer.1996.0175. [DOI] [PubMed] [Google Scholar]
  • 30.Tsukita S, Furuse M, Itoh M. Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2001;2(4):285–293. doi: 10.1038/35067088. [DOI] [PubMed] [Google Scholar]
  • 31.Han Y, Jiang N, Su T, Yang Q C, Yan C C, Ye L, Yuan Q, Zhu P W, Li W, Liu Z G, Shao Y. Netrin-1 promotes epithelium repair in corneal injury. Int J Ophthalmol. 2020;13(2):206–212. doi: 10.18240/ijo.2020.02.02. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wan LQ, Zhang YY, Wang HF, Chen C, Li H, Zhang Y, Xue JF, Zhou QJ, Xie LX. Efficacy of rhNGF-loaded amniotic membrane transplantation for rabbit corneal epithelial and nerve regeneration. Int J Ophthalmol. 2021;14(11):1653–1659. doi: 10.18240/ijo.2021.11.02. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chucair-Elliott AJ, Zheng M, Carr DJJ. Degeneration and regeneration of corneal nerves in response to HSV-1 infection. Invest Ophthalmol Vis Sci. 2015;56(2):1097–1107. doi: 10.1167/iovs.14-15596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sultana H, Neelakanta G, Foellmer HG, Montgomery RR, Anderson JF, Koski RA, Medzhitov RM, Fikrig E. Semaphorin 7A contributes to West Nile virus pathogenesis through TGF-β1/Smad6 signaling. J Immunol. 2012;189(6):3150–3158. doi: 10.4049/jimmunol.1201140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zhang ML, Yan X, Liu W, Sun RL, Xie YH, Jin FG. Endothelial semaphorin 7A promotes seawater aspiration-induced acute lung injury through plexin C1 and β1 integrin. Mol Med Rep. 2017;16(4):4215–4221. doi: 10.3892/mmr.2017.7097. [DOI] [PubMed] [Google Scholar]
  • 36.Roth JM, Köhler D, Schneider M, Granja TF, Rosenberger P. Semaphorin 7A aggravates pulmonary inflammation during lung injury. PLoS One. 2016;11(1):e0146930. doi: 10.1371/journal.pone.0146930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hu SH, Liu YF, You T, Heath J, Xu LR, Zheng XW, Wang AL, Wang YY, Li FC, Yang F, Cao YR, Zhang HY, van Gils JM, van Zonneveld AJ, Jo H, Wu QY, Zhang YH, Tang CJ, Zhu L. Vascular semaphorin 7A upregulation by disturbed flow promotes atherosclerosis through endothelial β1 integrin. Arterioscler Thromb Vasc Biol. 2018;38(2):335–343. doi: 10.1161/ATVBAHA.117.310491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Li X, Xie WL, Pan Q, Zhang XX, Zhang LJ, Zhao N, Xie QL, Ding JJ, Chai J. Semaphorin 7A interacts with nuclear factor NF-kappa-B p105 via integrin β1 and mediates inflammation. Cell Commun Signal. 2023;21(1):24. doi: 10.1186/s12964-022-01024-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Podolin PL, Callahan JF, Bolognese BJ, Li YH, Carlson K, Davis TG, Mellor GW, Evans C, Roshak AK. Attenuation of murine collagen-induced arthritis by a novel, potent, selective small molecule inhibitor of IkappaB Kinase 2, TPCA-1 (2-[(aminocarbonyl)amino]-5-(4-fluorophenyl)-3-thiophenecarboxamide), occurs via reduction of proinflammatory cytokines and antigen-induced T cell Proliferation. J Pharmacol Exp Ther. 2005;312(1):373–381. doi: 10.1124/jpet.104.074484. [DOI] [PubMed] [Google Scholar]
  • 40.Zhang W, Chen JL, Qu ML, Backman LJ, Zhang AN, Liu HY, Zhang XP, Zhou QJ, Danielson P. Sustained release of TPCA-1 from silk fibroin hydrogels preserves keratocyte phenotype and promotes corneal regeneration by inhibiting interleukin-1β signaling. Adv Healthc Mater. 2020;9(17):e2000591. doi: 10.1002/adhm.202000591. [DOI] [PubMed] [Google Scholar]
  • 41.Kaminsky LW, Al-Sadi R, Ma TY. IL-1β and the intestinal epithelial tight junction barrier. Front Immunol. 2021;12:767456. doi: 10.3389/fimmu.2021.767456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kimura K, Teranishi S, Nishida T. Interleukin-1beta-induced disruption of barrier function in cultured human corneal epithelial cells. Invest Ophthalmol Vis Sci. 2009;50(2):597–603. doi: 10.1167/iovs.08-2606. [DOI] [PubMed] [Google Scholar]

Articles from International Journal of Ophthalmology are provided here courtesy of Press of International Journal of Ophthalmology

RESOURCES