Skip to main content
Toxicology Research logoLink to Toxicology Research
. 2024 May 4;13(3):tfae071. doi: 10.1093/toxres/tfae071

Ameliorative impacts of astaxanthin against atrazine-induced renal toxicity through the modulation of ionic homeostasis and Nrf2 signaling pathways in mice

Mohamed Mohamed Soliman 1,, Khalid S Alotaibi 2, Shatha B Albattal 3, Saed Althobaiti 4, Helal F Al-Harthi 5, Arshad Mehmood 6
PMCID: PMC11074709  PMID: 38720817

Abstract

Astaxanthin (ASX), a red pigment belonging to carotenoids, has antioxidant activity and anti-oxidative stress effect. Atrazine (ATZ), a frequently used herbicide, whose degradation products are the cause for nephrosis and other oxidative stress associated diseases. This study was aimed to reveal the potential protective mechanism of astaxanthin against atrazine-induced nephrosis. Atrazine was orally given (250 mg/kg bw) to the mice along with astaxanthin (100 mg/kg bw) for 28 days. Serum biochemical indicators, oxidative stress biomarkers, ATPase activities, ion concentration, histomorphology, and various renal genes expression linked with apoptosis, Nrf2 signaling pathway, and aquaporins (AQPs) were assessed. It was found that serum creatinine (SCr), blood urea nitrogen (BUN), and MDA levels were significantly increased after the treatment of atrazine, whereas serum renal oxidative stress indicators like CAT, GSH, T-AOC, SOD decreased. Renal histopathology showed that atrazine significantly damaged renal tissues. The activities of Ca 2+-Mg 2+-ATPase were increased whereas Na +-K +-ATPase decreased significantly (P < 0.05). Moreover, results confirmed that the expression of AQPs, Nrf2, and apoptosis genes were also altered after atrazine administration. Interestingly, astaxanthin supplementation significantly (P < 0.05) improved atrazine-induced nephrotoxicity via decreasing SCr, BUN, oxidative stress, ionic homeostasis and reversing the changes in AQPs, Nrf2, and apoptosis gene expression. These findings collectively suggested that astaxanthin has strong potential ameliorative impact against atrazine induced nephrotoxicity.

Keywords: atrazine, oxidative stress, renal injury, ionic homeostasis, astaxanthin

Introduction

The use of synthetic chemicals in modern agriculture has significantly increased over the past few years. Frequently use of many pesticides induces negative effect on the environment quality. Atrazine a frequently used herbicide for the control of weed growth on agricultural soils.1,2 Atrazine is one of the most used herbicides in the USA and other countries.3 Due to its widespread uses, and higher water solubility, it can contaminate the environment for a longer time.4,5 Its approximate half-life of atrazine in aerobic soils is 146 days, freshwaters in 742 days, and marine environments 300 days.6,7 Due to the slow degradation of atrazine, it leaks into surface and ground waters. A higher percentage of atrazine was reported in streams and groundwater reservoirs in the USA, China, and European rivers.6,8,9

The kidneys are essential organ and play a vital role inthe excretion of metabolic waste products. Epidemiological studies documented that frequent use of atrazine in agriculture increases the chances of renal impairment.10 What’smore, many in vitro and in vivo studies confirm that atrazine exposure induces cytotoxicity, apoptosis, and oxidative damage.11–14 Atrazine exposure results in the increment of cell lysosomes and lipid peroxidation which further leads to cell dysfunction and nephrotoxicity.13,15 Additionally, atrazine was also reported to take part in DNA fragmentation and DNA methylation in the rats and common carp.16,17 Atrazine exerts renal damage via activating the Nrf2 signaling pathway in rats.11,14 Moreover, recently Guo et al.,13 observed that atrazine exposure disturbs renal ion homeostasis which further impaired renal function.

Nuclear factor erythroid 2-related factor 2 (Nrf2) is an important transcription factor and play key role in antioxidant defense mechanism.18 It participates in defending against oxidative stress (OS), via binding to antioxidant responsive element.19,20 Moreover, it also helps in maintaining cellular homeostasis, and able to regulate proteins, and detoxification enzymes.19,21 It has been reported that Nrf2/HO-1 activation may protect from various pesticides toxicity e.g. paraquat- and cypermethrin-induced toxicity.21 Atrazine was also reported to disturb antioxidant status via modulating Nrf2 signaling pathway in the liver and kidneys of quails.14,22

Aquaporins (AQPs) play an important role in regulating the water and ionic homeostasis in living cells. Aquaporins possess broad spectrum of functions in eukaryotes and changes in the aquaporins expression on the cell membrane cause renal injury.22,23 It was documented that upregulation of the expression of aquaporins (1, 2, 4, 6, and 7) in polycystic kidney disease, increases the H2O reabsorption which further results in alteration of blood pressure.24 Many studies reported that many diseases positively corelate with the deletion or mutation of AQP genes.25,26

Astaxanthin is a red-orange carotenoid pigment, present in various aquatic animals e.g. salmon, crab, and shrimp.22,26,27 Many studies reported the protective effects of astaxanthin on several diseases such as chronic kidney disease, neuroprotective, anti-inflammatory, and cardioprotective etc.28–30 Astaxanthin was reported to protect kidneys from various drugs and chemicals such as cisplatin, fructose, ochratoxin A, bisphenol A, and adriamycin.31–34 These protective effect of astaxanthin is due to its strong antioxidant ability among all carotenoids and easily pass through the blood–brain barrier.35 The present study was conducted to explore the nephroprotective effect of astaxanthin toward atrazine induced renal injury in mice.

Materials and methods

Animals and induction of atrazine-induced renal injury

Animal experiments were conducted in according with the Institutional Guidelines for the Care of Laboratory Animals of the Chinese Academy of Medical Science and Approved by the Institutional Ethics Committee for Research on Laboratory Animal Use. The 50 male Kunming mice (SPF) were procured from King Fahd Institute, King Abdul-Aziz University, Saudi Arabia. The animal experiment was according to the protocols and Ethical number; 42-0082 that approved by Ethical Committee for both Benha and Taif Universities. The animals were housed in control room maintaining the room relatively humidity 60%, temperature at 25 ± 5 °C on 12 h light/dark cycle along with free access to water and food for 1 week. After 1 week of environmental adjustment, mice were divided into six groups named as; Ncon (normal control received distilled water), Ccon (corn oil control group), ATZ (100 mg/kg bw astaxanthin), ASX (receive 250 mg/kg bw of atrazine), and ATZ + ASX (250 mg/kg bw of atrazine plus 100 mg/kg bw of astaxanthin). The astaxanthin was dissolved into corn oil. The AST and ATR were given intragastricto mice for 28 days along with normal food and drinking water. Animal experiment and doses used here were designed according to previously reported studies.13,14

After the completion of dosage for 28 days, all mice were anesthetized (sodium pento barbital, 50 mg per kg bw) and blood samples were collected. The serum was obtained after the centrifugation and stored at −20 °C for further biochemical analysis. Afterthat, mice were ethically killed, and kidneys were isolated. The kidneys washed with ice cold saline; some parts of kidneys were frozen at −80 °C whereas other pieces were fixed in a formalin solution for morphological analysis.

Renal function biomarkers and antioxidant activities analysis

The levels of creatinine and BUN were measured by using commercial kits provided by Sen Bei Jia Biological Technology Company, China. The renal and serum MDA, GSH, SOD, T-AOC levels were measured by using commercial kits purchased from Cell Signaling Technology, USA.

Determination of renal ion concentrations and ATPase activity

The homogenized renal tissues were subjected to the determination of renal ion concentrations. Renal ion concentrations such as Cl, Mg2+, K+, Ca2+, and Na+ were evaluated by using kits purchased from Sen Bei Jia Biological Technology Company, China. The ATPase activities such as Mg2+–ATPase, Ca2+– Mg2+–ATPase, Na+– K+–ATPase, and Ca2++–ATPase were also determined by using kits purchased from Cell Signaling Technology, USA.

Renal tissues histopathology analysis

The renal tissues were embedded in paraffin. After that renal tissues were cut (5 μm) before the staining with hematoxylin and eosin (H&E) and images were taken using microscope.36

Quantitative real-time polymerase chain reaction (qRT-PCR) analysis

TRI Regent reagent was used for the isolation of total RNA from renal tissues. The cDNA was synthesized, and RT-PCR amplification reaction was performed using SYBR premix Ex TaqII (Table 1). Amplification reaction was performed, and mRNA were calculated using the 2−ΔΔCT formula.

Table 1.

Primers used in this study.

Genes Primer Sequences
SOD1 F: CAGGACCTCATTTTAATCCTCAC
R: TGCCCAGGTCTCCAACAT
GPx1 F: TTTCCCGTGCAATCAGTTC
R: TCGGACGTACTTGAGGGAAT
Nrf2 R: AGGACATGGAGCAAGTTTGG
F: TTCTTTTTCCAGCGAGGAGA
CAT R: CCTTCAAGTTGGTTAATGCAGA
F: CAAGTTTTTGATGCCCTGGT
NQO1 R: GGTAGCGGCTCCATGTACTC
F: CATCCTTCCAGGATCTGCAT
HO-1 R: CACAGATGGCGTCACTTCGTC
F: GTGAGGACCCACTGGAGGAG
AQP1 F: ACCTGCTGGCGATTGACTAC
R: TGGTTTGAGAAGTTGCGGGT
AQP2 F: TGTGGAGCTCTTCCTGACCA
R: CAGCCGGTGAAATAGATCCCAA
AQP3 F: CGTTGTGGGGAGATGCTTCA
R: CCACAGCCAAACATCACAAGG
AQP4V3 F: TGTTTCCTACCCACCCTGCT
R: CAGGAATGTCCACACTTACAGC
AQP4V4 F: ATACTGTGTCCTCACTGGATGG
R: AGTTGAGCAGAGCGTAGGAC
AQP6 F: AGTCCATTGGATCTTCTGGGT
R: ATCGCTGGGCTACAGTCTTG
AQP7 F: GGGTGATTCTGGGCTCTTTTC
R: ATACTGATGCACGAAAGCCCT
AQP11 F: GAAATGGGTGCCGTGAGGTT
R: CATGTCGGTGTGGATGGGAT
GAPDH F: GTGAAGGTCGGTGTGAACGG
R: GTGATGGCATGGACTGTGGTC

Statistical analysis

The student’s t-test was used to compare statistical significance between two groups by using Graph Pad Prism. The data were expressed as mean ± SD and P < 0.05 was used for statistically significant.

Results

Astaxanthin improves renal function in atrazine -induced renal toxicity inmice

The serum creatinine (Scr), blood urea nitrogen (BUN) are the most representative of kidney functions. The serum Scr and BUN in atrazine induced renal injury mice were markedly elevated compared to Ncon group (P < 0.05) (Table 2). After 28 days of astaxanthin treatment (100 mg/kg bw), the levels of BUN and Scr were significantly (P < 0.05) decreased with compared to atrazine treated group.

Table 2.

Effect of astaxanthin on serum creatinine, blood urea nitrogen and serum renal oxidative stress indicators in atrazine induced nephrotoxicity mice (n = 10).

Tested parameters NCon Ccon ATX ATZ ATZ + ATX
Serum SCr 46.30 ± 1.67 50.48 ± 3.48 48.69 ± 1.98 139.48 ± 9.89### 58.36 ± 2.45***
BUN 9.87 ± 0.99 10.17 ± 0.78 8.97 ± 0.98 35.48 ± 1.14### 13.45 ± 0.85***
T-AOC 5.22 ± 0.99 5.15 ± 0.74 5.89 ± 0.29 1.97 ± 0.36### 6.22 ± 0.21***
MDA 8.52 ± 0.56 8.23 ± 0.36 9.24 ± 0.28 17.46 ± 1.11### 9.63 ± 0.85***
GSH 111.25 ± 10.1 105.20 ± 12.2 121.09 ± 11.3 49.52 ± 4.63### 89.65 ± 8.89***
SOD 149.32 ± 9.41 145.23 ± 8.56 155.63 ± 13.4 82.20 ± 5.46### 130.24 ± 11.5***
CAT 18.56 ± 1.23 17.56 ± 0.76 19.23 ± 1.46 6.25 ± 0.46### 19.46 ± 0.86***
Kidney T-AOC 2.98 ± 0.01 2.85 ± 0.07 3.12 ± 0.06 0.69 ± 0.01### 2.26 ± 0.03***
MDA 2.98 ± 0.08 3.00 ± 0.1 2.58 ± 0.23 8.23 ± 0.69### 3.45 ± 0.17**
GSH 28.20 ± 1.23 26.28 ± 0.85 33.28 ± 2.23 11.73 ± 0.68### 26.45 ± 1.09***
SOD 62.23 ± 1.24 63.45 ± 1.28 66.28 ± 4.56 23.24 ± 2.4### 55.30 ± 3.45***
CAT 82.45 ± 3.45 79.48 ± 4.76 80.48 ± 2.46 27.45 ± 1.11### 79.28 ± 2.86***

SCr: Serum creatinine (μmol/L); BUN: Blood urea nitrogen (mmol/L), serum T-AOC, GSH, and SOD: (U/mL), serum MDA: nmol/ml, Renal T-AOC, GSH, and SOD: (U/mg protein), Renal MDA: nmol/mg protein), Ncon: normal control, Ccon: corn oil control, ATX: astaxanthin, ATZ: atrazine, ATZ + ATX: atrazine+ astaxanthin, *P < 0.05 compare with Ncon, #P < 0.05 compare with ATZ.

Astaxanthin improves serum and renal antioxidant activities in atrazine-induced renal injury

The serum and renal antioxidant biomarkers such as GSH, CAT, MDA, SOD, and T-AOC levels are presented in Table 1. As shown in Table 2, compared with Ncon group the levels of serum and renal GSH, CAT, SOD, and T-AOC were remarkably downregulated whereas MDA contents were upregulated in the ATZ group. Notably, after the astaxanthin treatment (100 mg/kg bw) levels of serum and renal tissues antioxidant biomarkers such as GSH, CAT, SOD, and T-AOC were increased whereas MDA content decreases with comparison to ATZ group. These results indicated the potent antioxidant potential of astaxanthin.

Renal tissues histopathological analysis

The histopathological analysis of renal tissues in different groups is illustrated in fig. 1. As clearly seen from the fig. 1, a significant change in the renal tubular epithelial cell such as swelling, tubular necrosis, loss of proximal tubular, glomerulus, and interstitial congestion were noticed in the ATZ group compared to normal control group. Non-significant effects of Ccon and ASX control group on renal histopathology were observed compared to Ncon. Interestingly, ASX + ATZ treatment group restores atrazine mediated renal histological changes in mice.

Fig. 1.

Fig. 1

Effect of astaxanthin on renal histomorphology of atrazine induced nephrotoxicity mice (400x). Ncon: Normal control, Ccon: Corn oil control, ASX: Astaxanthin control, ATZ: Atrazine control, ASX + ATZ: Astaxanthin+ atrazine.

Astaxanthin regulates Na+, K+, Ca2+, and Mg2+ homeostasis in atrazine induced renal injury mice

As shown in fig. 2a–i, the concentration of Cl and Na+ in the atrazine treated group (ATZ) were higher whereas K+ was lower with comparison to Ncon group. Similarly, Na+-K+-ATPase activity was also lower in ATZ group with comparison to Ncon group. Astaxanthin markedly (P < 0.05) increases the Na+-K+-ATPase activity and rebalance the Na+ and K+ homeostasis.

Fig. 2.

Fig. 2

Effects of astaxanthin on the regulation of ionic homeostasis of atrazine induced nephrotoxicity mice.Ncon: Normal control, Ccon: Corn oil control, ASX: Astaxanthin control, ATZ: Atrazine control, ASX + ATZ: Astaxanthin+ atrazine, *P < 0.05 compared with Ncon, #P < 0.05 compared with ATZ.

The concentration of Mg2+ in the ATZ treated group was higher whereas Ca2+ was lower compared than that in the Con group, which were further rebalanced by astaxanthin treatments (100 mg/kg bw). The results showed that the Mg2+-ATPase, Ca2+-Mg2+-ATPase, and Ca2+-ATPase activities were higher in the ATZ group compared to the Ncon group, which were further returned to normal levels after astaxanthin treatments (Fig. 2a–i).

Protective impacts of astaxanthin against atrazine induced renal apoptosis

The renal genes expression of various anti-apoptosis factors such as B-cell lymphoma-2 (Bcl-2), and pro-apoptosis factors (Bax, Fas, Caspase3, and FasL) were also determined. The results revealed that atrazine treated group showed a significant (P < 0.05) downregulations of Bcl-2 gene expression whereas upregulation of Bax, Caspase3, Fas, and FasL compared to Ncon group (Fig. 3a–e). However, the non-significant effect of Fas in atrazine treated group was noticed compared to Ncon. Interestingly, ASX + ATZ treatment restores renal Bcl-2, Bax, Caspase3, Fas, and FasL gene expression in atrazine mediated renal injury mice (Fig. 3a–e).

Fig. 3.

Fig. 3

Effect of astaxanthin on renal apoptosis related genes expression of atrazine induced nephrotoxicity mice.Ncon: Normal control, Ccon: Corn oil control, ASX: Astaxanthin control, ATZ: Atrazine control, ASX + ATZ: Astaxanthin+ atrazine, *P < 0.05 compared with Ncon, #P < 0.05 compared with ATZ.

Protective effects of astaxanthin against atrazine induced changes on renal Nrf2 and its downstream genes

Nrf2 signaling pathway plays a key role in oxidative injury. Therefore, in the present study we also determined the expression of downstream genes involved in these pathways. As presented in fig. 4, ATZ treatment markedly downregulates the renal gene expressions of Nrf2, SOD1, GPx1, HO-1, CAT, and NQO1 with compared to Ncon group. The astaxanthin administration remarkably increases (P < 0.05) all testing transcription factors compared with atrazine group (Fig. 4).

Fig. 4.

Fig. 4

Effect of astaxanthin on renal nrf2 and its downstream genes expression of atrazine induced nephrotoxicity mice. Ncon: Normal control, Ccon: Corn oil control, ASX: Astaxanthin control, ATZ: Atrazine control, ASX + ATZ: Astaxanthin+ atrazine, *P < 0.05 compared with Ncon, #P < 0.05 compared with ATZ.

Effects of astaxanthin on renal aquaporins (AQPs) expression

The renal gene expressions of AQPs (AQP: 2, 6, 7, 11, AQP4V2, and AQP4V4) are presented in fig. 5a–h. The mRNA expression of renal AQPs (AQP: 2, 6, 7, 11, AQP4V2, and AQP4V4) in the ATZ group were upregulated compared to Ncon group. The gene expression levels of AQP1 and AQP3 were significantly (P < 0.05) decreases in the atrazine group compared to normal control group. Notably, after the exposure of astaxanthin significantly (P < 0.05) decreases in the renal gene expressions of AQPs (AQP: 2, 6, 7, 11, AQP4V2, and AQP4V4) and elevation in the AQP1 and AQP3 were observed compared to atrazine group (Fig. 5a–h).

Fig. 5.

Fig. 5

Effect of astaxanthin on renal AQPs genes expression of atrazine induced nephrotoxicity mice. Ncon: Normal control, Ccon: Corn oil control, ASX: Astaxanthin control, ATZ: Atrazine control, ASX + ATZ: Astaxanthin+ atrazine, *P < 0.05 compared with Ncon, #P < 0.05 compared with ATZ.

Discussion

From the past few years, burden and morbidity of environmental diseases are significantly increases including nephrosis. The prevalence of environmental nephrosis was reported to be higher among agricultural workers. Atrazine and its metabolites are present in surface water and groundwater and considered key determinants of environmental nephrosis. Until now, there are no effective treatment present for environmental nephrosis.13 Several studies concluded that carotenoids consumption decreased risk of various renal diseases.24,32–34 In this study, we explored the protective effect of astaxanthin against atrazine induced nephrotoxicity.

Serum creatinine and BUN are the key indicators of kidneys health, and increasing the levels of BUN, and Scr indicated impairment of renal function.37 The results of our study exhibited that atrazine exposure results in the elevation of SCr and BUN. This damage was further confirmed by using renal H & E staining (Table 1). Atrazine treatment results significant damage to kidneys such as tubular necrosis, interstitial congestion, and loss of proximal tubular were observed (Fig. 1). Notably, astaxanthin treatment significantly decreases the serum Cr, BUN and restores renal damage. Previously, Guo et al.13 also reported that lycopene decreases the SCr, BUN, and restore renal damage after atrazine exposure in mice.

Previously, many studies indicated that oxidative stress is the major mechanism of atrazine mediated toxicity.14,38,39 The over production of ROS decreases the effectiveness of antioxidant defenses. Earlier, it was observed that atrazine triggers the ROS production in quails which in turn damage mitochondria. Moreover, atrazine reported to increase the serum and renal MDA contents whereas decreases T-AOC, GSH, SOD, and CAT levels in quails.14 We also observed the increment of serum and renal MDA contents and decreases in the levels of T-AOC, GSH, SOD, and CAT after atrazine exposure to mice (Table 1). Interestingly, astaxanthin supplementation significantly (P < 0.05) decreases the serum and renal MDA contents whereas increases the T-AOC, GSH, SOD, and CAT levels. Consequently, astaxanthin antioxidant effect play a key role in protecting kidneys upon exposure to atrazine. Due to unique molecular structure of astaxanthin exert its powerful antioxidant activity via quenching singlet oxygen and scavenging free radicals.30,40,41

Nrf2 is a transcription factor and regulates antioxidant and phase II detoxification enzymes e.g. NQO1, GPx, HO-1, CAT, and SOD.42 We observed that atrazine treatment led to decrease the renal Nrf2 gene expression, which were closely link with previous findings.14 GPx, SOD, and CAT are the key enzymes in the first line of defense against OS whereas HO-1 and NQO1 are second line of defense against ROS (phase II enzymes).43 HO-1 plays a crucial role in regulating heme homeostasis and protection against free heme-induced toxicity. HO-1 plays a key role against free heme-induced toxicity protection and regulating heme homeostasis, which further regulates multi-components of nicotinamide-adenine dinucleotide phosphate (NADPH) oxidase. NQO1 is a cytosolic protein protecting cells against redox cycling and oxidative stress.44 ATZ treatment downregulates the renal gene expressions of Nrf2, SOD1, GPx1, HO-1, CAT, and NQO1 with compared to Ncon group which were further modulated by astaxanthin administration (Fig. 4). Previously, astaxanthin was reported to inhibit coronary microembolization-induced OS via activating Nrf2/HO-1.45 In another study, astaxanthin reduces the ROS production in human umbilical vein endothelial cells via Nrf2/HO-1 antioxidant pathway.46 Similarly, Chen et al.47 also observed that astaxanthin promotes Nrf2/ARE signaling and inhibit HG-induced renal fibrosis.

Apoptosis defines as an active mode of cell death. It was documented that apoptosis directly linked with the pathogenesis of many renal diseases.48 There are two main intracellular pathways for apoptosis that have been reported such as extrinsic pathway and intrinsic pathway. The extrinsic signaling pathway is mainly mediated by Fas/FasL and intrinsic pathway involved in a series of non-receptor-mediated intracellular signals (Bcl-2 family).49 Atrazine can cause apoptosis-related neurodegenerative effects by decreasing Bcl-2 level and increasing Bax in rat ventral midbrain. We observed that atrazine treated group showed a significant (p < 0.05) downregulations of Bcl-2 gene expression whereas upregulation of Bax, Caspase3, Fas, and FasL compared to Ncon group which were further rebalance by astaxanthin (Fig. 3a–e). Guo et al.50 reported that astaxanthin ameliorate acute kidney injury in rats via OS and mitochondrial-related apoptosis. In another study, it was also documented that astaxanthin protect against iohexol induced renal tubular epithelial cells via apoptosis.51

Ionic homeostasis imparts an important function in regulating the osmotic pressure and acid base balance, particularly in the kidney.52 K+ and Na+ are the highest content of cations present in the intracellular and extracellular fluid. What’smore, the kidney is the main organ to regulate the metabolism of Na+ and K+. The disturbance of ion concentration is directly linked with ATPases activity. The reabsorption of Na+ and K+ mainly mediated by Na+-K+-ATPase which is present in the proximal tubules in the kidney.53 It has been documented that atrazine markedly altar Na+-K+-ATPase activity and interrupted with ionic homeostasis in the heart, lead to cardiac damage.13 We observed that atrazine treatment significantly decreases Na+-K+-ATPase activity, K+, and increases Na+ and Cl in the renal tissues which were further rebalanced by astaxanthin treatment (Fig. 2a–i).

Ca2+ and Mg2+ are mainly regulated by kidneys. It is well known that magnesium and calcium are important elements in the human. That’swhy, when Ca2+ and Mg2+ homeostasis in the kidney is disturbed, it will result significant damage to the body.54,55 In our study, we also observed that atrazine markedly elevated the Ca2+-Mg2+-ATPase activity, increased Mg2+ and decreased Ca2+ in the kidney. Notably, astaxanthin supplementation significantly rebalances the ionic homeostasis in the kidney (Fig. 2a–i). Earlier studies also draw similar conclusions.13,16

AQPs are a family of highly selective transmembrane channels, consisting of 13 members, and responsible for water transport across cell. In mammals, AQPs are present in various tissues and organs.56 Eight different AQPs (AQPs: 1, 2, 3, 4, 5, 6, 7, and 11) in the different segments of renal tissues are present and play an important role to maintain normal urine concentration, tissue development and substance metabolism. It has been reported that AQPs participate in cancer, renal diseases, bowel disease, and dermatosis.57–60 A few studies reported that the expression of AQPs were dysregulated in diabetic nephropathy, polycystic kidney disease, renal carcinoma, renal fibrosis, pyelonephritis and IgA nephropathy, and hydronephrosis.56,61,62 What’smore, Guo et al.13 observed that atrazine treatment significantly dysregulated renal AQPs expression in mice and documented that lycopene treatment markedly rebalance renal AQPs in atrazine exposure mice. Earlier, Sohn et al.60 reported that glycyrrhizin protect gentamicin-induced acute renal failure via rebalance renal AQPs expression. In another study, Hongyan et al.63 also documented that liquiritigenin exhibit renal protective effects in potassium oxonate-induced hyperuricemia via targeting the AQPs. From these results it can be speculated that astaxanthin might maintain the normal physiological function of the kidneys via regulating renal AQPs expression and Nrf2 signaling pathways.

Conclusion

Current findings demonstrated that astaxanthin ameliorated atrazine induced nephrotoxicity via maintaining oxidative stress, ionic homeostasis and reversing the changes in AQPs. Furthermore, astaxanthin also inhibited Nrf2 signaling pathway in atrazine induced nephrotoxicity. Our study provided new theoretical basis and directions for further clinical application and study of astaxanthin for the treatment of environmental nephrosis. The collected astaxanthin findings are outlined in fig. 6.

Fig. 6.

Fig. 6

Collective ameliorative effects and pathways of astaxanthin against atrazine-induced nephrotoxicity via modulation of ionic homeostasis (adopted from Guo et al.13 ASX: Astaxanthin, ATZ: Atrazine.

Author contributions

Preparation, writing, data analysis, and revising paper contents were equally carried by all authors.

Funding

This research was funded by Taif University, Saudi Arabia, Project No. (TU-DSPP-2024-24).

Conflict of interest statement

The authors declare no conflict of interest.

Data availability

All data are presented in the figure. However additional information can be obtained from the corresponding author on request.

Ethical statement

All the experimental procedures were carried out in accordance with the National Institutes of Health Guidelines for the care and use of laboratory animals. All steps were followed to minimize the suffering of the experimental animals.

Acknowledgments

The authors extend their appreciation to Taif University, Saudi Arabia, for supporting this work through project number (TU-DSPP-2024-24).

Contributor Information

Mohamed Mohamed Soliman, Department of Clinical Laboratory Sciences, Turabah University College, Turabah, Taif University, Taif 21995, Saudi Arabia.

Khalid S Alotaibi, General Science and English Language Department, College of Applied Sciences, AlMaarefa University, Riyadh 71666, Saudi Arabia.

Shatha B Albattal, General Science and English Language Department, College of Applied Sciences, AlMaarefa University, Riyadh 71666, Saudi Arabia.

Saed Althobaiti, Department of Biology, Turabah University College, Turabah, Taif University, Taif 21995, Saudi Arabia.

Helal F Al-Harthi, Department of Biology, Turabah University College, Turabah, Taif University, Taif 21995, Saudi Arabia.

Arshad Mehmood, School of Food and Biological Engineering, Jiangsu University, 301 Xuefu Road, Zhenjiang, Jiangsu 212013, China.

References

  • 1. Satsuma K. Complete biodegradation of atrazine by a microbial community isolated from a naturally derived river ecosystem (microcosm). Chemosphere. 2009:77(4):590–596. [DOI] [PubMed] [Google Scholar]
  • 2. Short P, Colborn T. Pesticide use in the U.S. and policy implications: a focus on herbicides. Toxicol Ind Health. 1999:15(1):240–275. [DOI] [PubMed] [Google Scholar]
  • 3. Gagneten AM, Regaldo L, Carriquiriborde P, Reno U, Kergaravat SV, Butinof M, Agostini H, Alvarez M, Harte A. Atrazine characterization: an update on uses, monitoring, effects, and environmental impact, for the development of regulatory policies in Argentina. Integr Environ Assess Manag. 2022:19(3):684–697. [DOI] [PubMed] [Google Scholar]
  • 4. Schwab AP, Splichal PA, Banks MK. Persistence of atrazine and Alachlor in ground water aquifers and soil. Water Air Soil Pollut. 2006:171(1-4):203–235. [Google Scholar]
  • 5. Moorman TB, Jayachandran K, Reungsang AJSS. Adsorption and desorption of atrazine in soils and subsurface sediments. Soil Sci. 2001:166(12):921–929. [Google Scholar]
  • 6. Sass J, Colangelo A. European Union bans atrazine, while the United States negotiates continued use. Int J Occup Environ Health. 2006:12(3):260–267. [DOI] [PubMed] [Google Scholar]
  • 7. Mercurio P, Mueller JF, Eaglesham G, O'Brien J, Flores F, Negri AP. Degradation of herbicides in the tropical marine environment: influence of light and sediment. PLoS One. 2016:11(11):e0165890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Gfrerer M, Wenzl T, Quan X, Platzer B, Lankmayr E. Occurrence of triazines in surface and drinking water of Liaoning Province in eastern China. J Biochem Biophys Methods. 2002:53(1-3):217–228. [DOI] [PubMed] [Google Scholar]
  • 9. Battaglin WA, Rice KC, Focazio MJ, Salmons S, Barry RX. The occurrence of glyphosate, atrazine, and other pesticides in vernal pools and adjacent streams in Washington, DC, Maryland, Iowa, and Wyoming, 2005-2006. Environ Monit Assess. 2009:155(1-4):281–307. [DOI] [PubMed] [Google Scholar]
  • 10. Lebov JF, Engel LS, Richardson D, Hogan SL, Sandler DP, Hoppin JA. Pesticide exposure and end-stage renal disease risk among wives of pesticide applicators in the agricultural health study. Environ Res. 2015:143(Pt A):198–210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Liu W, du Y, Liu J, Wang H, Sun D, Liang D, Zhao L, Shang J. Effects of atrazine on the oxidative damage of kidney in Wister rats. Int J Clin Exp Med. 2014:7(10):3235–3243. [PMC free article] [PubMed] [Google Scholar]
  • 12. Dai XY, Li XW, Zhu SY, Li MZ, Zhao Y, Talukder M, Li YH, Li JL. Lycopene ameliorates Di(2-ethylhexyl) phthalate-induced Pyroptosis in spleen via suppression of classic Caspase-1/NLRP3 pathway. J Agric Food Chem. 2021:69(4):1291–1299. [DOI] [PubMed] [Google Scholar]
  • 13. Guo JY, Lin J, Huang YQ, Talukder M, Yu L, Li JL. AQP2 as a target of lycopene protects against atrazine-induced renal ionic homeostasis disturbance. Food Funct. 2021:12(11):4855–4863. [DOI] [PubMed] [Google Scholar]
  • 14. Zhang C, Qin L, Dou DC, Li XN, Ge J, Li JL. Atrazine induced oxidative stress and mitochondrial dysfunction in quail (Coturnix C. Coturnix) kidney via modulating Nrf2 signaling pathway. Chemosphere. 2018:212:974–982. [DOI] [PubMed] [Google Scholar]
  • 15. Olayinka ET, Ore A, Adewole KE, Oyerinde O. Evaluation of the toxicological effects of atrazine-metolachlor in male rats: in vivo and in silico studies. Environ Anal Health Toxicol. 2022:37(3):e2022021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Li X-N, Lin J, Xia J, Qin L, Zhu SY, Li JL. Lycopene mitigates atrazine-induced cardiac inflammation via blocking the NF-κB pathway and NO production. J Funct Foods. 2017:29:208–216. [Google Scholar]
  • 17. Wang H, Li XN, Li PC, Liu W, du ZH, Li JL. Modulation of heat-shock response is associated with Di (2-ethylhexyl) phthalate (DEHP)-induced cardiotoxicity in quail (Coturnix japonica). Chemosphere. 2019:214:812–820. [DOI] [PubMed] [Google Scholar]
  • 18. He M, Pan H, Chang RCC, So KF, Brecha NC, Pu M. Activation of the Nrf2/HO-1 antioxidant pathway contributes to the protective effects of Lycium barbarum polysaccharides in the rodent retina after ischemia-reperfusion-induced damage. PLoS One. 2014:9(1):e84800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Sahin K, Orhan C, Tuzcu M, Borawska MH, Jabłonski J, Guler O, Sahin N, Hayirli A. Berberis vulgaris root extract alleviates the adverse effects of heat stress via modulating hepatic nuclear transcription factors in quails. Br J Nutr. 2013:110(4):609–616. [DOI] [PubMed] [Google Scholar]
  • 20. Hawk MA, McCallister C, Schafer ZT. Antioxidant activity during tumor progression: a necessity for the survival of cancer cells? Cancers. 2016:8(10):92. 10.3390/cancers8100092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Bryan HK, Olayanju A, Goldring CE, Park BK. The Nrf2 cell defence pathway: Keap1-dependent and -independent mechanisms of regulation. Biochem Pharmacol. 2013:85(6):705–717. [DOI] [PubMed] [Google Scholar]
  • 22. Zhang C, Li XN, Xiang LR, Qin L, Lin J, Li JL. Atrazine triggers hepatic oxidative stress and apoptosis in quails (Coturnix C. Coturnix) via blocking Nrf2-mediated defense response. Ecotoxicol Environ Saf. 2017:137:49–56. [DOI] [PubMed] [Google Scholar]
  • 23. Cha SA, Park BM, Jung YJ, Kim SM, Kang KP, Kim W, Kim SH. Regional heterogeneity of expression of renal NPRs, TonEBP, and AQP-2 mRNAs in rats with acute kidney injury. Peptides. 2015:69:33–39. [DOI] [PubMed] [Google Scholar]
  • 24. Matsuzaki T, Yaguchi T, Shimizu K, Kita A, Ishibashi K, Takata K. The distribution and function of aquaporins in the kidney: resolved and unresolved questions. Anat Sci Int. 2017:92(2):187–199. [DOI] [PubMed] [Google Scholar]
  • 25. Yang B, Zhao D, Qian L, Verkman AS. Mouse model of inducible nephrogenic diabetes insipidus produced by floxed aquaporin-2 gene deletion. Am J Physiol Renal Physiol. 2006:291(2):F465–F472. [DOI] [PubMed] [Google Scholar]
  • 26. Haj-Yasein NN, Jensen V, Østby I, Omholt SW, Voipio J, Kaila K, Ottersen OP, Hvalby Ø, Nagelhus EA. Aquaporin-4 regulates extracellular space volume dynamics during high-frequency synaptic stimulation: a gene deletion study in mouse hippocampus. Glia. 2012:60(6):867–874. [DOI] [PubMed] [Google Scholar]
  • 27. Pereira CPM, Souza ACR, Vasconcelos AR, Prado PS, Name JJ. Antioxidant and anti-inflammatory mechanisms of action of astaxanthin in cardiovascular diseases (review). Int J Mol Med. 2021:47(1):37–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Aoi W, Naito Y, Sakuma K, Kuchide M, Tokuda H, Maoka T, Toyokuni S, Oka S, Yasuhara M, Yoshikawa T. Astaxanthin limits exercise-induced skeletal and cardiac muscle damage in mice. Antioxid Redox Signal. 2003:5(1):139–144. [DOI] [PubMed] [Google Scholar]
  • 29. Wu W, Wang X, Xiang Q, Meng X, Peng Y, du N, Liu Z, Sun Q, Wang C, Liu X. Astaxanthin alleviates brain aging in rats by attenuating oxidative stress and increasing BDNF levels. Food Funct. 2014:5(1):158–166. [DOI] [PubMed] [Google Scholar]
  • 30. Li L, Chen Y, Jiao D, Yang S, Li L, Li P. Protective effect of Astaxanthin on Ochratoxin A-induced kidney injury to mice by regulating oxidative stress-related NRF2/KEAP1 pathway. Molecules. 2020:25(6):1386. 10.3390/molecules25061386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Jiang W, Zhao H, Zhang L, Wu B, Zha Z. Maintenance of mitochondrial function by astaxanthin protects against bisphenol A-induced kidney toxicity in rats. Biomed Pharmacother. 2020:121:109629. [DOI] [PubMed] [Google Scholar]
  • 32. Akca G, Eren H, Tumkaya L, Mercantepe T, Horsanali MO, Deveci E, Dil E, Yilmaz A. The protective effect of astaxanthin against cisplatin-induced nephrotoxicity in rats. Biomed Pharmacother. 2018:100:575–582. [DOI] [PubMed] [Google Scholar]
  • 33. Liu G, Shi Y, Peng X, Liu H, Peng Y, He L. Astaxanthin attenuates adriamycin-induced focal segmental glomerulosclerosis. Pharmacology. 2015:95(3-4):193–200. [DOI] [PubMed] [Google Scholar]
  • 34. Zhu X, Chen Y, Chen Q, Yang H, Xie X. Astaxanthin promotes Nrf2/ARE Signaling to alleviate renal fibronectin and collagen IV accumulation in diabetic rats. J Diabetes Res. 2018:2018:6730315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Fanaee-Danesh E, Gali CC, Tadic J, Zandl-Lang M, Carmen Kober A, Agujetas VR, de Dios C, Tam-Amersdorfer C, Stracke A, Albrecher NM, et al. Astaxanthin exerts protective effects similar to bexarotene in Alzheimer's disease by modulating amyloid-beta and cholesterol homeostasis in blood-brain barrier endothelial cells. Biochim Biophys Acta Mol basis Dis. 2019:1865(9):2224–2245. [DOI] [PubMed] [Google Scholar]
  • 36. Bancroft JD, Layton C. In: Suvarna SK, Layton C, Bancroft JD, editors. 10 - the hematoxylins and eosin, in Bancroft's theory and practice of histological techniques (eighth edition). Elsevier Health Sciences; 2019. pp. 126–138. [Google Scholar]
  • 37. Meucci V, Luci G, Vanni M, Guidi G, Perondi F, Intorre L. Serum levels of ochratoxin a in dogs with chronic kidney disease (CKD): a retrospective study. J Vet Med Sci. 2017:79(2):440–447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Singh M, Sandhir R, Kiran R. Oxidative stress induced by atrazine in rat erythrocytes: mitigating effect of vitamin E. Toxicol Mech Methods. 2010:20(3):119–126. [DOI] [PubMed] [Google Scholar]
  • 39. Yoon DS, Park JC, Park HG, Lee JS, Han J. Effects of atrazine on life parameters, oxidative stress, and ecdysteroid biosynthetic pathway in the marine copepod Tigriopus japonicus. Aquat Toxicol. 2019:213:105213. [DOI] [PubMed] [Google Scholar]
  • 40. Iskender H, Yenice G, Dokumacioglu E, Hayirli A, Sevim C, Dokumacioglu A, Terim Kapakin KA. Astaxanthin alleviates renal damage of rats on high fructose diet through modulating NFκB/SIRT1 pathway and mitigating oxidative stress. Arch Physiol Biochem. 2020:126(1):89–93. [DOI] [PubMed] [Google Scholar]
  • 41. Zuluaga M, Gueguen V, Letourneur D, Pavon-Djavid G. Astaxanthin-antioxidant impact on excessive reactive oxygen species generation induced by ischemia and reperfusion injury. Chem Biol Interact. 2018:279:145–158. [DOI] [PubMed] [Google Scholar]
  • 42. Jaiswal AK. Nrf2 signaling in coordinated activation of antioxidant gene expression. Free Radic Biol Med. 2004:36(10):1199–1207. [DOI] [PubMed] [Google Scholar]
  • 43. Han X, Pan J, Ren D, Cheng Y, Fan P, Lou H. Naringenin-7-O-glucoside protects against doxorubicin-induced toxicity in H9c2 cardiomyocytes by induction of endogenous antioxidant enzymes. Food Chem Toxicol. 2008:46(9):3140–3146. [DOI] [PubMed] [Google Scholar]
  • 44. Liu X, Chen K, Zhu L, Liu H, Ma T, Xu Q, Xie T. Soyasaponin ab protects against oxidative stress in HepG2 cells via Nrf2/HO-1/NQO1 signaling pathways. J Funct Foods. 2018:45:110–117. [Google Scholar]
  • 45. Xue Y, Sun C, Hao Q, Cheng J. Astaxanthin ameliorates cardiomyocyte apoptosis after coronary microembolization by inhibiting oxidative stress via Nrf2/HO-1 pathway in rats. Naunyn Schmiedeberg's Arch Pharmacol. 2019:392(3):341–348. [DOI] [PubMed] [Google Scholar]
  • 46. Niu T, Xuan R, Jiang L, Wu W, Zhen Z, Song Y, Hong L, Zheng K, Zhang J, Xu Q, et al. Astaxanthin induces the Nrf2/HO-1 antioxidant pathway in human umbilical vein endothelial cells by generating trace amounts of ROS. J Agric Food Chem. 2018:66(6):1551–1559. [DOI] [PubMed] [Google Scholar]
  • 47. Chen Q, Tao J, Xie X. Astaxanthin promotes Nrf2/ARE Signaling to inhibit HG-induced renal fibrosis in GMCs. Mar Drugs. 2018:16(4):117. 10.3390/md16040117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Sanz AB, Santamaría B, Ruiz-Ortega M, Egido J, Ortiz A. Mechanisms of renal apoptosis in health and disease. J Am Soc Nephrol. 2008:19(9):1634–1642. [DOI] [PubMed] [Google Scholar]
  • 49. Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol. 2007:35(4):495–516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Guo SX, Zhou HL, Huang CL, You CG, Fang Q, Wu P, Wang XG, Han CM. Astaxanthin attenuates early acute kidney injury following severe burns in rats by ameliorating oxidative stress and mitochondrial-related apoptosis. Mar Drugs. 2015:13(4):2105–2123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Xu Y, Yao S, Gao D, Li W, Zheng D, Zhang Q. Effect of astaxanthin on apoptosis of rat renal tubular epithelial cells induced by iohexol. Am J Transl Res. 2019:11(5):3039–3047. [PMC free article] [PubMed] [Google Scholar]
  • 52. Klementová Š, Hornychová L, Šorf M, Zemanová J, Kahoun D. Toxicity of atrazine and the products of its homogeneous photocatalytic degradation on the aquatic organisms Lemna minor and Daphnia magna. Environ Sci Pollut Res Int. 2019:26(26):27259–27267. [DOI] [PubMed] [Google Scholar]
  • 53. Zhang C, Li H, Qin L, Ge J, Qi Z, Talukder M, Li YH, Li JL. Nuclear receptor AHR-mediated xenobiotic detoxification pathway involves in atrazine-induced nephrotoxicity in quail (Coturnix C. Coturnix). Environ Pollut. 2019:253:889–898. [DOI] [PubMed] [Google Scholar]
  • 54. Qu F, Liu S, He C, Zhou J, Zhang S, Ai Z, Chen Y, Yu Z, Ni D. Comparison of the effects of green and black tea extracts on Na(+) /K(+) -ATPase activity in intestine of type 1 and type 2 diabetic mice. Mol Nutr Food Res. 2019:63(17):e1801039. [DOI] [PubMed] [Google Scholar]
  • 55. Shui C, Shi Y, Hua X, Zhang Z, Zhang H, Lu G, Xie Y. Serum osmolality and ions, and gill Na + /K + -ATPase of spottedtail goby Synechogobius ommaturus (R.) in response to acute salinity changes. Aquacult Fish. 2018:3(2):79–83. [Google Scholar]
  • 56. Morrissey JJ, Mobley J, Figenshau RS, Vetter J, Bhayani S, Kharasch ED. Urine aquaporin 1 and perilipin 2 differentiate renal carcinomas from other imaged renal masses and bladder and prostate cancer. Mayo Clin Proc. 2015:90(1):35–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Hara-Chikuma M, Satooka H, Watanabe S, Honda T, Miyachi Y, Watanabe T, Verkman AS. Aquaporin-3-mediated hydrogen peroxide transport is required for NF-κB signalling in keratinocytes and development of psoriasis. Nat Commun. 2015:6(1):7454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Miller EW, Dickinson BC, Chang CJ. Aquaporin-3 mediates hydrogen peroxide uptake to regulate downstream intracellular signaling. Proc Natl Acad Sci USA. 2010:107(36):15681–15686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Vieceli Dalla Sega F, Zambonin L, Fiorentini D, Rizzo B, Caliceti C, Landi L, Hrelia S, Prata C. Specific aquaporins facilitate Nox-produced hydrogen peroxide transport through plasma membrane in leukaemia cells. Biochim Biophys Acta. 2014:1843(4):806–814. [DOI] [PubMed] [Google Scholar]
  • 60. Ampawong S, Klincomhum A, Likitsuntonwong W, Singha O, Ketjareon T, Panavechkijkul Y, Zaw KM, Kengkoom K. Expression of aquaporin-1, −2 and −4 in mice with a spontaneous mutation leading to hydronephrosis. J Comp Pathol. 2012:146(4):332–337. [DOI] [PubMed] [Google Scholar]
  • 61. Wang W, Luo R, Lin Y, Wang F, Zheng P, Levi M, Yang T, Li C. Aliskiren restores renal AQP2 expression during unilateral ureteral obstruction by inhibiting the inflammasome. Am J Physiol Renal Physiol. 2015:308(8):F910–F922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Rocchetti MT, Tamma G, Lasorsa D, Suriano IV, D'Apollo A, Papale M, Mastrofrancesco L, Grandaliano G, Svelto M, Valenti G, et al. Altered urinary excretion of aquaporin 2 in IgA nephropathy. Eur J Endocrinol. 2011:165(4):657–664. [DOI] [PubMed] [Google Scholar]
  • 63. Hongyan L, Suling W, Weina Z, Yajie Z, Jie R. Antihyperuricemic effect of liquiritigenin in potassium oxonate-induced hyperuricemic rats. Biomed Pharmacother. 2016:84:1930–1936. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data are presented in the figure. However additional information can be obtained from the corresponding author on request.


Articles from Toxicology Research are provided here courtesy of Oxford University Press

RESOURCES