MicroRNA-375-3p Alleviates Salicylate-Induced Neuronal Injury by Targeting ELAVL4 in Tinnitus

Abstract

Purpose  Tinnitus is a phantom perception of sound in the absence of acoustic source. Previous evidence has indicated that miR-375-3p is downregulated in rats with tinnitus in comparison to the controls. Nevertheless, its molecular mechanism underlying tinnitus pathogenesis is unclarified.

Methods  SH-SY5Y cells were differentiated into neuronlike cells and stimulated with salicylate to mimic tinnitus in vitro. Immunofluorescence staining was utilized for measuring expression of NR2B (glutamate ionotropic receptor NMDA type subunit 2B). Intracellular reactive oxygen species (ROS) level was determined using DCFH-DA assay kit. Real-time quantitative polymerase chain reaction as well as western blotting was utilized for examining RNA and protein levels. Luciferase reporter assay was implemented for verifying the interaction between miR-375-3p and ELAVL4 (ELAV-like RNA-binding protein 4).

Results  Salicylate treatment enhanced levels of NR2B and the early immediate gene ARC as well as ROS production. miR-375-3p was downregulated in salicylate-treated group. Overexpressing miR-375-3p attenuated the effects induced by salicylate in SH-SY5Y cells. miR-375-3p targeted ELAVL4 and upregulating ELAVL4 reversed miR-375-3p upregulation–triggered effects on SH-SY5Y cells under salicylate treatment.

Conclusion  miR-375-3p mitigates salicylate-triggered neuronal injury in SH-SY5Y cells by regulating ELAVL4 expression.

Introduction

Tinnitus is a phantom perception of sound in the absence of external acoustic source. ¹ Approximately, 10 to 15% of the population worldwide are afflicted with tinnitus, of which 1 to 2% experience a significantly impaired quality of life. ² The etiological factors related to tinnitus include hearing loss, noise exposure, ototoxicity, head/neck trauma, and psychiatric disorders such as depression. ³ Moreover, it has been proposed that the damage to either the peripheral or central auditory nervous system contributes to the onset of tinnitus. ⁴ There is currently no cure for tinnitus, which is greatly related to the poor understanding of the mechanism underlying tinnitus onset. ⁵ Salicylate-induced tinnitus model has been widely used for investigating the biological mechanism underlying tinnitus. High doses of salicylate can enhance auditory thresholds, decrease otoacoustic emissions, and reliably trigger tinnitus. ⁶

Glutamate is an important neurotransmitter in the central nervous system that produces an excitatory response under normal conditions by interacting with its receptors. ⁷ However, overexcitation of glutamate receptor results in excitotoxicity, inducing overproduction of reactive oxygen species (ROS). ROS overproduction causes DNA damage, loss of proteostasis, and destruction of organelles, consequently leading to neuronal death. ^{4 8} N -methyl-D-aspartate (NMDA) receptors (NRs) are a subtype of glutamate receptors. Excessive activation of NRs has been considered a potential risk factor for tinnitus. ⁹ Several reports have illustrated that blockade of NRs ameliorates salicylate-triggered tinnitus in animal models. ^{10 11} Nevertheless, the mechanisms underlying NR-mediated excitotoxicity in tinnitus are unclear.

MicroRNAs (miRNAs) are small nonprotein-coding RNAs that modulate gene expression posttranscriptionally. ¹² Studies have demonstrated that miRNAs are implicated in various biological responses, such as differentiation, autophagy, and oxidative stress. ^{13 14 15} It is recognized that miRNAs can target the 3′ UTRs of cytosolic mRNAs by base pairing, consequently leading to mRNA degradation or translation repression. ¹⁶ Multiple miRNAs have been suggested to regulate disease progression by targeting their downstream mRNAs, indicating their potentials as biomarkers and therapeutic targets for diseases. ^{17 18} However, there are few studies on tinnitus-related miRNAs. Many reports have indicated the significant role of miR-375-3p in disease progression. For instance, miR-375-3p enhances rat cardiomyocyte apoptosis under hypoxia treatment by targeting FOXP1 and Bcl2l2 . ¹⁹ It alleviates inflammatory response in human keratinocytes by regulating YAP1/LEKTI pathway. ²⁰ Moreover, Han et al proposed that miR-375-3p is downregulated in rats with tinnitus compared with that in control rats and overexpressing miR-375-3p may prevent the persistence of tinnitus in rats. ²¹ Nonetheless, the molecular mechanisms of miR-375-3p underlying tinnitus pathogenesis remain unclarified.

Herein, we examined the functions and mechanism of miR-375-3p in tinnitus in vitro. It was hypothesized that miR-375-3p might affect salicylate-triggered neuron injury by regulating its downstream molecules. The findings might be helpful for developing new therapeutic strategies for tinnitus.

Materials and Methods

Cell Culture and Treatment

Human neuroblastoma cell line SH-SY5Y (CL-0208, Procell, Wuhan, China) were incubated in Minimum Eagle Medium/F12 (EME/F12; CM-0208, Procell) containing 15% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37°C in a humidified incubator with 5% CO ₂ . For neuronal differentiation, cells were incubated in differentiation medium containing 0.1% FBS, 1% penicillin/streptomycin, and 1 μM retinoic acid (Solarbio, Beijing, China) for 2 days. ²² Differentiated SH-SY5Y neurons were treated with salicylate (40 μg/mL) for 8 hours to mimic tinnitus in vitro. ²³

Cell Transfection

Cell transfection was conducted before salicylate treatment using Lipofectamine 3000 (Invitrogen, Carlsbad, California, United States). miR-375-3p mimics or its negative control (miR-NC) and ELAVL4 (ELAV-like RNA-binding protein 4) overexpression vector or its control empty vector were, respectively, transfected into SH-SY5Y cells for upregulating miR-375-3p or ELAVL4 . All plasmids were purchased from GenePharma (Shanghai, China).

Real-Time Quantitative Polymerase Chain Reaction

Total RNA was extracted from cells using TRIzol reagent (Invitrogen). cDNA was prepared using iScript cDNA Kit (Bio-Rad, Hercules, California, United States). Real-time quantitative polymerase chain reaction (RT-qPCR) was implemented using GoTaq qPCR Master Mix (Promega, Madison, Wisconsin, United States) on a CFX96TM Real-Time PCR Detection System (Bio-Rad). Relative gene expression was calculated using the 2 ^−ΔΔCt method, normalized to GAPDH or U6. Primers are listed in Table 1 .

Table 1. Primers used for RT-qPCR.

Gene	Forward primer	Reverse primer
miR-375-3p	CGGGTTTGTTCGTTCGGCT	GTGCAGGGTCCGAGGTATT
NR2B	AGTTCCGACATTGCTTTATGG	TGCAGCTGTAGATACCTCTG
ARC	CTCAGCTCCAGTGATTCAC	CCTTGAGACCTGTTGTCAC
RLF	GAATTACTGCTTTCAGTGTCTG	ATGTGACTCCTGTAGAGACTG
POC1B	CATCTATACACTTCAAGGACATACG	AGTCCTCCATAATAAGACCTGTG
ELAVL4	GATCAAGTCACAGGAGTGTC	CCCTTTGATGGCTTCTTCTG
GAPDH	TCAAGATCATCAGCAATGCC	CGATACCAAAGTTGTCATGGA
U6	ATACAGAGAAAGTTAGCACGG	GGAATGCTTCAAAGAGTTGTG

Immunofluorescence Staining

Cells with indicated treatments were fixed with 4% paraformaldehyde in phosphate buffer saline (PBS), permeabilized in 0.1% Triton X-100 three times and blocked with 5% bovine serum albumin. Then, the cells were incubated at 4°C overnight with anti-NR2B (NR subunit 2B, NMDAR2B) antibody (5 µg/mL; ab65783, Abcam, Shanghai, China) and then incubated with Alexa Fluor 555–conjugated secondary antibody (ab150078, Abcam) at room temperature for 1 hour. Next, cells were washed three times with PBS and counterstained with DAPI (4',6-diamidino-2-phenylindole). Stained cells were mounted with antifade reagent, covered with a coverslip, and observed with a fluorescence microscope (Olympus, Tokyo, Japan).

Measurement of ROS

Intracellular ROS level was analyzed using DCFH-DA ROS Assay Kit (Solarbio). Cells were incubated with DCFH-DA (10 μM) for 20 minutes at 37°C in the dark. After washing three times to remove DCFH-DA that did not enter the cells, a fluorescence microplate (BD Biosciences, San Jose, California, United States) was used to measure the fluorescence intensity of dichlorofluorescein (DCF). The fluorescence intensity of DCF is proportional to ROS level.

Western Blotting

Proteins in cells were isolated using RIPA buffer (Solarbio) and quantified with a BCA Protein Assay Kit (Solarbio). Protein samples (20 μg) were separated by 10% SDS-PAGE and blotted onto polyvinylidene fluoride membranes (Beyotime, Shanghai, China). After blocking with 5% defatted milk, the membranes were incubated at 4°C overnight with anti-ELAVL4 (ab302514, 1:1,000, Abcam) and anti-GAPDH (ab9485, 1:2,500, Abcam) primary antibodies followed by incubation with the antirabbit secondary antibody (Abcam) for 2 hours at room temperature. Eventually, protein bands were visualized with an enhanced chemiluminescence kit (Solarbio) and quantified with ImageJ software (National Institutes of Health, Bethesda, Maryland, United States).

Luciferase Reporter Assay

Putative binding site between miR-375-3p and ELAVL4 was shown by TargetScan ( https://www.targetscan.org/vert_71/ ). Wild-type (Wt) or mutant (Mut) sequence of ELAVL4 3′ UTR containing miR-375-3p binding site was subcloned into pmirGLO vector (Promega). These vectors were cotransfected with miR-NC or miR-375-3p mimics into SH-SY5Y cells using Lipofectamine 3000 (Invitrogen). After 48 hours, the luciferase activity was examined using a Dual Luciferase Reporter Assay System (Promega).

Statistical Analysis

Statistical analysis was performed using SPSS 25.0 software (IBM, Armonk, Massachusetts, United States). Data are presented as mean ± standard deviation. Each experiment was implemented in triplicate. Differences between two groups were analyzed with Student's t -test, while those among multiple groups were evaluated using analysis of variance followed by Tukey's post hoc analysis. Significance was defined as p < 0.05.

Results

Salicylate Induces Neuron Injury and miR-375-3p Downregulation

SH-SY5Y neurons were stimulated with salicylate to mimic tinnitus in vitro. We then examined the effect of salicylate on SH-SY5Y cells. NR2B is a subunit of NRs. Immunofluorescence (IF) staining revealed that salicylate treatment markedly increased NR2B expression in SH-SY5Y cells ( Fig. 1A ). Consistent results were observed in Fig. 1B , as displayed by RT-qPCR. Additionally, salicylate induction significantly enhanced the level of ARC, an immediate early gene in neuronlike SH-SY5Y cells ( Fig. 1C ). Moreover, in comparison to the control group, salicylate-treated group displayed increased level of intracellular ROS ( Fig. 1D, E ). These data validated that salicylate significantly triggered neuron injury in SH-SY5Y cells. Notably, downregulation of miR-375-3p was observed in salicylate-stimulated cells as compared with that in the controls ( Fig. 1F ), indicating the potential role of miR-375-3p in tinnitus.

Fig. 1.

Salicylate induces neuron injury and miR-375-3p downregulation. SH-SY5Y cells were differentiated into neuronlike cells and treated with or without salicylate. (A) Representative images of IF staining for evaluating NR2B expression. (B, C) RT-qPCR analysis of NR2B (B) and ARC (C) mRNA expression. (D, E) DCFH-DA method for evaluating intracellular ROS production. (F) RT-qPCR analysis of miR-375-3p expression. ** p < 0.01.

Overexpressing miR-375-3p Mitigates Salicylate-Triggered Neuron Injury

To investigate miR-375-3p role in tinnitus in vitro, we overexpressed miR-375-3p in salicylate-treated neuronlike SH-SY5Y cells ( Fig. 2A ). Relative to miR-NC–treated group, miR-375-3p–overexpressed group exhibited decreased level of NR2B, as shown by IF staining and RT-qPCR ( Fig. 2B, C ). In parallel, upregulating miR-375-3p markedly reduced ARC expression and ROS production in SH-SY5Y cells under salicylate treatment ( Fig. 2D, F ). Collectively, miR-375-3p upregulation could alleviate salicylate-evoked neuron injury.

Fig. 2.

Overexpressing miR-375-3p mitigates salicylate-triggered neuron injury. SH-SY5Y cells were transfected with miR-NC or miR-375-3p mimics and stimulated with salicylate. (A) RT-qPCR for assessing miR-375-3p overexpression efficiency. (B) Representative images of IF staining for examining NR2B level. (C, D) RT-qPCR analysis of NR2B (C) and ARC (D) mRNA expression. (E, F) Intracellular ROS level detected by DCFH-DA assay kit. ** p < 0.01, *** p < 0.001.

miR-375-3p Targets ELAVL4

Subsequently, we explored the potential molecular mechanism of miR-375-3p in salicylate-stimulated SH-SY5Y cells. With the screening condition of target score > 95, three candidate targets were predicted from miRDB database ( Fig. 3A ). As shown by RT-qPCR, among the three candidate mRNAs, only ELAVL4 level was significantly decreased in miR-375-3p–overexpressed cells ( Fig. 3B ). Western blotting confirmed that miR-375-3p upregulation inhibited ELAVL4 protein expression in SH-SY5Y cells ( Fig. 3C, D ). Highly conserved binding site of miR-375-3p on ELAVL4 was predicted by TargetScan database ( Fig. 3E, F ). Moreover, upregulating miR-375-3p markedly weakened the luciferase activity of vector containing Wt ELAVL4 3′ UTR but had no significant impact on that of Mut ELAVL4 3′ UTR ( Fig. 3G ), verifying the interaction between miR-375-3p and ELAVL4 .

Fig. 3.

miR-375-3p targets ELAVL4. (A) miRDB website predicts the downstream targets of miR-375-3p (screening condition: target score > 95). (B) RT-qPCR for determining mRNA levels of candidate genes in miR-375-3p–overexpressed SH-SY5Y cells under salicylate treatment. (C, D) Western blotting of ELAVL4 protein level in indicated cells. (E, F) Highly conserved binding site of miR-375-3p on ELAVL4 3′ UTR. (G) Luciferase reporter assay for verifying the interaction between ELAVL4 and miR-375-3p. ** p < 0.01.

ELAVL4 Overexpression Reverses the Cytoprotective Effect of miR-375-3p on SH-SY5Y Cells

Rescue experiments were conducted to verify whether miR-375-3p exerted its cytoprotective role in neuronlike SH-SY5Y cells under salicylate treatment by targeting ELAVL4 . SH-SY5Y cells transfected with ELAVL4 overexpression vector showed higher ELAVL4 expression at mRNA and protein levels than those transfected with empty vector ( Fig. 4A–C ). Notably, overexpressing ELAVL4 partially reversed miR-375-3p mimics–mediated downregulation of NR2B in salicylate-treated cells ( Fig. 4D, E ). Likewise, miR-375-3p upregulation–triggered inhibition of ARC gene expression and ROS production was significantly abated by upregulating ELAVL4 ( Fig. 4F–H ). These data suggested that miR-375-3p protected against salicylate-evoked neuron injury by targeting ELAVL4 .

Fig. 4 ELAVL4 overexpression reverses the cytoprotective effect of miR-375-3p on SH-SY5Y cells.

SH-SY5Y cells were transfected with miR-NC, miR-375-3p mimics, or miR-375-3p mimics + ELAVL4 overexpression vector and exposed to salicylate. (A–C) RT-qPCR as well as western blotting for testing ELAVL4 overexpression efficiency. (D) Representative images of IF staining for measuring NR2B level. (E, F) RT-qPCR analysis of NR2B (E) and ARC (F) mRNA levels. (G, H) Detection of intracellular ROS level using DCFH-DA method. ** p < 0.01, *** p < 0.001.

Discussion

Tinnitus is defined not as a disease but as a common symptom. People with severe tinnitus are often afflicted with depression, anxiety, and sleep disturbance, which adversely affect their life quality. ²⁴ Despite numerous studies on tinnitus, the mechanism underlying tinnitus is still not fully understood, highlighting the need of further exploration. Salicylate, an ototoxic drug, has been widely adopted to induce tinnitus. ^{23 25 26} Based on previous evidence, neuronlike SH-SY5Y cells were stimulated with salicylate to mimic tinnitus in vitro.

Activation of NRs is considered to mainly occur under pathological conditions, such as excitotoxicity, in mature cochlea. ²⁷ Increasing evidence has suggested that blockade of NRs is a potential therapeutic strategy for tinnitus. ²⁸ NR2B is a subunit of NRs. Our results demonstrated that salicylate treatment significantly increased expression levels of NR2B and the early immediate gene, ARC , in SH-SY5Y cells. Additionally, evidence suggests that overexcitation of NR-triggered excitotoxicity induces excessive production of ROS, ultimately leading to neuronal death. ⁴ Here, our results revealed the high intracellular ROS level in salicylate-treated group. These results were consistent with previous studies as mentioned earlier, confirming the successful establishment of tinnitus model in vitro.

Accumulating evidence has illustrated that miRNAs are implicated in regulation of various pathological events; however, tinnitus-associated miRNAs have rarely been reported. A previous study indicated the downregulation of miR-375-3p in rats with tinnitus and that overexpressing miR-375-3p may prevent the persistence of tinnitus in rats. ²¹ In this study, we further explored the function of miR-375-3p in regulating salicylate-triggered neuron injury. Consistent with previous evidence, our results depicted that miR-375-3p level was decreased in salicylate-treated SH-SY5Y neurons in comparison to that in control cells. Functionally, upregulating miR-375-3p significantly attenuated salicylate-evoked neuron injury, as indicted by decreased levels of NR2B and ARC as well as ROS production.

The potential molecular mechanism of miR-375-3p in salicylate-stimulated SH-SY5Y cells was also investigated. miRNAs can interact with their downstream mRNAs to regulate mRNA stability and translation, thereby affecting various biological responses. ^{29 30} In this study, with bioinformatics analysis and validation experiments, we verified that miR-375-3p targeted ELAVL4 in SH-SY5Y cells under salicylate treatment. ELAVL4 , also known as HuD , is located at chromosome 1p33-p32.3 and proposed to regulate the translation and splicing of multiple Alzheimer's disease–associated genes as an RNA-binding protein. ³¹ ELAVL4 is abundantly expressed in developing neurons and plays a pivotal role in brain development, synaptic plasticity, and neurodegenerative disorders. ³² Nevertheless, its association with tinnitus has not been illustrated. In this study, we found that overexpressing ELAVL4 could reverse miR-375-3p upregulation–mediated reduction in NR2B and ARC expression as well as ROS production, indicating that ELAVL4 offset the neuroprotective effect of miR-375-3p on SH-SY5Y cells under salicylate treatment. Additionally, previous reports have indicated that ELAVL4 can stabilize the mRNA and elevate expression of proteins with critical synaptic functions, such as brain-derived neurotrophic factor, to strengthen synapses of individual dendritic branches. ³³ Due to the complexity of molecular mechanisms, the functions of miR-375-3p/ ELAVL4 axis and downstream genes of ELAVL4 in tinnitus are needed to be further explored.

In conclusion, we explored the role and mechanism of miR-375-3p in salicylate-treated neuronlike SH-SY5Y cells. The results revealed that miR-375-3p attenuates salicylate-induced neuron injury by targeting ELAVL4 in SH-SY5Y cells. Our findings might help develop a new therapeutic approach for tinnitus.

Funding Statement

Funding This work was supported by Medical Research Fund of Wuhan Health and Health Commission, Youth Project (Approval Number: WX19Q15).