Skip to main content
NCBI home page
Parasitology logoLink to Parasitology
. 2022 Aug 15;149(12):1590–1606. doi: 10.1017/S003118202200110X

Species complexes and life cycles of digenetic trematodes from the family Derogenidae

Darya Krupenko 1,✉, Georgii Kremnev 1, Anna Gonchar 1,2, Alexandra Uryadova 1, Aleksei Miroliubov 1,2, Vladimir Krapivin 1, Olga Skobkina 1, Arseniy Gubler 1, Olga Knyazeva 1
PMCID: PMC11077523  PMID: 35968696

graphic file with name S003118202200110X_figAb.jpg

Open in a new tab

Key words: Cercariae, Derogenes, fish parasites, Hemiuroidea, life cycles, Progonus, species recognition, Trematoda

Abstract

The best way to study digenean diversity combines molecular genetic methods, life-cycle studies and elaborate morphological descriptions. This approach has been barely used for one of the most widespread digenean taxa parasitizing fish – the superfamily Hemiuroidea. Here, we applied the integrative approach to the hemiuroideans from the family Derogenidae parasitizing fish at the White and Barents Seas. Analysis of 28S, 18S, 5.8S rDNA, ITS2 and cox1 gene sequences from sexually adult worms (maritae) showed genetic heterogeneity for 2 derogenid species known from this area: Derogenes varicus and Progonus muelleri. Thus, 2 pairs of genetic lineages were found: DV1 and DV2, PM1 and PM2, respectively. Data from other regions indicate that 2 more lineages of D. varicus probably exist. Based on previous records from the White and Barents Seas, we hypothesized that the cercariae found in the moonsnails (family Naticidae) belong to the Derogenidae and may help to differentiate these lineages as species. According to our results, Cercaria appendiculata from Cryptonatica affinis matched DV1, similar nameless cercariae from Euspira pallida and Amauropsis islandica matched DV2, and Cercaria octocauda from C. affinis matched PM1. We provide new data on the structure of these cercariae and discuss the life-cycle pattern of the studied digeneans.

Introduction

The Digenea is the most species-rich group of the parasitic worms, however, their diversity is far from being well studied. The main reasons are: (1) lack of faunistic data in many regions; (2) phenotypic variation; (3) the existence of cryptic or just hardly distinguishable species; and (4) the complex life cycles (Cribb, 2016). Happily, an integrative approach incorporating molecular genetics and modern morphological methods applied to different life-cycle stages gives the opportunity to bring the research on the digenean diversity to a new level (Georgieva et al., 2013; Gilardoni et al., 2020; Gonchar and Galaktionov, 2021; Huston et al., 2021; Faltýnková et al., 2022). This approach has been barely used for one of the most widespread digenean taxa parasitizing fish – the superfamily Hemiuroidea. Species identification of sexual adults (maritae) in certain hemiuroidean groups is problematic due to ambiguous morphological characteristics, apparently low host specificity and worldwide distribution. These problems are particularly true for the family Derogenidae, subfamily Derogeninae, with Derogenes varicus (Müller, 1784) Looss, 1901 being reported as one of the most widespread marine digenean species (WoRMS, 2022), but suspected to represent a cryptic species complex (Bray et al., 2016). Molecular data on the derogenids are few, and none of them cover the life-cycle stages from the first intermediate hosts.

Hemiuroideans typically possess 3-host life cycles (Hunninen and Cable, 1943; Køie, 1979, 1989, 1990a; Køie et al., 2002). Within the first intermediate host they produce a very special type of cercariae – cystophorous ones. The tail of such cercariae is partially transformed into a caudal cyst, and the body of the infective cercaria is withdrawn inside it. The caudal cyst may bear different types of appendages, some of which are used for locomotion (Køie, 1979, 1990a, 1992). The cyst also has a delivery tube – a special structure enabling infection of the next host. The second intermediate hosts of hemiuroideans are small crustaceans, often planktonic copepods. When they bite a caudal cyst, the delivery tube everts and penetrates their foregut, injecting the cercarial body into the haemocoel (Matthews, 1981).

Cystophorous cercariae have been described from marine and freshwater gastropods (Hunninen and Cable, 1943; Madhavi, 1978; Køie, 1979, 1989; Goater et al., 1990; Shameem et al., 1990), and also from bivalves and scaphopods (Wardle, 1975; Køie et al., 2002; Louvard et al., 2022). Among them are 4 different types of cercariae that have been found in the moonsnails (family Naticidae) from the Northern Atlantic and the adjacent Arctic (Barents and White Seas). The first, Cercaria appendiculata Pelseneer, 1906 has a furcate locomotory appendage, was primarily described from Euspira nitida (Donovan, 1803), and later found in Cryptonatica affinis (Gmelin, 1791) (Chubrik, 1966; Timofeeva, 1976; Køie, 1979). Køie (1979) demonstrated experimentally that C. appendiculata is the larva of Derogenes varicus. A similar cercaria was recovered from Euspira pallida (Broderip & G. B. Sowerby I, 1829) by Køie (1990b). At first, she supposed it belonged to Hemiurus levinseni Odhner, 1905, but later reassigned it to the Derogenidae (Køie, 1995, 2000). Another type of cystophorous cercariae described from the moonsnail C. affinis from the Barents Sea – Cercaria octocauda Tschubrik, 1952 – is characterized by a locomotory appendage with 8 long immotile threads on its end (Chubrik, 1966; Timofeeva, 1976). Finally, Cercaria saccocaudata Tschubrik, 1966 was described from C. affinis at the Barents and White Seas (Chubrik, 1966; Timofeeva, 1976). It lacks a locomotory appendage, and regarding the morphology it was supposed to belong to the family Lecithasteridae (Chubrik, 1966; Timofeeva, 1976), and finally proved to be Lecithaster salmonis (Krupenko et al., 2022).

In the present paper we revisit systematics and life cycles of the Derogenidae, subfamily Derogeninae at the White and Barents Seas. Maritae morphologically assigned to D. varicus and Progonus muelleri (Levinsen, 1881) Looss, 1899 were found to be genetically heterogeneous (in fragments of 28S, 18S, 5.8S rDNA, ITS2 and cox1 gene), thus possibly representing groups of species challenging to identify. Based on previous records of digenean fauna in the White and Barents Seas (Shulman and Shulman-Albova, 1953; Polyansky, 1955; Chubrik, 1966), we hypothesized that 3 types of cystophorous cercariae infecting the moonsnails in the White and Barents Seas also belong to the Derogeninae. Cercaria octocauda was proved to be the larva of P. muelleri. Two cercariae with furcate locomotory appendage matched 2 lineages within D. varicus.

Materials and methods

Sampling

Intermediate and definitive hosts were sampled at the White Sea (3 sites: Keret Archipelago, Velikaya Salma Strait and Bolshoy Solovetsky Island) in 2018–2021, and at the Barents Sea (Dalniye Zelentsy) in July–August 2021. Three moonsnail species were checked for the digenean infection: Cryptonatica affinis and Euspira pallida from both the White and Barents Seas, and Amauropsis islandica (Gmelin, 1791) from the White Sea. We searched for maritae of the family Derogenidae in 16 fish species from the White Sea and 4 species from the Barents Sea (Table 1). For other purposes we dissected whelks Buccinum scalariforme Møller, 1842 (N = 31) from the White Sea. A single derogenid marita was found in the stomach of 1 whelk.

Table 1.

Fish hosts examined, prevalence (%) and intensity data for derogenid maritae from the White and Barents Seas

Derogenes varicus Progonus muelleri
Host family Host species N Prevalence (%) Mean intensity Prevalence (%) Mean intensity
White Sea Keret Archipelago Agonidae Agonus cataphractus (Linnaeus, 1758) 1 – – – –
Anarhichadidae Anarhichas lupus Linnaeus, 1758 27 7 1 – –
Clupeidae Clupea pallasii marisalbi Berg, 1923 37 5 7 – –
Cottidae Gymnocanthus tricuspis (Reinhardt, 1830) 1 – – – –
Cottidae Myoxocephalus quadricornis (Linnaeus, 1758) 5 20 1 – –
Cottidae M. scorpius (Linnaeus, 1758) 90 39 3.5 2 1.5
Cottidae Triglops murrayi Günther, 1888 5 20 2 20 1
Gadidae Eleginus nawaga (Walbaum, 1792) 44 14 2 – –
Gadidae Gadus morhua Linnaeus, 1758 127 31 4.5 – –
Pleuronectidae Limanda limanda (Linnaeus, 1758) 114 10 1.5 1 1
Pleuronectidae Liopsetta glacialis (Pallas, 1776) 27 – – – –
Pleuronectidae Platichthys flesus (Linnaeus, 1758) 77 3 3 – –
Osmeridae Osmerus mordax dentex Steindachner & Kner, 1870 20 – – – –
Salmonidae Coregonus lavaretus (Linnaeus, 1758) 4 – – – –
Salmonidae Oncorhynchus gorbuscha (Walbaum, 1792) 3 67 7 – –
Zoarcidae Zoarces viviparus (Linnaeus, 1758) 2 – – – –
Bolshoy Solovetsky Island Cottidae M. scorpius 2 50 2 50 5
Velikaya Salma Strait Clupeidae C. pallasii marisalbi 1 100 1 – –
Cottidae M. scorpius 4 25 1 25 1
Gadidae E. nawaga 5 – – – –
Gadidae G. morhua 9 33 1.3 – –
Pleuronectidae L. limanda 4 25 5 – –
Barents Sea Dalniye Zelentsy Gadidae G. morhua 11 18 2.5 – –
Cottidae G. tricuspis 2 100 1 – –
Cottidae M. scorpius 3 100 12.3 – –
Pleuronectidae P. flesus 1 100 1 – –
Open in a new tab

Morphological analysis

Rediae and maritae were fixed in 96% ethanol for whole mounts. All specimens of maritae were heat-killed before fixation, except 1 from B. scalariforme. Rediae and maritae were stained with acetocarmine (Sigma Aldrich, Germany) followed by destaining in 0.1 m HCl in 70% ethanol, dehydrated in a graded alcohol series, clarified in xylol, and mounted in Canada balsam. Temporary mounts of cercariae, live and fixed in 2.5% glutaraldehyde in sea water, were used to study their gross morphology. Whole mounts were observed under microscopes Leica DM 500 or DM 2500 (Leica Microsystems, Germany); photos and videos were taken either in bright field, or with phase-contrast microscopy, or with differential interference contrast (DIC) using Nikon DS Fi1, or Sony Alpha 7RII, or smartphone camera. Measurements were made using Fiji software (Schindelin et al., 2012). Measurements of cercarial body were taken prior to its retraction into the caudal cyst. The delivery tube was measured in live specimens when everted under the cover glass pressure. All measurements are in micrometres.

For scanning electron microscopy (SEM), 2.5% glutaraldehyde-fixed cercariae were rinsed in water, dehydrated in ethanol and acetone, dried in a critical point dryer, coated with platinum, and examined with a Quanta 250 at 15 kV. Visualization of cercarial inner structure was also performed by means of confocal laser scanning microscopy (CLSM). Specimens were fixed in 4% paraformaldehyde in 0.01 m phosphate-buffered saline and stained with tetramethylrhodamine B isothiocyanate (TRITC)-labelled phalloidin and DAPI. The protocol was the same as previously described (Kremnev et al., 2020).

Molecular analysis

Ethanol-fixed rediae and maritae were used for molecular studies. To extract DNA, we took 1 redia or fragment of marita (preoral lobe and anterior part of the oral sucker); 32 isolates used for molecular analysis are listed in Table 2. Samples were taken from 96% ethanol and dried completely, incubated in 200 μL of 5% solution of Chelex® 100 resin (Bio-Rad, USA) with 0.2 mg mL−1 of proteinase K (Evrogen, Russia) at 56°C for 4 h, then kept for 8 min at 90°C and centrifuged for 10 min at 16,000 g. The supernatant containing DNA was transferred to a new tube and stored at −20°C.

Table 2.

Isolates, their origin and GenBank accession numbers for sequences

ID Species Stage Host species Locality GenBank accession numbers
28S rDNA 5.8S rDNA + ITS2 18S rDNA cox1
D5.1 Derogenes varicus Marita Limanda limanda Keret Archipelago (White Sea) OM761962 OM762002 – OM807173
D5.2 Derogenes varicus Marita Gadus morhua Keret Archipelago (White Sea) OM761963 OM762003 OM761994 OM807174
D5.3 Derogenes varicus Marita Myoxocephalus scorpius Keret Archipelago (White Sea) OM761964 OM762004 – OM807175
D5.4 Derogenes varicus Marita Anarhichas lupus Keret Archipelago (White Sea) OM761965 OM762005 – OM807176
D7.1 Derogenes varicus Marita Limanda limanda Keret Archipelago (White Sea) OM761966 OM762006 – OM807177
D7.2 Derogenes varicus Marita Eleginus nawaga Keret Archipelago (White Sea) OM761967 OM762007 – OM807178
D7.3 Derogenes varicus Marita Limanda limanda Keret Archipelago (White Sea) OM761968 OM762008 – OM807179
D7.5 Derogenes varicus Marita Clupea pallasii marisalbi Keret Archipelago (White Sea) OM761969 OM762009 OM761995 OM807180
D7.6 Derogenes varicus Marita Clupea pallasii marisalbi Keret Archipelago (White Sea) OM761970 OM762010 – OM807181
D12.3 Derogenes varicus Marita Gadus morhua Dalniye Zelentsy (Barents Sea) OM761971 OM762011 – OM807182
D12.4 Derogenes varicus Marita Myoxocephalus scorpius Dalniye Zelentsy (Barents Sea) OM761972 OM762012 – OM807183
D12.5 Derogenes varicus Marita Myoxocephalus scorpius Dalniye Zelentsy (Barents Sea) OM761973 OM762013 – OM807184
D14.2 Derogenes varicus Marita Gadus morhua Velikaya Salma Strait (White Sea) OM761974 OM762014 – –
D14.3 Derogenes varicus Marita Gadus morhua Velikaya Salma Strait (White Sea) OM761975 OM762015 – –
D16.2 Derogenes varicus Marita Triglops murrayi Keret Archipelago (White Sea) OM761976 OM762016 – –
A17.20 Derogenes varicus Marita Buccinum scalariforme Keret Archipelago (White Sea) OM761977 OM762017 – –
D4.10 Progonus muelleri Marita Myoxocephalus scorpius Bolshoy Solovetsky Island (White Sea) OM761978 OM762018 OM761996 OM807185
D4.11 Progonus muelleri Marita Myoxocephalus scorpius Keret Archipelago (White Sea) OM761979 OM762019 OM761997 OM807186
D4.12 Progonus muelleri Marita Myoxocephalus scorpius Keret Archipelago (White Sea) OM761980 OM762020 – OM807187
D14.1 Progonus muelleri Marita Myoxocephalus scorpius Velikaya Salma Strait (White Sea) OM761981 OM762021 – –
D16.1 Progonus muelleri Marita Limanda limanda Keret Archipelago (White Sea) OM761982 OM762022 – –
D16.3 Progonus muelleri Marita Triglops murrayi Keret Archipelago (White Sea) OM761983 OM762023 OM761998 –
D4.2 Cercaria appendiculata Rediae and cercariae Cryptonatica affinis Keret Archipelago (White Sea) OM761984 OM762024 – OM807188
D4.3 Cercaria appendiculata Rediae and cercariae Cryptonatica affinis Keret Archipelago (White Sea) OM761985 OM762025 – OM807189
D4.4 Cercaria appendiculata Rediae and cercariae Cryptonatica affinis Keret Archipelago (White Sea) OM761986 OM762026 – OM807190
D12.2 Cercaria appendiculata Rediae and cercariae Cryptonatica affinis Dalniye Zelentsy (Barents Sea) OM761987 OM762027 – OM807191
D12.6 Cercaria appendiculata Rediae and cercariae Cryptonatica affinis Dalniye Zelentsy (Barents Sea) OM761988 OM762028 – OM807192
D4.1 Derogenidae gen. sp. Rediae and cercariae Amauropsis islandica Keret Archipelago (White Sea) OM761989 OM762029 – OM807193
D11.4 Derogenidae gen. sp. Rediae and cercariae Euspira pallida Keret Archipelago (White Sea) OM761990 OM762030 OM761999 OM807194
D12.1 Derogenidae gen.sp. Rediae and cercariae Euspira pallida Dalniye Zelentsy (Barents Sea) OM761991 OM762031 OM762000 OM807195
D14.4 Cercaria octocauda Rediae and cercariae Cryptonatica affinis Velikaya Salma Strait (White Sea) OM761992 OM762032 OM762001 OM807196
D14.5 Cercaria octocauda Rediae and cercariae Cryptonatica affinis Velikaya Salma Strait (White Sea) OM761993 OM762033 – OM807197
Open in a new tab

We amplified a fragment of the 28S rDNA (domains D1–D3), a fragment containing 5.8S rDNA and ITS2, a fragment of 18S rDNA, and a fragment of the cytochrome oxidase I gene (cox1) with primers and conditions listed in Table 3. The 20 μL reaction mixture contained 4 μL of ScreenMix-HS (Evrogen), 0.5 μL of each primer (10 pmol μL−1), 2 μL of the DNA and 13 μL of PCR grade water (Evrogen). Polymerase chain reactions (PCRs) were run on a Veriti thermal cycler (Applied Biosystems, MA, USA). PCR products were stained with ethidium bromide and visualized through electrophoresis on a 1% agarose gel. Sequencing was performed with PCR primers on an ABI Prism 3500xl genetic analyser (Applied Biosystems, MA, USA). Chromatograms were analysed and edited, and alignments were built in Geneious Prime 2022.0.1 (https://www.geneious.com). Relevant data for alignments were obtained from GenBank (Supplementary Table 1). To annotate 28S and 5.8S + ITS2 regions, we used the sequence of Didymocystis scomberomori (KU341979; Schrandt et al., 2016) as a reference. Pairwise genetic distances between species (as the number of base differences per site) were calculated in MEGA 7 (Kumar et al., 2016). The maximum likelihood (ML) analysis was conducted at the CIPRES Science Gateway (https://www.phylo.org) using RAxML (Stamatakis, 2014) with 1000 bootstrap iterations. The model of nucleotide substitution was estimated as GTR + I for the 28S dataset, TIM2 + G for the 18S dataset, TVM + I for the 5.8S + ITS2 dataset and TIM3 + I + G for the cox1 dataset using JModelTest (Darriba et al., 2012) at the CIPRES Science Gateway. A haplotype network for fragments of cox1 was constructed in PopART 1.7 (Leigh and Bryant, 2015) by integer neighbour-joining network (reticulation tolerance 0.5).

Table 3.

PCR primers and thermocycling conditions; in all reactions initial denaturation was at 95°C for 5 min and final extension was at 72°C for 10 min

Product Primer Sequence (5′–3′), forward (F) and reverse (R) Thermocycling profile Reference
18S rDNA 18S1A F, GGCGATCGAAAAGATTAAGCCATGCA 94°C – 1 m
52°C – 1 m
72°C – 1 m
 × 35		 Hernández-Mena et al. (2017) (primers and conditions)
32 R, CGAAGTCCTATTCCATTATTC
28S rDNA digl2 F, AAGCATATCACTAAGCGG 95°C – 30s
54°C – 30s
72°C – 2 m
 × 40		 Tkach et al. (1999) (primers and conditions)
1500R R, GCTATCCTGAGGGAAACTTCG Olson et al. (2003) (primers and conditions)
5.8S rDNA + ITS2 3S F, GTACCGGTGGATCACGTGGCTAGTG 94°C – 30s
55°C – 30s
72°C – 1 m
 × 30		 Morgan and Blair (1995) (primers)
ITS2.2 R, CCTGGTTAGTTTCTTTTCCTCCGC
cox1 JB3 F, TTTTTTGGGCATCCTGAGGTTTAT 95°C – 30s
48°C – 40s
72°C – 1 m
 × 40		 Leung et al. (2009) (primers and conditions)
trem.cox1.rrnl R, AATCATGATGCAAAAGGTA
cox1 JB3 F, TTTTTTGGGCATCCTGAGGTTTAT 95°C – 30s
45°C – 30s
72°C – 1 m
 × 35		 Urabe et al. (2012) (primers and conditions)
COI R-Trema R, CAACAAATCATGATGCAAAAGG
Open in a new tab

Results

At the White Sea, we obtained maritae morphologically identified as Progonus muelleri from Myoxocephalus scorpius, Limanda limanda and Triglops murrayi. The maritae identified as Derogenes varicus were found in 10 fish species from the White Sea and 3 fish species from the Barents Sea (Table 1). A marita found in the stomach of the whelk Buccinum scalariforme was also identified as D. varicus.

Cystophorous cercariae of 4 types were found parasitizing moonsnails. Cercaria saccocaudata = Lecithaster salmonis (family Lecithasteridae) recovered from Cryptonatica affinis is not considered further here. Cercaria appendiculata was found in C. affinis both at the White Sea and Barents Sea. Cercaria octocauda was found in C. affinis from 1 locality at the White Sea (Velikaya Salma Strait). Finally, rediae with cystophorous cercariae of Derogenidae gen. sp. (according to Køie, 1995, 2000), similar to but much larger than C. appendiculata, were found in Euspira pallida (White and Barents Seas) and Amauropsis islandica (White Sea).

Molecular analysis and linking life-cycle stages

For molecular genetic analysis 32 newly recovered specimens were used: 22 maritae and 10 intramolluscan stages – rediae with cercariae (Table 2). We obtained 1130–1139 bp sequences of the 28S rDNA fragment (domains D1–D3). The following sequences of the representatives of the Derogeninae from GenBank were also used in the analysis: D. varicus AY222189 (Olson et al., 2003) and MW504598–9 (Sokolov et al., 2021); D. lacustris LC586089–90 (Tsuchida et al., 2021); P. muelleri MW507469–71 (Sokolov et al., 2021). Prosogonotrema bilabiatum (AY222191; Olson et al., 2003) served as an outgroup. The alignment was 1052 bp long after trimming the ends to match the shortest sequence. The ML tree was built to visualize the results. Our specimens formed 4 distinct groups (Fig. 1, Supplementary Table 2). The first group included all our D. varicus specimens from fish and all rediae of C. appendiculata from Cryptonatica affinis, with no nucleotide substitutions. The second group comprised the marita of D. varicus from the whelk B. scalariforme and derogenid rediae from Euspira pallida and Amauropis islandica; these sequences were identical to one of the D. varicus sequences from GenBank (AY222189) from the North Sea. These 2 groups are later referred to as DV1 and DV2. Divergence between them was 0.0068 ± 0.0053 (17 substitutions). The sequences of D. varicus from the Pacific (MW504598–9) differed from DV1 in 14 and from DV2 in 11 substitutions; they are labelled in Fig. 1 as DV3. The other 2 closely related groups comprised maritae of P. muelleri and rediae of C. octocauda; a single variation was in position 501: 3 maritae and 2 C. octocauda rediae (T) differed from 3 other maritae (C) (distance = 0.0004 ± 0.0009). These 2 groups of specimens are later referred to as PM1 and PM2, respectively. Previously published sequences of P. muelleri from the Pacific and the White Sea (MW507469–71) fell into the PM1 group. Two sequences of D. lacustris formed a separate group with intraspecific pairwise distance 0.0005 ± 0.0008 (Fig. 1, Supplementary Table 2).

Fig. 1.

Fig. 1.

Open in a new tab

ML phylogenetic tree based on the 28S rDNA sequence data. Bootstrap values are printed in nodes. Scale bar shows the substitution rate. DV1–3 and PM1–2 mark the separate genetic lineages within Derogenes varicus and Progonus muelleri species, respectively. Abbreviations: AI – Amauropsis islandica; AL – Anarhichas lupus; BS – Buccinum scalariforme; CA – Cryptonatica affinis; CS – Caprella septentrionalis; CP – Clupea pallasii marisalbi; EF – Eumicrotremus fedorovi; EN – Eleginus nawaga; EP – Euspira pallida; GM – Gadus morhua; HP – Hippoglossoides platessoides; LL – Limanda limanda; MS – Myoxocephalus scorpius; TM – Triglops murrayi.

We also analysed 525–593 bp fragments including partial 5.8S rDNA (110–150 bp), complete ITS2 and the beginning of 28S (31–74 bp). Accacladocoelium macrocotyle (KF687303; Ahuir-Baraja et al., 2015) was taken as an outgroup. After trimming the ends, the alignment was 531 bp long, including gaps. In the obtained ML tree our specimens grouped exactly the same way as in the 28S rDNA analysis (Fig. 2). Intragroup variation was absent. Divergence between the groups DV1 and DV2 was 0.0374 ± 0.0101 (18 substitutions and 4 indels) (Supplementary Table 3). The groups PM1 and PM2 differed in a single position (260, A/G) (divergence = 0.0021 ± 0.0019).

Fig. 2.

Fig. 2.

Open in a new tab

ML phylogenetic tree based on the ITS2 rDNA sequence data. Bootstrap values are printed in nodes. Scale bar shows the substitution rate. DV1–2 and PM1–2 mark the separate genetic lineages within Derogenes varicus and Progonus muelleri species, respectively. Abbreviations: AI – Amauropsis islandica; AL – Anarhichas lupus; BS – Buccinum scalariforme; CA – Cryptonatica affinis; CP – Clupea pallasii marisalbi; EN – Eleginus nawaga; EP – Euspira pallida; GM – Gadus morhua; LL – Limanda limanda; MS – Myoxocephalus scorpius; TM – Triglops murrayi.

A fragment of 18S rDNA 775–778 bp long was sequenced for 8 of our specimens, 2 from each of the groups DV1, DV2, PM1 and PM2 (Table 2). The closest BLAST hit was D. varicus (AJ287511; Littlewood and Olson, 2001), which was also included in the analysis. Prosogonotrema bilabiatum (AJ287565; Littlewood and Olson, 2001) served as an outgroup. After trimming the ends, the alignment was 779 bp long, including gaps. Our specimens grouped the same way as in 28S and 5.8S + ITS2 analyses (Fig. 3, Supplementary Table 4). PM1 and PM2 differed from each other in 1 position (599, C/T; distance = 0.0013 ± 0.0012). The difference between DV1 and DV2 was in 11 positions (distance = 0.0143 ± 0.005). Derogenes varicus from GenBank (AJ287511; Cribb et al., 2001) was closest to DV2, though with 1 substitution and 1 indel (distance = 0.0013 ± 0.0011); this sequence is labelled DV4 on the 18S tree (Fig. 3). We also compared the alignment with another sequence of D. varicus from GenBank – AF029816 (Blair et al., 1998). It overlapped our alignment by a rather short fragment (213 bp) and was thus not included in the ML analysis. This fragment was identical in AF29816 and our sequences of DV1, and differed from DV2 and DV4 in 9 positions.

Fig. 3.

Fig. 3.

Open in a new tab

ML phylogenetic tree based on the 18S rDNA sequence data. Bootstrap values are printed in nodes. Scale bar shows the substitution rate. DV1–2, 4 and PM1–2 mark the separate genetic lineages within Derogenes varicus and Progonus muelleri species, respectively. Abbreviations: CA – Cryptonatica affinis; CP – Clupea pallasii marisalbi; EP – Euspira pallida; GM – Gadus morhua; HP – Hippoglossoides platessoides; MS – Myoxocephalus scorpius; TM – Triglops murrayi.

Fragments of cox1 gene were sequenced for 25 specimens (Table 2). After trimming, the alignment was 788 bp long. Didymocystis wedli (AB725624) served as an outgroup. In the obtained ML tree, our specimens grouped the same way as in the rDNA analyses (Fig. 4). Minimal intergroup pairwise distance was between PM1 and PM2 (0.0905 ± 0.041, 61 positions), and maximal intragroup pairwise distance was in DV1 (0.0155 ± 0.0082, 12 positions) (Supplementary Table 5). In DV1 34 polymorphic sites were present; all haplotypes were unique; overall mean distance was 0.0076 ± 0.0014. We built a haplotype network for DV1, because rediae of this species from the White and Barents Seas clearly differed by size (see below), and thus could represent different lineages. However, geographic origin of isolates was not associated with the position of DV1 samples on the haplotype network (Fig. 5). DV2 had 1 polymorphic site with a synonymous substitution. One variable position was also present within PM1.

Fig. 4.

Fig. 4.

Open in a new tab

ML phylogenetic tree based on partial cox1 gene sequences. Bootstrap values are printed in nodes. Scale bar shows the substitution rate. DV1–2 and PM1–2 mark the separate genetic lineages within Derogenes varicus and Progonus muelleri species, respectively. Branches within the DV1 clade are collapsed. Abbreviations: AI – Amauropsis islandica; AL – Anarhichas lupus; CA – Cryptonatica affinis; CP – Clupea pallasii marisalbi; EN – Eleginus nawaga; EP – Euspira pallida; GM – Gadus morhua; LL – Limanda limanda; MS – Myoxocephalus scorpius.

Fig. 5.

Fig. 5.

Open in a new tab

Haplotype network for DV1 isolates based on partial cox1 gene sequences. Circle size represents the haplotype frequency. Black dots illustrate missing haplotypes. Number of hatch marks corresponds to the number of substitutions between haplotypes.

Descriptions

All the obtained maritae were identified either as Derogenes varicus or as Progonus muelleri, based on their morphological characteristics. Measurements are given in Table 4. Considering the genetic heterogeneity between all the specimens of D. varicus from fish and the one from Buccinum scalariforme, and between maritae of P. muelleri, the measurements are shown separately – referred to as DV1 and DV2, PM1 and PM2, respectively. Hologenophores for all maritae isolates and 5 paragenophores of DV1 maritae were deposited in the collection of the Department of Invertebrate Zoology of Saint Petersburg University.

Table 4.

Measurements of Derogenes varicus (DV1 and DV2) and Progonus muelleri (PM1 and PM2) maritae

DV1 (based on 15 hologenophores and 5 paragenophores)1 DV2 (based on 1 hologenophore)1 PM1 (based on 3 hologenophores) PM2 (based on 2 hologenophores)
Body length 1291 (873–1885) 1161 1211 (745–1827) 1389 (1351–1427)
Body maximum width 371 (257–498) 469 326 (242–471) 378 (359–397)
Forebody 527 (349–786) 473 564 (300–828) 562 (548–575)
FO/BL 41 (35–47) % 41 % 45 (40–48) % 40 (40–41) %
Post-caecal region 104 (41–165) 37 158 (115–206) 234 (206–262)
PC/BL 8 (5–11) % 3 % 14 (11–20) % 17 (14–19) %
Preoral lobe length 28 (20–40)
(based on 4 paragenophores)		 – Not prominent Not prominent
Oral sucker 152 (89–214) × 167 (117–224) 188 × 217 – 125 (104–145) × 133 (115–151)
Ventral sucker 304 (224–426) × 313 (219–437) 352 × 354 275 (174–351) × 248 (176–362) 314 (291–337) × 313 (294–332)
Sucker-length ratio 2.07 (1.58 –2.88) 1.87 – 2.56 (2.32–2.80)
Sucker-width ratio 1.93 (1.52–2.43) 1.63 – 2.38 (2.20–2.56)
Pharynx 65 (41–87) × 77 (52–104) 81 × 87 60 (55–64) × 64 (62–65) 66 (60–72) × 76 (73–79)
Sinus sac 84 (64–112) × 87 (60–106) 98 × 85 68 (48–91) × 78 (48–109) 66 (65–67) × 83 (77–89)
Pars prostatica length 230 (176–337) 132 125 (65–184) 130 (116–144)
Seminal vesicle 75 (39–225) × 46 (23–81) 93 × 52 90 (53–148) × 49 (28–62) 142 (111–173) × 71 (65–76)
Left testis 105 (70–157) × 105 (62–144) 142 × 88 82 (66–110) × 83 (67–113) 145 (125–164) × 125 (115–134)
Right testis 105 (75–142) × 102 (61–160) 158 × 77 105 (79–147) × 84 (71–107) 154 (140–167) × 131 (120–142)
Ovary 103 (77–153) × 109 (69–158) 146 × 127 143 (114–186) × 124 (92–177) 121 (111–131) × 116 (112–120)
Left vitelline mass 152 (109–203) × 116 (63–201) 173 × 121 146 (103–203) × 113 (76–173) 132 (124–139) × 95 (92–98)
Right vitelline mass 144 (97–211) × 114 (69–173) 167 × 117 153 (113–206) × 99 (76–118) 134 (131–137) × 100 (99–101)
Left vitelline mass position Anterior, symmetrical, posterior Anterior Anterior Anterior, symmetrical
Eggs 51 (44–60) × 31 (25–37) 60 (57–63) × 35 (32–38) 52 (44–63) × 27 (23–31) 47 (43–54) × 26 (23–29)
Open in a new tab

FO/BL, forebody to body length ratio; PC/BL, postcaecal region to body length ratio.

1

Body length and oral sucker were measured from some of hologenophores before taking a piece for DNA extraction.

The descriptions of 3 types of intramolluscan stages were made de novo. Measurements from this and previous studies are summarized in Tables 5 and 6.

Table 5.

Measurements of C. appendiculata (DV1) and Derogenidae gen. sp. (DV2) cercariae compared with previous descriptions

C. appendiculata (DV1) Derogenidae gen. sp. (DV2)
This study (based on 11 live and 30 fixed specimens) Køie (1979) Chubrik (1966) Timofeeva (1976) This study (based on 18 live and 9 fixed specimens) Køie (1990b)
Caudal cyst Ø1 94 (85–103) 100–110 60–120 80–120 195 (170–211) 180–200
Caudal cyst Ø2 91 (81–100) – 50–90 – 155 (138–169) 150
Caudal cyst thick 61 (57–65) – – – 102 (90–123) –
Motile appendage length 145 (109–178) 140–200 90–170 140–210 600 (529–688) 500–600
Motile appendage Ø1 18 (16–21) 20 20 20 36 (30–41) –
Motile appendage Ø2 8 (7–10) 8 4 10 17 (14–21) –
Furca length 58 (53–66) 40–60 20–60 40–60 72 (62–85) 80
Delivery tube length 409 (306–456) 500–600 – 300–400 446 (430–471) 500
Delivery tube width (middle) 15 (12–20) –1 – 10 – –
Delivery tube width (base) – – – – 35 (30–44) 30
Delivery tube maximum width – – – – 79 (71–94) 100
Body length 170 (124–249) 210 150–190 160–210 238 (187–283) 230
Body maximum width 47 (39–56) 55 30–50 30–50 77 (59–109) 80
Oral sucker 27 (25–31) × 27 (25–30) 26 × 34 20 26–28 32 (26–37) × 38 (32–47) 40
Ventral sucker 28 (24–31) × 30 (27–33) 30 × 35 20–30 29–32 39 (37–45) × 42 (35–53) 40
Pharynx 13 (12–16) × 16 (14–17) 14 8–10 10 × 14 17 (14–21) × 22 (19–24) 15
Open in a new tab
1

Only narrow distal part width is mentioned – 10 μm.

Table 6.

Measurements of Cercaria octocauda (PM1) cercariae compared with previous descriptions

This study (based on 24 live and 11 fixed specimens) Chubrik (1966) Timofeeva (1976)
Caudal cyst length 311 (277–365) 210–280 210–310
Caudal cyst width 81 (67–99) 40–60 40–60
Fin length 122 (100–145) – –
Fin maximum width 77 (67–92) – –
Motile appendage length 213 (173–254) 120–210 150–210
Motile appendage Ø 17 (14–21) – –
Immotile threads length 631 (547–734) 360–430 320–510
Delivery tube length 1155 (1045–1272) – 600–650
Delivery tube width (middle) 27 (25–30) – 20–30
Delivery tube width (end) 39 (36–41) – –
Body length 282 (205–373) 110–300 140–240
Body maximum width 57 (32–84) 20–50 40–60
Oral sucker 29 (23–36) × 33 (21–44) 20–30 21 × 31
Ventral sucker 33 (23–38) × 33 (22–41) 20–30 36
Pharynx 15 (13–18) × 17 (13–22) 10 –
Open in a new tab

Cercaria appendiculata Pelseneer, 1906 (DV1) (Fig. 6)

Fig. 6.

Fig. 6.

Open in a new tab

Cercaria appendiculata (DV1). Schemes of pre-infective (A), infective (B) cercariae, and caudal cyst with everted delivery tube (C). (D, E) CLSM, TRITC-phalloidin staining; muscular, digestive and excretory systems in pre-infective (D) and infective (E) cercaria. (F) SEM, infective cercaria, lateral view. (G) Bright field, caudal cyst with everted delivery tube. Scale bars – 50 μm. Abbreviations: ap – aperture; c – caecum; cb – cercarial body; cc – caudal cyst; dt – delivery tube; dte – delivery tube extension; oe – oesophagus; ep – excretory pore; ev – excretory vesicle; fc – flame cell; fu – furca; ic – inner cyst layer; la – locomotory appendage; mo – membranous outgrowth; oc – outer cyst layer; os – oral sucker; ph – pharynx; rm – retractor muscles; sph – sphincter; vs – ventral sucker.

Host: Cryptonatica affinis

Localities: White Sea, Keret Archipelago; Barents Sea, Dalniye Zelentsy.

Sites: Reproductive gland and ducts, partially digestive gland, hypobranchial gland.

Prevalence: 5.2% (14 of 270) at Keret Archipelago, White Sea; 5.8% (6 of 104) at Dalniye Zelentsy, Barents Sea.

Rediae measurements based on 29 ethanol-fixed specimens: 16 from White Sea and 13 from Barents Sea. As rediae from White and Barents Seas differed clearly by size, their measurements are given separately (marked WS and BS). WS rediae elongated, 1848 (608–3411) × 174 (141–221). Pharynx small, 47 (28–32) × 34 (25–30). Caecum 548 (318–939) × 50 (27–73). Birth pore close to mouth opening. BS rediae very long, 4024 (3479–5006) × 154 (123–253). Pharynx small, 42 (37–51) × 30 (25–34). Caecum 929 (566–1536) × 30 (20–40). Birth pore close to mouth opening.

Cercariae measurements based on 12 live and 30 glutaraldehyde-fixed specimens: 29 from the White Sea and 13 from the Barents Sea. Cercariae of cystophorous type, tail consisting of caudal cyst, delivery tube and locomotory appendage. Body 170 (124–249) long, 47 (39–56) wide. Oral sucker 27 (25–31) × 27 (25–30), ventral sucker 28 (24–31) × 30 (27–33) and pharynx 13 (12–16) × 16 (14–17). Intestinal caeca reaching slightly behind the ventral sucker. Excretory vesicle Y-shaped, with widened proximal part; excretory ducts unite dorsally near pharynx. Eight flame cells present within the body. Four more flame cells form compact group within caudal cyst close to its aperture. Muscular sphincter present at cyst aperture; retractor muscles connect body hind end with cyst wall.

In infective cercariae, body and delivery tube pulled into caudal cyst, aperture closed. Body lies with anterior end near folded delivery tube. Caudal cyst roundish, 94 (85–103) × 91 (81–100) in diameter, 61 (57–65) thick, 2-layered, space between layers narrow. One side with depression, and furcate locomotory appendage attached at its bottom; outer layer forms membranous outgrowth. Locomotory appendage 145 (109–178) long, 18 (16–21) × 8 (7–10) in diameter, furca 58 (53–66) long. Everted delivery tube 409 (306–456) long, 15 (12–20) wide in middle region, narrower in distal part, wider at tip; roundish extension present in proximal region.

Derogenidae gen. sp. (DV2) (Fig. 7)

Fig. 7.

Fig. 7.

Open in a new tab

Derogenidae gen. sp. (DV2). Schemes of pre-infective (A), infective (B) cercaria and caudal cyst with everted delivery tube (C). (D) Bright field, live pre-infective cercaria, general view. (E, F) Pre-infective cercariae, CLSM, TRITC-phalloidin staining; muscular, digestive and excretory systems. (G) Bright field, caudal cyst with everted delivery tube. (H, I) SEM, infective cercaria. Scale bars – 50 μm. Abbreviations: ap – aperture; c – caecum; cb – cercarial body; cc – caudal cyst; dt – delivery tube; oe – oesophagus; ev – excretory vesicle; fc – flame cell; fu – furca; ic – inner cyst layer; la – locomotory appendage; oc – outer cyst layer; os – oral sucker; ph – pharynx; rm – retractor muscles; sph – sphincter; vs – ventral sucker.

Hosts: Euspira pallida, Amauropsis islandica

Localities: White Sea, Keret Archipelago; Barents Sea, Dalniye Zelentsy.

Sites: Reproductive gland and ducts, partially digestive gland.

Prevalence: 4.2% (1 of 24) E. pallida, 33.4% (1 of 3) A. islandica at Keret Archipelago, White Sea; 12.5% (1 of 8) E. pallida at Dalniye Zelentsy, Barents Sea.

Rediae measurements based on 22 ethanol-fixed specimens: 6 from Barents Sea and 16 from White Sea. Rediae elongated, 2265 (1313–3961) × 219 (145–308). Pharynx small, 55 (42–68) × 42 (31–51). Caecum 1063 (805–1366) × 45 (33–56). Birth pore close to mouth opening.

Cercariae measurements based on 18 live and 9 glutaraldehyde-fixed specimens: 25 from the White Sea and 2 from the Barents Sea. Cercariae of cystophorous type, tail consisting of caudal cyst, delivery tube and locomotory appendage. Body 238 (187–283) long, 77 (59–109) wide. Oral sucker 32 (26–37) × 38 (32–47), ventral sucker 39 (37–45) × 42 (35–53), pharynx 17 (14–21) × 22 (19–24). Intestinal caeca almost reaching posterior body end. Excretory vesicle Y-shaped, with widened proximal part; excretory ducts uniting dorsally near pharynx. Eight flame cells within body, 4 more lying loosely within caudal cyst close to the aperture. Muscular sphincter at cyst aperture; retractor muscles connecting body hind end with the cyst wall.

In infective cercariae, body and delivery tube inside caudal cyst, aperture closed, anterior body end close to tightly packed delivery tube. Caudal cyst oval, 195 (170–211) × 155 (138–169) in diameter, 102 (90–123) thick, 2 layered, space between layers broad. Locomotory appendage 600 (529–688) long, 36 (30–41) × 17 (14–21) in diameter, attached at depression on caudal cyst side; furca 72 (62–85) long. Everted delivery tube 446 (430–471) long, 35 (30–44) wide at base, proximal part inflated, maximal width 79 (71–94).

Cercaria octocauda Tschubrik, 1952 (PM1) (Fig. 8)

Fig. 8.

Fig. 8.

Open in a new tab

Cercaria octocauda (PM1). Schemes of pre-infective (A), infective (B) cercaria and caudal cyst with everted delivery tube (C). (D) Bright field, live pre-infective cercaria, general view. (E, F) CLSM, TRITC-phalloidin staining; muscular, digestive and excretory systems in pre-infective cercaria (E) and in caudal cyst (F). (G) SEM, infective cercaria. (H) Phase-contrast microscopy, cercaria leaving caudal cyst through delivery tube; arrowheads indicate tip of delivery tube. Scale bars – 50 μm. Abbreviations: ap – aperture; c – caecum; cb – cercarial body; cc – caudal cyst; dt – delivery tube; oe – oesophagus; ev – excretory vesicle; fc – flame cell; fi – arrow-shaped fin; ic – inner cyst layer; it – immotile threads; la – locomotory appendage; oc – outer cyst layer; os – oral sucker; ph – pharynx; rm – retractor muscles; sph – sphincter; vs – ventral sucker.

Host: Cryptonatica affinis

Locality: White Sea, Velikaya Salma Strait.

Sites: Reproductive gland and ducts, partially digestive gland.

Prevalence: 26.7% (4 of 15)

Rediae measurements based on 14 ethanol-fixed specimens. Rediae elongated, 1897 (1018–2906) × 182 (138–228). Pharynx small, 43 (36–48) × 33 (29–38). Caecum 422 (309–512) × 27 (20–32). Birth pore close to mouth opening.

Cercariae measurements based on 24 live and 11 glutaraldehyde-fixed specimens. Cercariae of cystophorous type, tail consisting of caudal cyst, delivery tube and locomotory appendage. Body 282 (205–373) long, 57 (32–84) wide. Oral sucker 29 (23–36) × 33 (21–44), ventral sucker 33 (23–38) × 33 (22–41), pharynx 15 (13–18) × 17 (13–22). Intestinal caeca reaching middle of ventral sucker. Excretory vesicle Y-shaped, with widened proximal part; excretory ducts uniting dorsally near pharynx. Eight flame cells within body, 4 more lying within caudal cyst close to aperture, opposite to locomotory appendage attachment spot. Muscular sphincter at cyst aperture; retractor muscles connecting body hind end with anterior part of cyst wall.

Caudal cyst 311 (277–365) long, rounded in cross section, maximal diameter 81 (67–99), anterior end spherical, opposite end pointed. Cyst 2-layered, space between layers broad; outer layer forming arrow-shaped fin at pointed end, 122 (100–145) long, 77 (67–92) wide. Locomotory appendage attached near fin base, 213 (173–254) long, 17 (14–21) in diameter, with 8 immotile threads 631 (547–734) long. In infective cercariae, delivery tube and body drawn into caudal cyst through aperture at its wide end, aperture closed. Tube everting at pointed end of cyst. Delivery tube 1155 (1045–1272) long, width uniform (27 (25–30) – middle region) except wider tip – 39 (36–41).

Discussion

According to our data based on morphological identification, 2 species of the family Derogenidae, subfamily Derogeninae parasitize fishes in the White Sea: Derogenes varicus and Progonus muelleri. The former was found in a wide range of fishes (10 of 16 examined species), and the latter – predominantly in Myoxocephalus scorpius. Such results are consistent with the published data on White Sea fish parasites (Shulman and Shulman-Albova, 1953). We also recovered 1 marita of D. varicus from the stomach of the whelk Buccinum scalariforme from the White Sea. Such a non-typical host probably received the worm through feeding on an infected dead fish – a post-cyclic transmission event which had been presumed for a long time for various Hemiuroidea (Køie, 1979; Gibson and Bray, 1986) and recently proved to occur in D. lacustris (Tsuchida et al., 2022). In the Barents Sea we found only D. varicus, obviously due to the small number of fish dissected.

Previously, D. varicus and P. muelleri were recorded as the only derogenid parasites in the Barents Sea (Polyansky, 1955; Issaitschikov, 1933; Mitenev, 1993; Køie, 2009; Kuklin et al., 2012). Shulman and Shulman-Albova (1953) claimed to have found 1 more species of the genus Derogenes in the White Sea – D. crassus. The key difference between D. varicus and D. crassus is the egg size: 50–66 × 26–39 (Odhner, 1905; Manter, 1926; Lloyd, 1938) and 63–75 × 33–39 (Manter, 1934; Yamaguti, 1938), respectively. Shulman and Shulman-Albova (1953) did not provide morphometric data, and thus there is no convincing evidence that they actually found D. crassus. Worldwide, D. crassus has otherwise been recovered from warm seas (Manter, 1934; Yamaguti, 1938; McCauley, 1960; Dyer et al., 1992; Kuramochi, 2014), and this distribution also raises doubts about the presence of this species in the White Sea.

Genetically our specimens of D. varicus split into 2 groups: all the maritae from fish vs the marita from the whelk B. scalariforme. The former matched the D. varicus of Blair et al. (1998) (AF029816) from an unspecified locality in 18S rDNA sequence. The latter had the sequence of 28S rDNA fragment identical to the sequence of D. varicus from the North Sea (AY222189; Olson et al., 2003). Morphological reexamination and morphometry of our specimens identified only 1 difference between maritae from the fish and that from the whelk – average egg size was 51 × 31 and 60 × 35, respectively. However, the ranges overlapped (44–60 × 25–37 and 57–63 × 32–38, respectively), and generally complied with the egg size in the previous descriptions of D. varicus: 50–66 × 26–39 (Odhner, 1905; Manter, 1926; Lloyd, 1938). It should be also taken into account that the marita from B. scalariforme may be morphologically deviant because it was recovered from a non-typical host. Nonetheless, based on the present data and the sequences of D. varicus from GenBank, we conclude that there are 2 clearly distinct lineages of D. varicus which we marked as DV1 and DV2. Unfortunately, we have not found maritae of DV2 in fish to compare with DV1, so we cannot diagnose these groups as 2 species through maritae morphology. We may speculate that DV2 is the species that Shulman and Shulman-Albova (1953) called D. crassus, but this is yet to be proved. The 18S rDNA sequence AJ287511 of D. varicus (Littlewood and Olson, 2001) from the North Sea differed from both DV1 and DV2, and thus represents another lineage of D. varicus (labelled DV4 in Fig. 3). Finally, one more lineage is represented by 28S rDNA sequences MW504598–9 of D. varicus from the Kuril Islands, Sea of Okhotsk (Sokolov et al., 2021), labelled DV3 in Fig. 1. As DV3 and DV4 have been recognized by different markers, it cannot be ruled out that they are one and the same lineage. However, the geographic origin (Pacific vs Atlantic) may be an argument that they are not.

In the moonsnails from the White and Barents Seas we found digenean life cycle stages which matched maritae of DV1 and DV2 in the analysed rDNA fragments. Thus, DV1 utilizes Cryptonatica affinis as the first intermediate host, and its rediae and cercariae were described as Cercaria appendiculata (Chubrik, 1966; Timofeeva, 1976; Køie, 1979). The first intermediate hosts of DV2 are Euspira pallida and Amauropsis islandica, and its rediae and cercariae were described by Køie (1990b). Cercariae of DV1 and DV2 have similar furcate locomotory appendages, but clearly differ in size and shape of the caudal cyst and delivery tube. Isolates from the first intermediate hosts allowed us to analyse variability in cox1 gene for DV1 and DV2. The monophyly of these groups was supported, and the gap between intra- and intergroup variation was evident. It is curious that DV1 rediae from the White and Barents Seas differed dramatically in length, but these differences were not consistent with molecular diversity in cox1. Such phenotypic variation may arise from different environmental conditions, but currently there are not enough data to discuss it.

To sum up, DV1 and DV2 differ in several genetic markers, both rather conservative (rRNA) and variable (cox1), as well as in the first intermediate hosts and in cercaria structure. Thus, the current criteria of species delineation are accomplished (Huston et al., 2021; Bray et al., 2022) and DV1 and DV2 deserve to be recognized as 2 species.

The maritae of P. muelleri were genetically heterogeneous, too. Three substitutions were present in the analysed fragments of rDNA: 1 in 28S rDNA, 1 in ITS2 and 1 in 18S rDNA. The divergence in cox1 gene between these groups was quite high (61–62 substitutions). As genetically different lineages occurred in sympatry, a question on their conspecificity came up, so we refer to them as PM1 and PM2. However, the genetic distance between these lineages is much smaller than that between DV1 and DV2, and in 28S it is similar to the distance between 2 sequences of D. lacustris from Tsuchida et al. (2021). No morphological differences were found between maritae of P. muelleri. Cercaria octocauda from C. affinis matched 3 maritae of PM1 by all the fragments of rDNA analysed and by cox1. Unfortunately, we did not find cercariae matching PM2 to compare them with C. octocauda. Therefore, for now we lack morphological or biological evidence to recognize PM1 and PM2 as 2 species.

Redescription of ‘true’ D. varicus and P. muelleri also cannot be provided as long as there is no molecular data from the type localities and type hosts. For D. varicus these are Danish Exclusive Economic Zone and Salmo salar Linnaeus, 1758 (Müller, 1784). Type locality of P. muelleri is West Greenland Shelf, but type host is not specified, that is either Myoxocephalus scorpius or Gadus macrocephalus Tilesius, 1810 (Levinsen, 1881).

Our results for the life cycles of DV1, DV2 and PM1 comply with the previous data on the life cycles of the Hemiuroidea in general. Moonsnails serve as the first intermediate hosts for all these 3 species. This may be characteristic of the subfamily Derogeninae, but not the Derogenidae as a whole: representatives of the other subfamilies infect pulmonates and different groups of Littorinimorpha (Madhavi, 1978; Goater et al., 1990; Køie and Gibson, 1991). Metacercariae of D. varicus had been described from various planktonic copepods (Wright, 1907; Weinstein, 1972). They probably serve as the most common second intermediate hosts, at least for DV1, according to the experiments of Køie (1979). Experimental data on DV2 cercariae are ambiguous: Køie (1990b) succeeded in infecting 3 copepod species by cystophorous cercariae from E. pallida, but those copepods did not survive for more than several weeks. Metacercariae identified as D. varicus also had been found multiple times in Chaetognatha (Kulachkova, 1972; Weinstein, 1972; Øresland, 1986; Rolbiecki and Waskusz, 2005), and it is probable that they were infected by eating copepods (Dollfus, 1960; Køie, 1979). Unlike D. varicus, P. muelleri had never been recorded in the second intermediate host until recently when its metacercaria was found in a skeleton shrimp Caprella septentrionalis Krøyer, 1838 (Caprellidae, Amphipoda) from the White Sea (Sokolov et al., 2021). The 28S rDNA sequence of this metacercaria fell into the PM1 group in our analysis. Thus, all the 3 hosts of PM1 are revealed now.

The hemiuroidean cercariae are quite diverse in tail structure, though some patterns with respect to phylogeny may be derived. For example, the vast majority of the Hemiuridae with known larval stages are characterized by cercariae with an oar-shaped locomotory appendage of the tail (Køie, 1990a, 1990b, 1992, 1995; Krupenko et al., 2020). Cercariae of the Lecithasteridae are immotile and possess roundish caudal cyst (Hunninen and Cable, 1943; Køie, 1989; Køie et al., 2002; Krupenko et al., 2022). Within the family Derogenidae cercariae are not uniform (Madhavi, 1978; Køie, 1979; Goater et al., 1990; Køie and Gibson, 1991). Our data showed that cercariae noticeably differ even within the subfamily Derogeninae. Both Derogenes and Progonus have locomotory appendages, but in the former it is furcate and in the latter it has 8 immotile threads. Differences in the cystophorous cercariae structure must be strongly dependent on the second intermediate host biology. A case of Halipegus occidualis Stafford, 1905 is particularly illustrative in this respect: evolutionary switch to ostracod second intermediate hosts resulted in the modification of cercariae tail and infection mechanism (Zelmer and Esch, 1998). Close phylogenetic relationship of Derogenes and Progonus contrasts with the difference in their tail morphology, and this brings us back to their life cycles. Structure of Progonus cercariae may be interpreted as adaptive to infect C. septentrionalis which is a filter-feeder (Legeżyńska et al., 2012): threads on the locomotory appendage of cercaria let it be easily trapped in the setose antennae 2 of C. septentrionalis. Switch to skeleton shrimps also might have resulted in narrowing the definitive host range of Progonus: demersal fish are favoured, and the highest infection rates are registered for the European sculpin (Shulman and Shulman-Albova, 1953; Polyansky, 1955; our data). Thus, the life cycle of Progonus seems to be closely associated with benthic communities, rather than with the planktonic ones as in Derogenes.

Conclusion

Marine digeneans with wide geographical distribution and low specificity towards the definitive host are obvious candidates to be species complexes. Derogenes varicus was proved to be the one, and Progonus muelleri is under suspicion now. To untangle these complexes, a worldwide sampling is needed, and primarily – specimens from the type hosts and type localities. At the same time, quite a number of marine digeneans had been described based on a single or few specimens, and do not have reliable diagnostic features. For instance, it is doubtful that D. robustus Brinkmann, 1967, D. chelidonichthydis Shen, 1989, D. minoi Shen, 1990, D. magnus Wang, 1991, D. bohaiensis Qiu & Liang in Shen & Qiu, 1995 can be distinguished from D. varicus. Molecular methods are essential to check whether these species are valid, and life-cycle studies are likely to be equally valuable.

Acknowledgements

The research study was carried out using the resources and with the help of the staff of the Educational and Research Station ‘Belomorskaia’ of Saint Petersburg University (SPbU), the White Sea Biological Station (WSBS) ‘Kartesh’ of the Zoological Institute of the Russian Academy of Sciences (ZIN RAS), the N. A. Pertsov White Sea Biological Station of Lomonosov Moscow State University, and Biological Research Station of Murmansk Marine Biological Institute of RAS in Dalnie Zelentsy. We thank all our colleagues who helped with sampling, especially Professor George Slyusarev, Sergei Bagrov, Dr Mikhail Makarov and Alexander Semenov. The molecular studies were carried out in the Research Resource Center ‘Molecular and Cell Technologies’ of SPbU, the SEM studies – in the ‘Taxon’ Research Resource Center (http://www.ckp-rf.ru/ckp/3038/) (ZIN, RAS), and the CLSM studies – in the Resource Center for Microscopy and Microanalysis of SPbU. We are grateful to Dr Karin Tsuchida who provided us with relevant literature on derogenid taxonomy. We also thank 2 anonymous reviewers for their helpful comments and efforts to improve the manuscript.

Supplementary material

For supplementary material accompanying this paper visit https://doi.org/10.1017/S003118202200110X.

S003118202200110Xsup.zip (133.9KB, zip)

click here to view supplementary material

Data availability

The aligned 28S, 18S, 5.8 rDNA, ITS2 and cox1 datasets used in phylogenetic analysis are freely accessible at http://dx.doi.org/10.13140/RG.2.2.19523.27683/1.

Author's contributions

DK conceived and designed the study. DK, GK, AU, VK, OS, AGu and OK conducted data gathering. DK, GK and AGo performed molecular analyses. AM, DK and GK performed morphological analyses. DK, GK and AGo wrote the article.

Financial support

This study was supported by the Russian Science Foundation (Russia), grant no. 19-74-10029. Work at the WSBS ‘Kartesh’ was supported by a research programme of ZIN RAS (project no. 122031100260-0).

Conflicts of interest

The authors declare there are no conflicts of interest.

References

  1. Ahuir-Baraja AE, Fraija-Fernández N, Raga JA and Montero FE (2015) Molecular and morphological differentiation of two similar species of Accacoeliidae (Digenea): Accacladocoelium macrocotyle and A. nigroflavum from sunfish, Mola mola. The Journal of Parasitology 101, 231–235. [DOI] [PubMed] [Google Scholar]
  2. Blair D, Bray RA and Barker SC (1998) Molecules and morphology in phylogenetic studies of the Hemiuroidea (Digenea: Trematoda: Platyhelminthes). Molecular Phylogenetics and Evolution 9, 15–25. [DOI] [PubMed] [Google Scholar]
  3. Bray RA, Diaz PE and Cribb TH (2016) Knowledge of marine fish trematodes of Atlantic and Eastern Pacific Oceans. Systematic Parasitology 93, 223–235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bray RA, Cutmore SC and Cribb TH (2022) A paradigm for the recognition of cryptic trematode species in tropical Indo-west Pacific fishes: the problematic genus Preptetos (Trematoda: Lepocreadiidae). International Journal for Parasitology 52, 169–203. [DOI] [PubMed] [Google Scholar]
  5. Chubrik GK (1966) Fauna and ecology of trematode larvae from molluscs in the Barents and White Seas. Trudy Murmanskogo Morskogo Biologicheskogo Instituta 10, 78–166 [in Russian]. [Google Scholar]
  6. Cribb TH (2016) The biodiversity of trematodes of fishes. Systematic Parasitology 93, 219–221. [DOI] [PubMed] [Google Scholar]
  7. Cribb TH, Bray RA, Littlewood DTJ, Pichelin S and Herniou EA (2001) Relationships of the Digenea – evidence from molecules and morphology. In Littlewood DTJ and Bray RA (eds), Interrelationships of Platyhelminthes. London, UK: Taylor & Francis, pp. 186–193. [Google Scholar]
  8. Darriba D, Taboada GL, Doallo R and Posada D (2012) JModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9, 772–772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Dollfus R (1960) Distomes des chaetognathes. Bulletin de l'Institut des Pêches Maritimes du Maroc, Casablanca 4, 19–45 [in French]. [Google Scholar]
  10. Dyer WG, Williams EH and Bunkley-Williams L (1992) Homalometron dowgialloi sp. n. (Homalometridae) from Haemulon flavolineatum and additional records of digenetic trematodes of marine fishes in the West Indies. Journal of the Helminthological Society of Washington 59, 182–189. [Google Scholar]
  11. Faltýnková A, Kudlai O, Pantoja C, Yakovleva G and Lebedeva D (2022) Another plea for ‘best practice’ in molecular approaches to trematode systematics: Diplostomum sp. clade Q identified as Diplostomum baeri Dubois, 1937 in Europe. Parasitology 149, 503–518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Georgieva S, Selbach C, Faltýnková A, Soldánová M, Sures B, Skírnisson K and Kostadinova A (2013) New cryptic species of the ‘revolutum’ group of Echinostoma (Digenea: Echinostomatidae) revealed by molecular and morphological data. Parasites & Vectors 6, 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gibson DI and Bray RA (1986) The Hemiuridae (Digenea) of fishes from the Northeast. Bulletin of the British Museum (Natural History) Zoology 51, 1–125. [Google Scholar]
  14. Gilardoni C, Etchegoin J, Cribb T, Pina S, Rodrigues P, Diez ME and Cremonte F (2020) Cryptic speciation of the zoogonid digenean Diphterostomum flavum n. sp. demonstrated by morphological and molecular data. Parasite 27, 1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Goater TM, Browne CL and Esch GW (1990) On the life history and functional morphology of Halipegus occidualis (Trematoda: Hemiuridae), with emphasis on the cystophorous cercaria stage. International Journal for Parasitology 20, 923–934. [Google Scholar]
  16. Gonchar A and Galaktionov KV (2021) It is marine: distinguishing a new species of Catatropis (Digenea: Notocotylidae) from its freshwater twin. Parasitology 148, 74–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hernández-Mena DI, García-Varela M and de León GPP (2017) Filling the gaps in the classification of the Digenea Carus, 1863: systematic position of the Proterodiplostomidae Dubois, 1936 within the superfamily Diplostomoidea Poirier, 1886, inferred from nuclear and mitochondrial DNA sequences. Systematic Parasitology 94, 833–848. [DOI] [PubMed] [Google Scholar]
  18. Hunninen AV and Cable RM (1943) The life history of Lecithaster confusus Odhner (Trematoda: Hemiuridae). The Journal of Parasitology 29, 71–79. [Google Scholar]
  19. Huston DC, Cutmore SC, Miller TL, Sasal P, Smit NJ and Cribb TH (2021) Gorgocephalidae (Digenea: Lepocreadioidea) in the Indo-West Pacific: new species, life-cycle data and perspectives on species delineation over geographic range. Zoological Journal of the Linnean Society 193, 1416–1455. [Google Scholar]
  20. Issaitschikov IM (1933) Contribution to parasitic worms of some groups of vertebrates from Russian Arctic. Transactions of the Oceanographical Institute 3, 1–44 [in Russian with partial English translation]. [Google Scholar]
  21. Køie M (1979) On the morphology and life-history of Derogenes varicus (Müller, 1784) Looss, 1901 (Trematoda, Hemiuridae). Zeitschrift für Parasitenkunde 59, 67–78. [Google Scholar]
  22. Køie M (1989) On the morphology and life history of Lecithaster gibbosus (Rudolphi, 1802) Lühe, 1901 (Digenea, Hemiuroidea). Parasitology Research 75, 361–367. [Google Scholar]
  23. Køie M (1990a) On the morphology and life-history of Hemiurus luehei Odhner, 1905 (Digenea: Hemiuridae). Journal of Helminthology 64, 193–202. [DOI] [PubMed] [Google Scholar]
  24. Køie M (1990b) A new cystophorous cercaria in Lunatia pallida (Broderip & Sowerby) (Naticidae): possibly the cercaria of Hemiurus levinseni Odhner, 1905 (Digenea, Hemiuridae). Ophelia 31, 77–84. [Google Scholar]
  25. Køie M (1992) Life cycle and structure of the fish digenean Brachyphallus crenatus (Hemiuridae). The Journal of Parasitology 78, 338–343. [PubMed] [Google Scholar]
  26. Køie M (1995) The life-cycle and biology of Hemiurus communis Odhner, 1905 (Digenea, Hemiuridae). Parasite 2, 195–202. [Google Scholar]
  27. Køie M (2000) Metazoan parasites of teleost fishes from Atlantic waters off the Faroe Islands. Ophelia 52, 25–44. [Google Scholar]
  28. Køie M (2009) Boreogadus saida (Lepechin) (Gadidae): a review of its metazoan parasite fauna from Greenland, eastern Canada, Alaska and the Russian Arctic. Polar Biology 32, 1399–1406. [Google Scholar]
  29. Køie M and Gibson DI (1991) Aspects of the life-cycle of Magnibursatus caudofilamentosa (Reimer, 1971) Gibson and Køie, 1991 (Digenea, Hemiuroidea, Derogenidae). Ophelia 34, 117–127. [Google Scholar]
  30. Køie M, Karlsbakk E and Nylund A (2002) A cystophorous cercaria and metacercaria in Antalis entalis (L.) (Mollusca, Scaphopoda) in Norwegian waters, the larval stage of Lecithophyllum botryophorum (Olsson, 1868) (Digenea, Lecithasteridae). Sarsia: North Atlantic Marine Science 87, 302–311. [Google Scholar]
  31. Kremnev G, Gonchar A, Krapivin V, Knyazeva O and Krupenko D (2020) First elucidation of the life cycle in the family Brachycladiidae (Digenea), parasites of marine mammals. International Journal for Parasitology 50, 997–1009. [DOI] [PubMed] [Google Scholar]
  32. Krupenko D, Gonchar A, Kremnev G and Uryadova A (2020) On the life cycle of Hemiurus levinseni Odhner, 1905 (Digenea: Hemiuridae). Invertebrate Zoology 17, 205–218. [Google Scholar]
  33. Krupenko D, Kremnev G, Skobkina O, Gonchar A, Uryadova A and Miroliubov A (2022) Lecithaster (Lecithasteridae, Digenea) in the White Sea: an unnoticed guest from the Pacific? Journal of Helminthology 96, e43. [DOI] [PubMed] [Google Scholar]
  34. Kuklin VV, Kuklina MM and Kisova NE (2012) Species composition and seasonal dynamics of the helminthofauna of the bullroat (Myoxocephalus scorpius, Cottidae) from Kola Bay of the Barents Sea. Russian Journal of Zoology 91, 131–137 [in Russian, with English summary]. [Google Scholar]
  35. Kulachkova VG (1972) Helminths of Saggita elegans Verrill from the White Sea. Parazitologiia 16, 297–304 [in Russian, with English summary]. [PubMed] [Google Scholar]
  36. Kumar S, Stecher G and Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33, 1870–1874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kuramochi T (2014) Digenean trematodes of deep-sea fishes from the Sea of Japan. National Museum of Nature and Science Monographs 44, 29–37. [Google Scholar]
  38. Legeżyńska J, Kędra M and Walkusz W (2012) When season does not matter: summer and winter trophic ecology of Arctic amphipods. Hydrobiologia 684, 189–214. [Google Scholar]
  39. Leigh JW and Bryant D (2015) POPART: full-feature software for haplotype network construction. Methods in Ecology and Evolution 6, 1110–1116. [Google Scholar]
  40. Leung TL, Donald KM, Keeney DB, Koehler AV, Peoples RC and Poulin R (2009) Trematode parasites of Otago Harbour (New Zealand) soft-sediment intertidal ecosystems: life cycles, ecological roles and DNA barcodes. New Zealand Journal of Marine and Freshwater Research 43, 857–865. [Google Scholar]
  41. Levinsen GMR (1881) Bidrag til kundskap om Gronlands trematodfauna. Oversigt over det kongelige Dansk videnskadernes Selskabs Forhandlinger 23, 52–84. [Google Scholar]
  42. Littlewood DTJ and Olson PD (2001) Small subunit rDNA and the Platyhelminthes: signal, noise, conflict and compromise. In Littlewood DTJ and Bray RA (eds), Interrelationships of Platyhelminthes. London, UK: Taylor & Francis, pp. 262–278. [Google Scholar]
  43. Lloyd LC (1938) Some digenetic trematodes from Puget Sound fish. The Journal of Parasitology 24, 103–133. [Google Scholar]
  44. Louvard C, Cutmore SC, Yong RQ, Dang C and Cribb TH (2022) First elucidation of a didymozoid life cycle: Saccularina magnacetabula n. gen. n. sp. infecting an arcid bivalve. International Journal for Parasitology 52, 407–425. [DOI] [PubMed] [Google Scholar]
  45. Madhavi R (1978) Life history of Genarchopsis goppo Ozaki, 1925 (Trematoda: Hemiuridae) from the freshwater fish Channa punctata. Journal of Helminthology 52, 251–259. [DOI] [PubMed] [Google Scholar]
  46. Manter HW (1926) Some North American fish trematodes. Illinois Biological Monographs 10, 1–138. [Google Scholar]
  47. Manter HW (1934) Some digenetic trematodes from deep-water fish of Tortugas, Florida. Papers from Tortugas Laboratory 28, 257–345. [Google Scholar]
  48. Matthews BF (1981) Cercaria vaullegeardi Pelseneer, 1906 (Digenea: Hemiuridae); the infection mechanism. Parasitology 83, 587–593. [Google Scholar]
  49. McCauley JE (1960) Some hemiurid trematodes of Oregon marine fishes. The Journal of Parasitology 46, 84–89. [Google Scholar]
  50. Mitenev VK (1993) Parasite fauna of the Barents Sea and White Sea salmon Salmo salar L. In Parasitological studies of fish in the Northern Basin. Murmansk: Izdatel’stvo PINRO, pp. 66–82 [in Russian]. [Google Scholar]
  51. Morgan JAT and Blair D (1995) Nuclear rDNA ITS sequence variation in the trematode genus Echinostoma: an aid to establishing relationships within the 37-collar-spine group. Parasitology 111, 609–615. [DOI] [PubMed] [Google Scholar]
  52. Odhner T (1905) Die Trematoden des arktischen Gebietes. Fauna Arctica 4, 289–372 [in German]. [Google Scholar]
  53. Olson PD, Cribb TH, Tkach VV, Bray RA and Littlewood DTJ (2003) Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). International Journal for Parasitology 33, 733–755. [DOI] [PubMed] [Google Scholar]
  54. Øresland V (1986) Parasites of the chaetognath Sagitta setosa in the western English Channel. Marine Biology 92, 87–91. [Google Scholar]
  55. Polyansky YI (1955) Studies on the parasitology of the fish in the Northern Seas of the USSR. Parasites of fish of the Barents Sea. Trudy Zoologicheskogo Instituta 19, 5–170 [In Russian: English translation (1966) Israel Program for Scientific Translations, Cat. No. 1655, 158 pp.]. [Google Scholar]
  56. Rolbiecki L and Waskusz W (2005) Derogenes varicus (Müller, 1784) from chaetognaths (Chaetognatha) caught in Kongsfjorden, West Spitsbergen. Oceanological and Hydrobiological Studies 34, 131–134. [Google Scholar]
  57. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden S, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P and Cardona A (2012) Fiji: an open-source platform for biological-image analysis. Nature Methods 9, 676–682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Schrandt MN, Andres MJ, Powers SP and Overstreet RM (2016) Novel infection site and ecology of cryptic Didymocystis sp. (Trematoda) in the fish Scomberomorus maculatus. The Journal of Parasitology 102, 297–305. [DOI] [PubMed] [Google Scholar]
  59. Shameem U, Rao NN and Madhavi R (1990) Cercaria chilkaensis No. 1, a new cystophorous cercaria from the snail Stenothyra blanfordiana from Chilka lake, India. Journal of Natural History 24, 261–270. [Google Scholar]
  60. Shulman S and Shulman-Albova R (1953) Parasites of Fishes of the White Sea. Moskva-Leningrad, USSR: Izdatelstvo Akademia Nauk SSSR; [In Russian]. [Google Scholar]
  61. Sokolov SG, Atopkin DM and Gordeev II (2021) Phylogenetic position of the hemiuroid genus Paraccacladium Bray & Gibson, 1977 (Trematoda: Hemiuroidea) and the status of the subfamily Paraccacladiinae Bray & Gibson, 1977. Marine Biology Research 17, 31–40. [Google Scholar]
  62. Stamatakis A (2014) RAxML version 8: a tool for phylogenetic analysis and postanalysis of large phylogenies. Bioinformatics 30, 1312–1313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Timofeeva TA (1976) Morphology and biology of cystophorous cercariae from the Barents Sea. Parazitologiia 10, 488–496 [in Russian, with English summary]. [PubMed] [Google Scholar]
  64. Tkach V, Grabda-Kazubska B, Pawlowski J and Swiderski Z (1999) Molecular and morphological evidence for close phylogenetic affinities of the genera Macrodera, Leptophallus, Metaleptophallus and Paralepoderma [Digenea, Plagiorchiata]. Acta Parasitologica 44, 170–179. [Google Scholar]
  65. Tsuchida K, Flores V, Viozzi G, Rauque C and Urabe M (2021) Hemiuroidean trematodes from freshwater Patagonian fishes: description of a new species, distribution and molecular phylogeny. Parasitology Research 120, 1219–1232. [DOI] [PubMed] [Google Scholar]
  66. Tsuchida K, Rauque C, Viozzi G, Flores V and Urabe M (2022) First report of post-cyclic transmission in trematodes: Derogenes lacustris (Digenea: Hemiuroidea) in Patagonian freshwater fishes. Parasitology 149, 234–238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Urabe M, Nishimura T and Shimazu T (2012) Taxonomic revision of three species of the genus Genarchopsis (Digenea: Hemiuroidea: Derogenidae) in Japan by molecular phylogenetic analyses. Parasitology International 61, 554–560. [DOI] [PubMed] [Google Scholar]
  68. Wardle WJ (1975) Cercaria anadarae sp. n. parasitizing a bivalve mollusc, Anadara brasiliana (Lamarck), from the northwest Gulf of Mexico. Journal of Parasitology 61, 1048–1049. [PubMed] [Google Scholar]
  69. Weinstein M (1972) Studies on the Relationship between Sagitta Elegans Verrill and its Endoparasites in the Southwestern Gulf of St. Lawrence (PhD thesis). University of Montreal, Montreal, Canada. [Google Scholar]
  70. WoRMS (2022) Derogenes varicus (Müller, 1784) Looss, 1901. https://www.marinespecies.org/aphia.php?p=taxdetails&id=109264 on 2022-03-20.
  71. Wright RR (1907) The plankton of eastern Nova Scotia waters. An account of floating organisms upon which young food-fishes mainly subsist. Report Department Marine Fish Canadian 39, 1–18. [Google Scholar]
  72. Yamaguti S (1938) Studies on the helminth fauna of Japan. Part 24. Trematodes of fishes, V. Japanese Journal of Zoology 8, 15–74. [Google Scholar]
  73. Zelmer DA and Esch GW (1998) The infection mechanism of the cystophorous cercariae of Halipegus occidualis (Digenea: Hemiuridae). Invertebrate Biology 117, 281–287. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

For supplementary material accompanying this paper visit https://doi.org/10.1017/S003118202200110X.

S003118202200110Xsup.zip (133.9KB, zip)

click here to view supplementary material

Data Availability Statement

The aligned 28S, 18S, 5.8 rDNA, ITS2 and cox1 datasets used in phylogenetic analysis are freely accessible at http://dx.doi.org/10.13140/RG.2.2.19523.27683/1.

Articles from Parasitology are provided here courtesy of Cambridge University Press

RESOURCES