Skip to main content
Parasites & Vectors logoLink to Parasites & Vectors
. 2024 May 9;17:209. doi: 10.1186/s13071-024-06292-8

A case of mistaken identity: a systematic review, meta-analysis, and reinvestigation of hemotropic Mycoplasma spp. infection in Ctenocephalides felis (cat flea)

Charlotte O Moore 1, Erin Lashnits 2, Michael Lappin 3, Jennifer Hawley 3, Edward B Breitschwerdt 1,
PMCID: PMC11078739  PMID: 38720359

Abstract

Background

Feline-associated hemotropic Mycoplasma (hemoplasmas) are believed to be transmitted by two primary mechanisms: (1) direct transmission via fighting and (2) vector-borne transmission by the cat flea (Ctenocephalides felis). While the efficiency of transmission by C. felis appears low, most manuscripts focus on the prevalence of hemoplasmas in wild-caught fleas and report either a very low (< 3%) or a high (> 26%) prevalence. Therefore, we aimed to assess the influence of sample processing and PCR methods on C. felis hemoplasma infection prevalence.

Methods

A systemic review of PubMed articles identified 13 manuscripts (1,531 fleas/flea pools) that met the inclusion criteria (performed PCR for >1 hemoplasma on C. felis collected from cats). Risk of bias was assessed utilizing the ROBINS-E tool. Meta-analysis performed in R of these manuscripts found that not washing samples and a common set of 16S rRNA primers first published in Jensen et al. 2001 were associated with increased hemoplasma prevalence. To evaluate the influence of washing on newly collected fleas, we assessed the hemoplasma status of 20 pools of 5 C. felis each, half of which were washed and half not washed.

Results

Flea washing did not influence the detection of hemoplasma but instead amplified Spiroplasma. To assess non-specific amplification with the Jensen et al. 2001 primers, 67 C. felis samples (34% previously reported hemoplasma infected) were subject to PCR and sequencing. By this method, hemoplasma was detected in only 3% of samples. In the remaining “hemoplasma infected” fleas, PCR amplified Spiroplasma or other bacteria.

Conclusions

Therefore, we concluded that hemoplasma infection in C. felis is rare, and future flea prevalence studies should sequence all positive amplicons to validate PCR specificity. Further investigation of alternative methods of feline-associated hemoplasma transmission and the ability of C. felis to maintain hemoplasma infection is necessary.

Graphical Abstract

graphic file with name 13071_2024_6292_Figa_HTML.webp

Supplementary Information

The online version contains supplementary material available at https://doi.org/10.1186/s13071-024-06292-8.

Keywords: Ctenocephalides felis, Cat flea, Hemotropic mycoplasma, Vector-borne, Flea-borne pathogen, Mycoplasma haemofelis, Candidatus Mycoplasma turicensis, Mycoplasma haemominutum

Background

While multiple species of hemotropic Mycoplasma (hemoplasma) have been described in domestic and wild animals (e.g. domestic cat, dog, and swine), their presence, disease manifestations, and mechanism of transmission remain incompletely understood [15]. Case reports document human infection and disease caused by a human-associated hemoplasma species (Candidatus Mycoplasma turicensis) as well as hemoplasma associated with domestic animal species such as the cat (Mycoplasma haemofelis), dog (Candidatus Mycoplasma haematoparvum), pig (Mycoplasma suis), and sheep (Mycoplasma ovis) [49]. Human illness varies in reported severity with symptoms that range from pyrexia and hemolytic anemia to lymphadenomegaly and hepatosplenomegaly. Understanding domestic animal-associated hemoplasma transmission and disease manifestations in the classically associated host species will further inform our understanding of disease epidemiology, pathogenesis, and potential zoonotic transmission routes.

The domestic cat is host to three hemoplasma species: Mycoplasma haemominutum (Mhm), M. haemofelis (Mhf), and Candidatus Mycoplasma turicensis (Mtc) [10]. Within the feline host, hemoplasmas infect erythrocytes, occasionally causing hemolytic anemia and fever. Experimental infection documents a spectrum of disease severity, with cats generally manifesting a single episode of transient anemia that resolves spontaneously in approximately 50 days [11, 12]. In immunocompromised cats, hemoplasmas are believed to cause more severe regenerative hemolytic anemia and fever and potentially contribute to myeloproliferative diseases in feline leukemia virus (FeLV)-infected cats [11]. Among the three feline associated hemoplasma species, Mhf is the most pathogenic and Mhm is the most common [13, 14]. Infection in the cat is typically associated with male sex, older age, outdoor access, multi-cat homes, and feline immunodeficiency (FIV) infection [1518].

The mode(s) of transmission for feline-associated hemoplasmas are poorly understood with researchers and veterinarians proposing two primary mechanisms: transmission via “fighting” (blood contact) and flea-borne transmission [10]. The association of hemoplasma infection with male cats, outdoor access, older age, and FIV infection are all cited as evidence that feline hemoplasmas are transmitted via fighting [1518]. While experimental transmission via fighting is ethically concerning, current experimental transmission models utilize blood transfusion, mimicking transmission via blood-to-blood contact [13, 19].

In the last 13 years, there has been minimal advancement in the understanding of fleas as vectors for hemoplasma transmission [10]. Based on experimental transmission, Ctenocephalides felis (the cat flea) are capable of transmitting Mhf to uninfected cats at a low transmission efficiency (1/6) following infestation with 100 C. felis from a hemoplasma-infected cat [14]. However, Mhm was not apparently transmitted by flea infestation in this model, and neither Mhf nor Mhm was transmitted by ingestion of infected fleas [14, 20]. Confusingly, the prevalence of hemoplasma infection in C. felis samples varies widely among publications (0–72%), with no evidence of geographic, host, or flea factors to explain this divergence [21, 22]. Assessing the persistence of infection in C. felis, dissemination in C. felis tissues, and true rate of hemoplasma infection in C. felis is necessary to assess the frequency and type (mechanical or biological) of hemoplasma transmission by C. felis.

The goal of this study was to reassess the previous reports of high hemoplasma prevalence in wild-caught C. felis and determine whether differences in laboratory methods may explain the large range in reported prevalence. To accomplish this, a meta-analysis was performed to assess the influence of specific methodological differences on the prevalence of C. felis hemoplasma infection from 13 manuscripts. Two variables of interest were included: flea washing and primer set. Flea washing was included because of the observation in reviewing literature that manuscripts including flea washing displayed lower hemoplasma detection. Primer set was analyzed because of the previous non-specific amplification of bacteria other than hemoplasmas with hemoplasma primers (Breitschwerdt Laboratory, unpublished data). This analysis indicated flea washing and the use of hemoplasma primers designed by Jensen et al. 2001 (Myco_Hf_F, Myco_Hf_R) or similar Manvell et al. 2021 primers (Myco_Hf_F.1, Myco_Hf_R) have a significant effect on feline hemoplasma detection in C. felis (Table 1) [23, 24]. Therefore, the second aim was to experimentally assess whether flea washing removes feline hemoplasma. Following the amplification of bacteria other than hemoplasmas in washed and un-washed fleas utilizing the Myco_Hf_F.1 and Myco_Hf_R primers, the third aim was to reassess the detection of hemoplasma in fleas previously reported as hemoplasma infected with the addition of sequencing to confirm amplicon identities.

Table 1.

Hemotropic Mycoplasma spp. PCR primers. Primers utilized in this study for retesting of hemotropic Mycoplasma spp. DNA in stored Ctenocephalides felis samples from a previous publication that reported a high hemotropic Mycoplasma prevalence in cat fleas [28]

Primer Oligonucleotide sequence (5′-3′) Target gene Reference
Myco_Hf_F ACGAAAGTCTGATGGAGCAATA 16S hMyco Jensen et al. 2001 [24]
Myco_Hf_R ACGCCCAATAAATCCGRATAAT
Myco_Hf_F.1 GACGAAAGTCTGATGGAGCAAT 16S hMyco Manvell et al. 2021 [23]
Myco_Hf_R ACGCCCAATAAATCCGRATAAT

Methods

Meta-analysis of hemotropic Mycoplasma spp. in Ctenocephalides felis

The evidence for flea-borne transmission of hemoplasmas relies primarily on the detection of hemoplasma DNA in C. felis (cat flea) removed from domestic cats. A search on PubMed (https://pubmed.ncbi.nlm.nih.gov/) on December 7, 2023, for five terms (“mycoplasma flea,” “hemobartonella flea,” “hemotropic mycoplasma flea,” “feline hemotropic mycoplasma vector,” “hemoplasma flea”) was utilized to identify suitable articles. The authors also reviewed all citations within the included manuscripts and did not identify additional suitable articles. Articles were included if they tested C. felis from cats for more than one hemoplasma species. Manuscripts dated before December 2023 were considered. Abstracts for all manuscripts were reviewed to determine inclusion by the first author (COM) and full texts utilized to collect data. All data were collected by the first author of this manuscript (COM). The total number of fleas, number of hemoplasma-infected fleas, primers utilized for PCR, and use of flea washing was determined for each manuscript. Only manuscripts with all variables of interest reported were considered. If the article included testing both C. felis and Ctenocephalides canis, only C. felis data were selected, if the article gave sufficient information.

Potential sources of bias were considered. Only manuscripts written in English were returned by the search. As the outcomes analyzed were not due to intervention (i.e. assignment to treatment groups), the risk of reporting bias is considered minimal. The greatest potential risk of bias was the inability to locate manuscripts reporting fleas not infected with hemoplasma species due to the use of alternative keywords (e.g. Bartonella, Rickettsia) more in line with the study’s findings. Bias due to missing results was unlikely, as all manuscripts were required to report the variables of interest. The ROBINS-E tool (riskofbias.info/welcome/robins-e-tool) was used to guide the assessment of individual study bias (Additional file 1).

Methods of heterogeneity were analyzed as the variables of interest, specifically primer set and flea washing. The outcome of interest was the proportion of hemoplasma-infected fleas. Inclusion criteria required that all studies were eligible for synthesis, as they reported the variables and outcome of interest. Pearson's Chi-squared test was used to assess the association of primer and flea washing with flea hemoplasma infection. In comparisons with > 2 categories, pairwise comparison between proportions was performed to determine significantly different categories. All data analysis and visualization were performed in R (version 4.3.0). A sensitivity analysis was performed including the one manuscript that met almost all inclusion criteria but only tested C. felis for Mhf. Certainty in the body of evidence was assessed by study design.

Effect of washing on hemoplasma status

To assess the effect of flea washing on hemoplasma detection in fleas, 100 previously collected C. felis were obtained from free-roaming cats in the Northeast and Midwest US by the FleaNet Biobank (University of Wisconsin-Madison School of Veterinary Medicine, https://fleanet.vetmed.wisc.edu/). Fleas were then assigned to 20 different flea pools (5 fleas per pool). Each flea from an individual cat was assigned to a different pool. The 20 flea pools were then randomized to two treatment groups: washing vs. not washing. For the washing group, half of the flea pools (n = 10) underwent two phosphate-buffered saline (PBS) and two 100% ethanol washes, similar to the manuscripts included in the meta-analysis that utilized a wash step [2426]. Briefly, 200 ul PBS or ethanol was pipetted into the pool of fleas, gently vortexed, and pipetted off. All flea pools then underwent DNA extraction and PCR targeting the 16S rRNA hemoplasma gene utilizing the Myco_Hf_F.1 and Myco_Hf_R primers [23]. These primers were selected because of their prior use and validation within the laboratory. All PCR-positive samples were sequenced and compared to published sequences utilizing NCBI BLAST.

Reinvestigation of hemoplasma detection in Ctenocephalides felis

To reevaluate the prevalence and sequence identity obtained from fleas previously reported as hemoplasma positive, the DNA from 67 individual fleas from a previous survey of hemoplasma in Thailand was provided by a co-author (M.L.) [28]. Conventional PCR utilizing the Myco_Hf_F and Myco_Hf_R primers was first performed at Colorado State University (CSU), and then qPCR utilizing the Myco_Hf_F.1 and Myco_Hf_R primers was performed at North Carolina State University (NCSU). Resulting amplicons at both universities were submitted for sequencing and compared to published sequences utilizing NCBI BLAST. DNA was maintained at −80 °C at CSU and shipped overnight on ice to NCSU where it was stored in a −80 °C freezer.

Results

Meta-analysis of hemotropic Mycoplasma spp. in Ctenocephalides felis

The search yielded 66 articles, 13 of which met the inclusion criteria (Fig. 1; Table 2). No abstracts or non-English articles were returned from the search, and all manuscripts that did not include testing of C. felis from cats for two or more hemoplasma species were excluded. One manuscript reports the testing of fleas from cats for hemoplasma but only included Mhf and was therefore not considered in the analyses [29]. Citations within the included manuscripts did not identify additional suitable articles.

Fig. 1.

Fig. 1

Study selection. Flowchart depicting the number of records identified by our search, reason for exclusion, and number of included records (box shown in green).

Table 2.

Manuscripts reporting hemotropic Mycoplasma spp. in wild-caught Ctenocephalides felis. Manuscript first author and citation, sample type (pooled or individual fleas), number of fleas per pool, percentage of hemoplasma-positive samples, country of flea origin, and primer set utilized to assess hemotropic Mycoplasma spp. presence in wild-caught C. felis. All studies that pooled fleas included fleas from a single host animal in the pool. ‘N/A’ indicates that the manuscript did not utilize pooling. ‘Not indicated’ indicates that the manuscript did not report the range of fleas included in flea pools

Manuscript [citation] Sample type Fleas per pool % Hemoplasma-positive samples ± 95% CI (#/Total Tested) Country Primer [citation]
Shaw et al. 2004 [30] Pooled fleas 1–5 49% ± 1.09% (44/90) UK Jensen et al. 2001 [24]
Lappin et al. 2006 [31] Pooled fleas 1–14 27% ± 0.95% (25/92) US Jensen et al. 2001 [24]
Willi et al. 2007 [21] Pooled fleas Not indicated 3% ± 0.44% (2/73) Switzerland Willi et al. 2005 [19]
Kamrani et al. 2008 [18] Pooled fleas 1–5 72% ± 1.76% (36/50) Ontario, Canada Jensen et al. 2001 [24]
Barrs et al. 2010 [22] Pooled fleas 2–15 56% ± 0.88% (62/111) Australia Jensen et al. 2001 [24]
Hornok et al. 2010 [27] Pooled fleas 1–11 2% ± 0.13% (3/187) Central-Eastern Europe Willi et al. 2005 [19]
Assarasakorn et al. 2012 [28] Pooled fleas 1–3 34% ± 1.86% (17/50) Thailand Jensen et al. 2001 [24]
Persichetti et al. 2016 [25] Pooled fleas 2–5 0% (0/28) Italy Martínez-Díaz et al. 2013 [32]
Abdullah et al. 2019 [33] Pooled fleas 1–89 1% ± 0.03% (3/470) UK Peters et al. 2008 [34]
Mifsud et al. 2020 [35] Pooled fleas 2–5 38% ± 4.53% (8/21) Thailand Jensen et al. 2001 [24]
Manvell et al. 2021 [26] Individual fleas N/A 0% (0/168)

US,

UK

Manvell et al. 2021 [23]
Azrizal-Wahid et al. 2021 [36] Individual fleas N/A 0% (0/100) Malaysia Criado-Fornelio et al. 2003 [37]
Zarea et al. 2022 [38] Individual fleas N/A 0% (0/91) Asia Tasker et al. 2010 [39]

Manuscripts were diverse, including studies from Asia, Australia, Europe, and North America and spanning from 2004 to 2022. Most manuscripts utilized primers targeting the hemoplasma 16S rRNA gene developed by Jensen et al. 2001 (Myco_Hf_F and Myco_Hf_R) or similar Manvell et al. 2021 primers (Myco_Hf_F.1 and Myco_Hf_R) [23, 24]. The Myco_Hf_F.1 primer is almost 100% homologous to the Myco_Hf_F primers but has a one base pair shift in the forward primer that is homologous to hemoplasma and Spiroplasma spp. sequences (Table 1). In total, these 13 manuscripts reported PCR results from 1531 Ctenocephalides fleas or flea pools (Additional file 2).

Risk of bias, as assessed by the ROBINS-E tool, was considered uniformly low for all manuscripts due to the meta-analysis inclusion criteria and observational nature of all studies. Methodological differences are considered the most likely source of misclassification error and are therefore the focus of analysis.

The first methodological variation of interest was the washing procedures implemented among different studies. Manuscripts that implemented washing (n = 3) reported 0.78% (3/383) of C. felis infected with hemoplasmas whereas manuscripts that did not implement washing (n = 10) reported 17.2% (197/1148) (p < 0.0001; Pearson’s Chi-squared test). Upon further analysis, the primer set utilized by these manuscripts appeared to be a confounding variable.

Comparing the hemoplasma detection rate of manuscripts utilizing the Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R primers to those utilizing other primer sets, seven manuscripts were identified that utilized the Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R primers and six manuscripts utilized other primer sets. Manuscripts utilizing the Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R primers reported 33% (192/582) of C. felis as hemoplasma infected compared to 0.82% (8/949) of C. felis infected in manuscripts utilizing other primer sets (p < 0.0001; Pearson’s Chi-squared test). Of the manuscripts utilizing the Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R primers, three reported sequencing all samples and one reported sequencing Mhf or Mtc positive samples. In those that did not utilize sequencing, hemoplasma identity was assessed by amplicon size via gel electrophoresis. Of the three manuscripts reporting sequencing, only one reported the GenBank accession ID of sequences.

When assessing the two variables of interest (washing and primer set), fleas from manuscripts that utilized the Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R primer set and did not wash fleas clearly displayed the highest hemoplasma infection prevalence (Table 3; p < 0.0001). Therefore, further investigation of unwashed fleas and confirmation of the hemoplasma detection in fleas tested with the Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R primer set were required to determine if increased hemoplasma detection could be attributed to flea washing or primer set. Sensitivity analysis included one additional manuscript that utilized only Mhf PCR and found that all statistical tests yielded the same significant/non-significant result [29]. All studies were descriptive, observational studies. Certainty of prevalence estimates varied across studies based on study size (n = 21–111).

Table 3.

Primer set, flea pooling, and flea washing are associated with detection of hemotropic Mycoplasma spp. This table displays the percentage of hemotropic Mycoplasma-infected fleas reported by the identified manuscripts based on the PCR primers utilized and whether authors utilized a washing step prior to DNA extraction. Primers are grouped as either those designed by Jensen et al. 2001 or other primers. *Categories that were significantly different from all other categories by pairwise comparison of proportions post hoc test. *p < 0.05, **p < 0.01, ***p < 0.0001

Primer set Washed Percentage infected fleas ± 95% CI (# pos/total)
Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R No 46.38 ± 0.24% (192/414) ***
Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R Yes 0% (0/168)
Other primers No 0.68 ± 0.03% (5/734)
Other primers Yes 1.40 ± 0.11% (3/215)

Effect of washing on hemoplasma prevalence

Of the 20 new C. felis pools that underwent DNA extraction and PCR for hemoplasma, 12 pools (60%) were positive by PCR including 7 (70%) in the wash group and 5 (50%) in the no-wash group (p = 0.65; Fisher’s exact test). However, when sequenced, all amplicons were identified as Spiroplasma spp. (GenBank accession no. EU170606.1), not a hemoplasma species.

Reinvestigation of hemoplasma detection in Ctenocephalides felis

DNA from fleas previously reported as hemoplasma positive [28] was obtained and retested utilizing the Myco_Hf_F and Myco_Hf_R primers at Colorado State University and the Myco_Hf_F.1 and Myco_Hf_R primers at North Carolina State University [23, 24]. The original study assessed amplicon identity by gel electrophoresis and comparison to sequence length, not by sequencing. In total, only two C. felis (2/67, 3% vs. the previously published 34%) contained hemoplasma DNA, as confirmed by sequencing. Spiroplasma spp. DNA was amplified and sequenced from a majority of previously PCR positive samples (Table 4). Non-specific amplification of bacteria other than hemoplasma was confirmed independently at two institutions when using both primer sets (Table 5).

Table 4.

Results from hemotropic Mycoplasma spp. PCR. Percentage and total number of fleas infected with different hemotropic Mycoplasma spp. and other bacteria based on hemotropic Mycoplasma PCR and sequencing with the Jensen et al. 2001 and Manvell et al. 2021 primers. One sample was positive for Limosilactobacillus spp. and Spiroplasma spp. and is therefore included in both. If samples were negative by one PCR and positive by another, they were included in only the positive result. The GenBank Accession ID is included for reference

Organism % DNA positive fleas (#) GenBank accession ID
Spiroplasma spp. 23.9% (16) EU170606.1
Mycoplasma haemofelis 3.0% (2) AM748929.1
Limosilactobacillus spp. 3.0% (2) OP554566.1
Sinocapsa zengkensis 1.5% (1) NR_177749.1
Lactobacillus rhamnosus 1.5% (1) GU429435.1
Bacillus cereus 1.5% (1) MN251217.1
Uncultured bacterium 4.5% (3)

MF224262.1 (n = 2)

MT013437.1 (n = 1)

Negative 62.7% (42) N/A

Table 5.

Comparison of Manvell et al. 2021 and Jensen et al. 2001 hemotropic Mycoplasma spp. PCR primers. Percentage of samples (number of samples) with non-specific amplification, hemotropic Mycoplasma spp. amplification, or negative PCR results. A small proportion of samples did not have enough excess DNA available for testing utilizing the Manvell et al. 2021 primers and are therefore listed as “Not available for testing.” Primers utilized are those from Manvell et al. 2021 [23] and Jensen et al. 2001 [24]

Manvell et al. 2021 Jensen et al. 2001
Non-specific amplification Mycoplasma haemofelis Negative
Non-specific amplification 22.4% (15) 0% (0) 5.5% (5)
Mycoplasma haemofelis 0% (0) 0% (0) 0% (0)
Negative 4.5% (3) 1.5% (1) 59.7% (40)
Not available for testing 0% (0) 1.5% (1) 3% (2)

Discussion

This manuscript documents the frequent amplification of Spiroplasma spp. or other bacteria by the Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R primers developed to detect the hemoplasma 16S rRNA gene [23, 24]. This suggests that previous reports of high hemoplasma prevalence in C. felis are likely due to misreporting of Spiroplasma or other bacteria in the absence of sequencing or primers specific for hemoplasma. Using stored DNA from Assarasakorn et al., hemoplasma was detected in only 3% (2/67) of individual C. felis compared to the 34% (17/50) of flea pools reported in the original study [27]. This finding reinforces the importance of sequencing PCR amplicons and comparison to a robust, updated database of sequences.

The finding that flea washing did not influence hemoplasma detection suggests that these methodological changes are not responsible for the variability of hemoplasma detection in the 13 manuscripts analyzed. The failure to detect hemoplasma with or without washing suggests that differing hemoplasma prevalence is not due to physical removal of hemoplasma from the surface or flea mouthparts.

The primary evidence for flea-borne transmission of feline hemoplasmas is the high prevalence in C. felis. Therefore, with a lower revised prevalence, we suggest there is limited evidence for C. felis facilitating sufficient transmission for the current prevalence of hemoplasma in cats worldwide (~ 20%) [40, 41]. Other epidemiology and experimental study findings provide limited evidence that C. felis is primarily responsible for transmission of hemoplasma: (1) poor transmission efficiency in experimental studies, (2) dissimilar hemoplasma and C. felis or Bartonella spp. (a known flea-borne pathogen) epidemiology, and (3) a lack of correlation between cat hemoplasma infection and flea infestation. Additionally, the findings reported in this manuscript suggest that (4) wild-caught C. felis are only occasionally infected with hemoplasmas.

  • (1) While experimental infection of domestic cats by inoculation with hemoplasma-infected blood from a donor cat is well documented, experimental infection by C. felis fed on hemoplasma-infected cats failed to transmit hemoplasma to a majority of recipient cats [13, 14, 42, 43]. Hemoplasmas can be detected by PCR in C. felis after feeding on an infected cat (Mhm or Mhf); however, the ability of hemoplasmas to colonize C. felis, proliferate within C. felis, or disseminate to the C. felis salivary glands for transmission in the saliva is unknown [14]. In attempted experimental infection by fleas fed on known hemoplasma-infected hosts, the one cat that displayed infection, as indicated by PCR amplification, likely acquired a low hemoplasma dose as they failed to manifest clinical or hematological abnormalities despite infestation with far more infected fleas than is expected to occur in nature [14]. Additional attempts to infect cats by ingestion of infected C. felis or C. felis feces failed to produce infection [20]. Given the low rate of transmission and a suspected low infectious dose delivered by C. felis (too low to develop disease), the authors suggest that C. felis may be an occasional mechanical vector of hemoplasmas and an unlikely biological vector.

  • (2) The lack of association between feline hemoplasma infection and C. felis epidemiology further questions the role of C. felis in feline-associated hemoplasma transmission. Compared to predicted C. felis prevalence (see Lawrence et al. 2019), feline hemoplasmas do not display similar epidemiology, being overrepresented in certain countries (e.g. Saudi Arabia, Iran, South Korea) and underrepresented in others (e.g. China; Fig. 2) [44]. This lack of association is confirmed by large surveys (n > 950 cats) from Italy and Japan that failed to determine geographic variations in hemoplasma presence despite predicted variations in C. felis epidemiology [45, 46]. In contrast, in the same study from Italy and a similar study from Japan, a geographic association was detected for feline Bartonella spp., a known flea-borne pathogen [45, 47]. This lack of association also extends to the association of host hemoplasma infection with C. felis infestation.

  • (3) Investigating the association of host hemoplasma infection and flea infestation consistently fails to report an association [32, 39, 40, 77, 80, 85], with limited studies detecting an association [55]. However, due to the persistence of hemoplasma infection over long periods of time and the association of flea infestation with other variables (e.g. outdoor access, owned status), these studies are of limited value to assess the relevance of C. felis as a vector of hemoplasma species.

  • (4) Finally, our finding that non-hemoplasma bacteria are frequently amplified by primers targeting the 16S rRNA gene, specifically the Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R primers, indicates that the true rate of hemoplasma infection in C. felis in nature is much lower than previously reported. The frequency of off-target amplification utilizing these primers reflects the importance of sequencing and advantage of utilizing a gene target specific to the genus of interest. Across manuscripts not utilizing the Myco_Hf_F/Myco_Hf_F.1 and Myco_Hf_R primers, the cumulative percentage of hemoplasma-infected C. felis is < 1% (0.82%; 8/949). We propose this detection rate may be due to the ingestion of hemoplasmas in the infected bloodmeal and not infection or colonization of the flea. As the hemoplasma infection status of the tested C. felis was unknown, it was not possible to assess the effect of washing on hemoplasma infection. However, the authors still encourage washing of vector samples, particularly for microbiome analysis [96].

Fig. 2.

Fig. 2

Global epidemiology of feline hemotropic Mycoplasma spp. infection. Rate of hemotropic Mycoplasma infection from manuscripts obtained from PubMed searching every combination of “[Country] cat mycoplasma.” If multiple manuscripts were obtained from a single country, the prevalence was recalculated based on the number of cats tested and number of hemotropic Mycoplasma-positive cats. Map was created utilizing mapchart.net. Prevalence is derived from the following manuscripts: Albania [48], Australia [22, 49], Brazil [40, 5055], Canada (British Columbia [56], Ontario [18], Saskatchewan [57], Prince Edward Island [58]), Chile [59], China [60], Cyprus [61], Denmark [62], Ecuador [63], Egypt [64], Germany [17, 65], Greece [66, 67], Iran [68], Ireland [69], Italy [25, 45, 7072], Kenya [29] Japan [46, 73, 74], New Zealand [75], Portugal [32, 76], Qatar [77], Romania [78], Russia [79], Saudi Arabia [80], South Africa [81], South Korea [82], Spain [40, 83, 84], Switzerland [19], Tanzania [28], Thailand [28, 8587], Turkey [88, 89], Trinidad and Tobago [90], England [91], USA (Arizona [92], California, Colorado, and Florida [93], Louisiana [94], and Virginia and North Carolina [23]), Scotland [95], and Singapore [93]

Limitations of this meta-analysis include a limited body of literature and potential failure to identify manuscripts with hemoplasma-negative fleas due to the use of alternative keywords. Furthermore, this manuscript did not assess the influence of host factors (outdoor access, sex, etc.), rigor of flea collection, or average number of fleas per host on reported hemoplasma prevalence. Experimental work completed in this manuscript is limited by the observational nature with a clear need for experimental transmission studies to fully understand the extent of flea involvement in hemoplasma transmission. Furthermore, testing of known infected C. felis with and without flea washing is necessary to assess the influence of washing on pathogen detection.

Conclusions

In summary, the revised low rate of C. felis hemoplasma detection necessitates further investigation of the efficiency of C. felis as a vector and ability of C. felis to maintain hemoplasma infection. Future investigation of hemoplasma transmission should also explore alternative modes of transmission. Transmission by alternative vector species is considered unlikely given the inability of Aedes aegypti to transmit hemoplasma infection and limited detection of hemoplasma infection in other wild-caught ectoparasites (e.g. ticks) [21, 97, 98]. Vertical transmission of hemoplasma is also considered unlikely in the cat because of the infrequent detection in female cats or their reproductive tissue and an association of infection with older age [1, 23]. Based upon current evidence, feline-associated hemoplasmas are likely transmitted by biting and scratching during fighting. This is supported by epidemiological studies that report an association of hemoplasma infection with male cats, older age, and outdoor access [15, 17, 40, 46, 71], as well as experimental studies that report transmission of anemia by ingestion of blood from an anemic cat and the detection of hemoplasmas in cat saliva and salivary glands [99, 100]. Based on this evidence, direct transmission of hemoplasma species via fighting presents a promising area of research.

Supplementary Information

13071_2024_6292_MOESM1_ESM.docx (40.3KB, docx)

Additional file 1: S1. PRISMA Checklist. Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA).

13071_2024_6292_MOESM2_ESM.xlsx (16.4KB, xlsx)

Additional file 2: S1. Data list of articles included in the systematic review and sensitivity analysis.

Acknowledgements

The authors thank the North Carolina State University-Vector Borne Disease Diagnostics Laboratory for sharing their hemotropic Mycoplasma primers with us.

Author contributions

CM, EL, and EB designed the study. CM, EL, ML, and EB acquired study resources and funding. CM, EL, JH, and ML collected samples. CM and EL conceptualized data analysis. CM performed formal analysis and data visualization. CM and EB performed original manuscript draft preparation. All authors reviewed and edited the final manuscript draft. EL, ML, and EB supervised the project.

Funding

A portion of this project was completed while CM was supported by the North Carolina State University’s Molecular Biotechnology Training Program of the National Institutes of Health under award number 1T32GM133366.

Availability of data and materials

The data utilized for meta-analysis are available in the supplementary data file.

Declarations

Ethics approval and consent to participate

N/A

Consent for publication

N/A.

Competing interests

In conjunction with S. Sontakke and North Carolina State University, EBB holds US Patent No. 7,115,384 Media and Methods for Cultivation of Microorganisms, which was issued on October 3, 2006, and also co-founder, shareholder, and Chief Scientific Officer for Galaxy Diagnostics, a company that provides advanced diagnostic testing for the detection of Bartonella spp. infections. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential competing of interest.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

8/23/2026

Following original publication, Additional file 2 has been updated; please be referred to the current version of the file

Change history

10/30/2024

A Correction to this paper has been published: https://doi.org/10.1186/s13071-024-06536-7

References

  • 1.Lashnits E, Grant S, Thomas B, Qurollo B, Breitschwerdt EB. Evidence for vertical transmission of Mycoplasma haemocanis, but not Ehrlichia ewingii, in a dog. J Vet Intern Med. 2019;33:1747–52. 10.1111/jvim.15517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Huggins LG, Baydoun Z, Mab R, Khouri Y, Schunack B, Traub RJ, et al. Transmission of haemotropic Mycoplasma in the absence of arthropod vectors within a closed population of dogs on ectoparasiticides. Sci Rep. 2023;13:10143. 10.1038/s41598-023-37079-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bordin LC, Gava D, Sonalio K, Mechler-Dreibi ML, Zanella JRC, Morés N, et al. Investigation of hemotropic Mycoplasmas in fetuses and sows with reproductive failure. Vet Anim Sci. 2021. 10.1016/j.vas.2021.100175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Dos Santos AP, Dos Santos RP, Biondo AW, Dora JM, Goldani LZ, De Oliveira ST, et al. Hemoplasma infection in HIV-positive patient. Brazil Emerg Infect Dis. 2008;14:1922–4. 10.3201/eid1412.080964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hattori N, Kuroda M, Katano H, Takuma T, Ito T, Arai N, et al. Candidatus Mycoplasma haemohominis in Human, Japan. Emerg Infect Dis. 2020. 10.3201/eid2601.190983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sykes JE, Lindsay LAL, Maggi RG, Breitschwerdt EB. Human coinfection with Bartonella henselae and two hemotropic Mycoplasma variants resembling Mycoplasma ovis. J Clin Microbiol. 2010;48:3782–5. 10.1128/JCM.01029-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Yuan C, Liang A, Yu F, Yang Z, Li Z, Zhu J, et al. Eperythrozoon infection identified in an unknown aetiology anaemia patient. Ann Microbiol. 2007;57:467–9. 10.1007/BF03175091. [DOI] [Google Scholar]
  • 8.Steer JA, Tasker S, Barker EN, Jensen J, Mitchell J, Stocki T, et al. A novel hemotropic Mycoplasma (Hemoplasma) in a patient with hemolytic anemia and pyrexia. Clin Infect Dis. 2011;53:147–51. 10.1093/cid/cir666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Maggi RG, Compton SM, Trull CL, Mascarelli PE, Mozayeni BR, Breitschwerdt B, et al. Infection with hemotropic Mycoplasma species in patients with or without extensive arthropod or animal contact. J Clin Microbiol. 2013;51:3237–41. 10.1128/JCM.01125-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sykes JE. Feline hemotropic mycoplasmas. Vet Clin North Am Small Anim Pract. 2010;40:1157–70. 10.1016/j.cvsm.2010.07.003. [DOI] [PubMed] [Google Scholar]
  • 11.George JW, Rideout BA, Griffey SM, Pedersen NC. Effect of preexisting FeLV infection or FeLV and feline immunodeficiency virus coinfection on pathogenicity of the small variant of Haemobartonella felis in cats. Am J Vet Res. 2002;63:1172–8. 10.2460/ajvr.2002.63.1172. [DOI] [PubMed] [Google Scholar]
  • 12.Wolf-Jäckel GA, Jäckel C, Museux K, Hoelzle K, Tasker S, Lutz H, et al. Identification, characterization, and application of a recombinant antigen for the serological investigation of feline hemotropic Mycoplasma infections. Clin Vaccine Immunol. 2010;17:1917–25. 10.1128/CVI.00282-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tasker S, Peters IR, Papasouliotis K, Cue SM, Willi B, Hofmann-Lehmann R, et al. Description of outcomes of experimental infection with feline haemoplasmas: Copy numbers, haematology, Coombs’ testing and blood glucose concentrations. Vet Microbiol. 2009;139:323–32. 10.1016/j.vetmic.2009.06.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Woods JE, Brewer MM, Hawley JR, Wisnewski N, Lappin MR. Evaluation of experimental transmission of Candidatus Mycoplasma haemominutum and Mycoplasma haemofelis by Ctenocephalides felis to cats. Am J Vet Res. 2005;66:1008–12. 10.2460/ajvr.2005.66.1008. [DOI] [PubMed] [Google Scholar]
  • 15.Willi B, Boretti FS, Baumgartner C, Tasker S, Wenger B, Cattori V, et al. Prevalence, risk factor analysis, and follow-up of infections caused by three feline hemoplasma species in cats in Switzerland. J Clin Microbiol. 2006;44:961–9. 10.1128/JCM.44.3.961-969.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sykes JE, Terry JC, Lindsay LL, Owens SD. Prevalences of various hemoplasma species among cats in the United States with possible hemoplasmosis. J Am Vet Med Assoc. 2008;232:372–9. 10.2460/javma.232.3.372. [DOI] [PubMed] [Google Scholar]
  • 17.Bergmann M, Englert T, Stuetzer B, Hawley JR, Lappin MR. Risk factors of different hemoplasma species infections in cats. BMC Vet Res. 2017;13:6. 10.1186/s12917-017-0953-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kamrani A, Parreira VR, Greenwood J, Prescott JF. The prevalence of Bartonella, hemoplasma, and Rickettsia felis infections in domestic cats and in cat fleas in Ontario. Can J Vet Res. 2008;1:411–9. [PMC free article] [PubMed] [Google Scholar]
  • 19.Willi B, Boretti FS, Cattori V, Tasker S, Meli ML, Reusch C, et al. Identification, molecular characterization, and experimental transmission of a new hemoplasma isolate from a cat with hemolytic anemia in Switzerland. J Clin Microbiol. 2005;43:2581–5. 10.1128/JCM.43.6.2581-2585.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Woods JE, Wisnewki N, Lappin MR. Attempted transmission of Candidatus Mycoplasma haemominutum and Mycoplasma haemofelis by feeding cats infected Ctenocephalides felis. Am J Vet Res. 2006;67:494–7. 10.2460/ajvr.67.3.494. [DOI] [PubMed] [Google Scholar]
  • 21.Willi B, Boretti FS, Meli ML, Bernasconi MV, Casati S, Hegglin D, et al. Real-time PCR investigation of potential vectors, reservoirs, and shedding patterns of feline hemotropic mycoplasmas. Appl Environ Microbiol. 2007;73:3798–802. 10.1128/AEM.02977-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Barrs VR, Beatty JA, Wilson BJ, Evans N, Gowan R, Baral RM, et al. Prevalence of Bartonella species, Rickettsia felis, haemoplasmas and the Ehrlichia group in the blood of cats and fleas in eastern Australia. Aust Vet J. 2010;88:160–5. 10.1111/j.1751-0813.2010.00569.x. [DOI] [PubMed] [Google Scholar]
  • 23.Manvell C, Ferris K, Maggi R, Breitschwerdt EB, Lashnits E. Prevalence of vector-borne pathogens in reproductive and non-reproductive tissue samples from free-roaming domestic cats in the South Atlantic USA. Pathogens. 2021;10:17. 10.3390/pathogens10091221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Jensen WA, Lappin MR, Kamkar S, Reagan WJ. Use of a polymerase chain reaction assay to detect and differentiate two strains of Haemobartonella felis in naturally infected cats. Am J Vet Res. 2001;62:604–8. 10.2460/ajvr.2001.62.604. [DOI] [PubMed] [Google Scholar]
  • 25.Persichetti MF, Solano-Gallego L, Serrano L, Altet L, Reale S, Masucci M, et al. Detection of vector-borne pathogens in cats and their ectoparasites in southern Italy. Parasit Vectors. 2016;9:7. 10.1186/s13071-016-1534-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Manvell C, Berman H, Callahan B, Breitschwerdt E, Swain W, Ferris K, et al. Identification of microbial taxa present in Ctenocephalides felis (cat flea) reveals widespread co-infection and associations with vector phylogeny. Parasit Vectors. 2022;5:17. 10.1186/s13071-022-05487-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Hornok S, Meli ML, Perreten A, Farkas R, Willi B, Beugnet F, et al. Molecular investigation of hard ticks (Acari: Ixodidae) and fleas (Siphonaptera: Pulicidae) as potential vectors of rickettsial and mycoplasmal agents. Vet Microbiol. 2010;140:98–104. 10.1016/j.vetmic.2009.07.013. [DOI] [PubMed] [Google Scholar]
  • 28.Assarasakorn S, Veir JK, Hawley JR, Brewer MM, Morris AK, Hill AE, et al. Prevalence of Bartonella species, hemoplasmas, and Rickettsia felis DNA in blood and fleas of cats in Bangkok. Thailand Res Vet Sci. 2012;93:1213–6. 10.1016/j.rvsc.2012.03.015. [DOI] [PubMed] [Google Scholar]
  • 29.Madder M, Day M, Schunack B, Fourie J, Labuschange M, Van Der Westhuizen W, et al. A community approach for pathogens and their arthropod vectors (ticks and fleas) in cats of sub-Saharan Africa. Parasit Vectors. 2022;15:321. 10.1186/s13071-022-05436-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Shaw SE, Kenny MJ, Tasker S, Birtles RJ. Pathogen carriage by the cat flea Ctenocephalides felis (Bouche) in the United Kingdom. Vet Microbiol. 2004;102:183–8. 10.1016/j.vetmic.2004.06.013. [DOI] [PubMed] [Google Scholar]
  • 31.Lappin MR, Griffin B, Brunt J, Riley A, Burney D, Hawley J, et al. Prevalence of Bartonella species, haemoplasma species, Ehrlichia species, Anaplasma phagocytophilum, and Neorickettsia risticii DNA in the blood of cats and their fleas in the United States. J Feline Med Surg. 2006;8:85–90. 10.1016/j.jfms.2005.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Martínez-Díaz VL, Silvestre-Ferreira AC, Vilhena H, Pastor J, Francino O, Altet L. Prevalence and co-infection of haemotropic mycoplasmas in Portuguese cats by real-time polymerase chain reaction. J Feline Med Surg. 2013;15:879–85. 10.1177/1098612X13480985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Abdullah S, Helps C, Tasker S, Newbury H, Wall R. Pathogens in fleas collected from cats and dogs: Distribution and prevalence in the UK. Parasit Vectors. 2019;12:1–10. 10.1186/s13071-019-3326-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Peters IR, Helps CR, Willi B, Hofmann-Lehmann R, Tasker S. The prevalence of three species of feline haemoplasmas in samples submitted to a diagnostics service as determined by three novel real-time duplex PCR assays. Vet Microbiol. 2008;126:142–50. 10.1016/j.vetmic.2007.06.017. [DOI] [PubMed] [Google Scholar]
  • 35.Mifsud M, Takacs N, Gyurkovszky M, Solymosi N, Farkas R. Detection of flea-borne pathogens from cats and fleas in a Maltese shelter. Vector Borne Zoonotic Dis. 2020;20:529–34. 10.1089/vbz.2019.2553. [DOI] [PubMed] [Google Scholar]
  • 36.Azrizal-Wahid N, Sofian-Azirun M, Low VL. Flea-borne pathogens in the cat flea Ctenocephalides felis and their association with mtDNA diversity of the flea host. Comp Immunol Microbiol Infect Dis. 2021;75:9. 10.1016/j.cimid.2021.101621. [DOI] [PubMed] [Google Scholar]
  • 37.Criado-Fornelio A, Martinez-Marcos A, Buling-Saraña A, Barba-Carretero JC. Presence of Mycoplasma haemofelis, Mycoplasma haemominutum and piroplasmids in cats from southern Europe: a molecular study. Vet Microbiol. 2003;93:307–17. 10.1016/S0378-1135(03)00044-0. [DOI] [PubMed] [Google Scholar]
  • 38.Zarea AAK, Bezerra-Santos MA, Nguyen V, Colella V, Dantas-Torres F, Halos L, et al. Occurrence and bacterial loads of Bartonella and haemotropic Mycoplasma species in privately owned cats and dogs and their fleas from East and Southeast Asia. Zoonoses Public Health. 2022;69:17. 10.1111/zph.12959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tasker S, Peters IR, Mumford AD, Day MJ, Gruffydd-Jones TJ, Day S, et al. Investigation of human haemotropic Mycoplasma infections using a novel generic haemoplasma qPCR assay on blood samples and blood smears. J Med Microbiol. 2010;59:1285–92. 10.1099/jmm.0.021691-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Díaz-Regañón D, Villaescusa A, Ayllón T, Rodríguez-Franco F, García-Sancho M, Agulla B, et al. Epidemiological study of hemotropic Mycoplasmas (hemoplasmas) in cats from central Spain. Parasit Vectors. 2018;11:9. 10.1186/s13071-018-2740-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Munhoz AD, Simões IGPC, Calazans APF, Macedo LS, Cruz RDS, Lacerda LC, et al. Hemotropic mycoplasmas in naturally infected cats in Northeastern Brazil. Rev Bras Parasitol Vet. 2018;27:446–54. 10.1590/s1984-296120180074. [DOI] [PubMed] [Google Scholar]
  • 42.Tasker S, Peters IR, Day MJ, Willi B, Hofmann-Lehmann R, Gruffydd-Jones TJ, et al. Distribution of Mycoplasma haemofelis in blood and tissues following experimental infection. Microb Pathog. 2009;47:334–40. 10.1016/j.micpath.2009.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wolf-Jäckel GA, Cattori V, Geret CP, Novacco M, Meli ML, Riond B, et al. Quantification of the humoral immune response and hemoplasma blood and tissue loads in cats coinfected with ‘Candidatus Mycoplasma haemominutum’ and feline leukemia virus. Microb Pathog. 2012;53:74–80. 10.1016/j.micpath.2012.05.003. [DOI] [PubMed] [Google Scholar]
  • 44.Lawrence AL, Webb CE, Clark NJ, Halajian A, Mihalca AD, Miret J, et al. Out-of-Africa, human-mediated dispersal of the common cat flea, Ctenocephalides felis: The hitchhiker’s guide to world domination. Int J Parasitol. 2019;49:321–36. 10.1016/j.ijpara.2019.01.001. [DOI] [PubMed] [Google Scholar]
  • 45.Latrofa MS, Iatta R, Toniolo F, Furlanello T, Ravagnan S, Capelli G, et al. A molecular survey of vector-borne pathogens and haemoplasmas in owned cats across Italy. Parasit Vectors. 2020;13:116. 10.1186/s13071-020-3990-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tanahara M, Miyamoto S, Nishio T, Yoshii Y, Sakuma M, Sakata Y, et al. An epidemiological survey of feline hemoplasma infection in Japan. J Vet Med Sci. 2010;72:1575–81. 10.1292/jvms.10-0143. [DOI] [PubMed] [Google Scholar]
  • 47.Sato S, Kabeya H, Negishi A, Tsujimoto H, Nishigaki K, Endo Y, et al. Molecular survey of Bartonella henselae and Bartonella clarridgeiae in pet cats across Japan by species-specific nested-PCR. Epidemiol Infect. 2017;145:2694–700. 10.1017/S0950268817001601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Silaghi C, Knaus M, Rapti D, Kusi I, Shukullari E, Hamel D, et al. Survey of Toxoplasma gondii and Neospora caninum, haemotropic mycoplasmas and other arthropod-borne pathogens in cats from Albania. Parasit Vectors. 2014;7:62. 10.1186/1756-3305-7-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Tasker S, Braddock JA, Baral R, Helps CR, Day MJ, Gruffydd-Jones TJ, et al. Diagnosis of feline haemoplasma infection in Australian cats using a real-time PCR assay. J Feline Med Surg. 2004;6:345–54. 10.1016/j.jfms.2003.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.André MR, Baccarim Denardi NC, Marques De Sousa KC, Gonçalves LR, Henrique PC, Grosse Rossi Ontivero CR, et al. Arthropod-borne pathogens circulating in free-roaming domestic cats in a zoo environment in Brazil. Ticks Tick Borne Dis. 2014. 10.1016/j.ttbdis.2014.03.011. [DOI] [PubMed] [Google Scholar]
  • 51.Bortoli CPD, André MR, Seki MC, Pinto AA, Machado SDTZ, Machado RZ. Detection of hemoplasma and Bartonella species and co-infection with retroviruses in cats subjected to a spaying/neutering program in Jaboticabal, SP. Brazil Rev Bras Parasitol Vet. 2012;21:219–23. 10.1590/S1984-29612012000300008. [DOI] [PubMed] [Google Scholar]
  • 52.Melo TBD, Silva TRM, Almeida TLACD, Tutija JF, Silva AOD, Lira MDS, et al. Molecular detection of vector-borne pathogens in cats tested for FIV and FeLV. Vet Parasitol Reg Stud Reports. 2023. 10.1016/j.vprsr.2023.100857. [DOI] [PubMed] [Google Scholar]
  • 53.Macieira DB, De Menezes RDCAA, Damico CB, Almosny NRP, McLane HL, Daggy JK, et al. Prevalence and risk factors for hemoplasmas in domestic cats naturally infected with feline immunodeficiency virus and/or feline leukemia virus in Rio de Janeiro—Brazil. J Feline Surg Med. 2008;10:120–9. 10.1016/j.jfms.2007.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Santis ACGAD, Herrera HM, Sousa KCMD, Gonçalves LR, Denardi NCB, Domingos IH, et al. Molecular detection of hemotrophic mycoplasmas among domiciled and free-roaming cats in Campo Grande, state of Mato Grosso do Sul Brazil. Rev Bras Parasitol Vet. 2014;23:231–6. 10.1590/S1984-29612014039. [DOI] [PubMed] [Google Scholar]
  • 55.Yamakawa AC, Haisi A, Kmetiuk LB, Pellizzaro M, Mendes JCR, Canavessi AMO, et al. Molecular detection of feline hemoplasmas and retroviruses in free-roaming and shelter cats within a university campus. JFMS Open Rep. 2023;9:205511692211486. 10.1177/20551169221148672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Gourkow N, Lawson JH, Hamon SC, Phillips CJC. Descriptive epidemiology of upper respiratory disease and associated risk factors in cats in an animal shelter in coastal western Canada. Can Vet J. 2013;54:132–8. [PMC free article] [PubMed] [Google Scholar]
  • 57.Nibblett BMD, Waldner C, Taylor SM, Jackson ML, Knorr LM, Snead EC. Hemotropic Mycoplasma prevalence in shelter and client-owned cats in Saskatchewan and a comparison of polymerase chain reaction (PCR)—Results from two independent laboratories. Can J Vet Res. 2009;74:91–6. [PMC free article] [PubMed] [Google Scholar]
  • 58.Stojanovic V, Foley P. Infectious disease prevalence in a feral cat population on Prince Edward Island. Canada Can Vet J. 2011;52:979–82. [PMC free article] [PubMed] [Google Scholar]
  • 59.Walker Vergara R, Morera Galleguillos F, Gómez Jaramillo M, Pereira Almosny NR, Arauna Martínez P, Grob Behne P, et al. Prevalence, risk factor analysis, and hematological findings of hemoplasma infection in domestic cats from Valdivia, Southern Chile. Comp Immunol Microbiol Infect Dis. 2016;46:20–6. 10.1016/j.cimid.2016.03.004. [DOI] [PubMed] [Google Scholar]
  • 60.Zhang Y, Zhang Z, Lou Y, Yu Y. Prevalence of hemoplasmas and Bartonella species in client-owned cats in Beijing and Shainghai China. J Vet Med Sci. 2021. 10.1292/jvms.20-0681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Attipa C, Papasouliotis K, Solano-Gallego L, Baneth G, Nachum-Biala Y, Sarvani E, et al. Prevalence study and risk factor analysis of selected bacterial, protozoal, and viral, including vector-borne, pathogens in cats from Cyprus. Parasit Vectors. 2017;10:130. 10.1186/s13071-017-2063-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Rosenqvist MB, Meilstrup A-KH, Larsen J, Olsen JE, Jensen AL, Thomsen LE. Prevalence of feline haemoplasma in cats in Denmark. Acta Vet Scand. 2016. 10.1186/s13028-016-0260-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Levy JK, Crawford PC, Lappin MR, Dubovi EJ, Levy MG, Alleman R, et al. Infectious diseases of dogs and cats on Isabela Island Galapagos. J Vet Intern Med. 2008;22:60–5. 10.1111/j.1939-1676.2007.0034.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Zarea AAK, Tempesta M, Fouad EA, Ndiana LA, Mahmoud MS, Mrenoshki D, et al. Prevalence of Bartonella spp., haemotropic Mycoplasma spp. and others vector-borne pathogens in private-owned dogs and cats, Egypt. Acta Trop. 2023. 10.1016/j.actatropica.2023.106857. [DOI] [PubMed] [Google Scholar]
  • 65.Bauer N, Balzer HJ, Thüre S, Moritz A. Prevalence of feline haemotropic mycoplasmas in convenience samples of cats in Germany. J Feline Med Surg. 2008;10:252–8. 10.1016/j.jfms.2007.12.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Mylonakis ME, Schreeg M, Chatzis MK, Pearce J, Marr HS, Saridomichelakis MN, et al. Molecular detection of vector-borne pathogens in Greek cats. Ticks Tick Borne Dis. 2018;9:171–5. 10.1016/j.ttbdis.2017.08.013. [DOI] [PubMed] [Google Scholar]
  • 67.Maher IE, Tasker S, Polizopoulou Z, Dasopoulou A, Egan K, Helps CR, et al. Polymerase chain reaction survey of feline haemoplasma infections in Greece. J Feline Med Surg. 2010;12:601–5. 10.1016/j.jfms.2010.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Ghazisaeedi F, Atyabi N, Zahrai Salehi T, Gentilini F, Ashrafi Tamai I, Akbarein H, et al. A molecular study of hemotropic mycoplasmas (hemoplasmas) in cats in Iran. Vet Clin Pathol. 2014;43:381–6. 10.1111/vcp.12166. [DOI] [PubMed] [Google Scholar]
  • 69.Juvet F, Lappin MR, Brennan S, Mooney CT. Prevalence of selected infectious agents in cats in Ireland. J Feline Med Surg. 2010;12:476–82. 10.1016/j.jfms.2010.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Gentilini F, Novacco M, Turba ME, Willi B, Bacci ML, Hofmann-Lehmann R. Use of combined conventional and real-time PCR to determine the epidemiology of feline haemoplasma infections in northern Italy. J Feline Med Surg. 2009;11:277–85. 10.1016/j.jfms.2008.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Ravagnan S, Carli E, Piseddu E, Da Rold G, Porcellato E, Zanardello C, et al. Prevalence and molecular characterization of canine and feline hemotropic mycoplasmas (hemoplasmas) in northern Italy. Parasit Vectors. 2017;10:132. 10.1186/s13071-017-2069-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Spada E, Proverbio D, Galluzzo P, Della Pepa A, Bagnagatti De Giorgi G, Perego R, et al. Prevalence of Haemoplasma infections in stray cats in Northern Italy. ISRN Microbiology. 2014. 10.1155/2014/298352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Inokuma H, Taroura S, Okuda M, Hisasue M, Itamoto K, Une S, et al. Molecular survey of Mycoplasma haemofelis and ‘Candidatus Mycoplasma haemominutum’ infection in cats in Yamaguchi and surrounding areas. J Vet Med Sci. 2004;66:1017–20. 10.1292/jvms.66.1017. [DOI] [PubMed] [Google Scholar]
  • 74.Fujihara M, Watanabe M, Yamada T, Harasawa R. Occurrence of ‘Candidatus Mycoplasma turicensis’ infection in domestic cats in Japan. J Vet Med Sci. 2007;69:1061–3. 10.1292/jvms.69.1061. [DOI] [PubMed] [Google Scholar]
  • 75.Jenkins KS, Dittmer KE, Marshall JC, Tasker S. Prevalence and risk factor analysis of feline haemoplasma infection in New Zealand domestic cats using a real-time PCR assay. J Feline Med Surg. 2013;15:1063–9. 10.1177/1098612X13488384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Duarte A, Marques V, Correia JHD, Neto I, Bráz BS, Rodrigues C, et al. Molecular detection of haemotropic Mycoplasma species in urban and rural cats from Portugal. J Feline Med Surg. 2015;17:516–22. 10.1177/1098612X14550172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Alho AM, Lima C, Latrofa MS, Colella V, Ravagnan S, Capelli G, et al. Molecular detection of vector-borne pathogens in dogs and cats from Qatar. Parasit Vectors. 2017;10:298. 10.1186/s13071-017-2237-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Imre M, Văduva C, Dărăbuș G, Morariu S, Herman V, Plutzer J, et al. Molecular detection of hemotropic mycoplasmas (hemoplasmas) in domestic cats (Felis catus) in Romania. BMC Vet Res. 2020;16:399. 10.1186/s12917-020-02626-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Demkin VV, Kazakov AA. Prevalence of hemotropic mycoplasmas and coinfection with feline leukemia virus and feline immunodeficiency virus in cats in the Moscow region, Russia. Prev Vet Med. 2021;190:105339. 10.1016/j.prevetmed.2021.105339. [DOI] [PubMed] [Google Scholar]
  • 80.Alanazi AD, Alouffi AS, Alyousif MS, Alshahrani MY, Abdullah HHAM, Abdel-Shafy S, et al. Molecular survey of vector-borne pathogens of dogs and cats in two regions of Saudi Arabia. Pathogens. 2020;10:11. 10.3390/pathogens10010025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Lobetti R, Lappin MR. Prevalence of Toxoplasma gondii, Bartonella species and haemoplasma infection in cats in South Africa. J Feline Med Surg. 2012;14:857–62. 10.1177/1098612X12452495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Hwang J, Gottdenker N, Min M-S, Lee H, Chun M-S. Evaluation of biochemical and haematological parameters and prevalence of selected pathogens in feral cats from urban and rural habitats in South Korea. J Feline Med Surg. 2016;18:443–51. 10.1177/1098612X15587572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Álvarez-Fernández A, Maggi R, Martín-Valls GE, Baxarias M, Breitschwerdt EB, Solano-Gallego L. Prospective serological and molecular cross-sectional study focusing on Bartonella and other blood-borne organisms in cats from Catalonia (Spain). Parasit Vectors. 2022;15:6. 10.1186/s13071-021-05105-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Roura X, Peters IR, Altet L, Tabar MD, Barker EN, Planellas M, et al. Prevalence of hemotropic mycoplasmas in healthy and unhealthy cats and dogs in Spain. J Vet Diagn Invest. 2010;22:270–4. 10.1177/104063871002200219. [DOI] [PubMed] [Google Scholar]
  • 85.Do T, Kamyingkird K, Bui LK, Inpankaew T. Genetic characterization and risk factors for feline hemoplasma infection in semi-domesticated cats in Bangkok, Thailand. Vet World. 2020. 10.14202/vetworld.2020.975-980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Kaewmongkol S, Lakhana N, Sirinarumitr T, Fenwick SG, Kaewmongkol G. Investigation of hemotropic Mycoplasma spp. genotypes in client-owned cats in Thailand. Vet Microbiol. 2020. 10.1016/j.vetmic.2020.108765. [DOI] [PubMed] [Google Scholar]
  • 87.Suksai P, Sangkachai N, Chatsiriwech J, Kanthasaewee O, Sariya L, Chaichoun K. Development of multiplex polymerase chain reaction for detection of feline hemotropic mycoplasma in blood and tissue specimens. Southeast Asian J Trop Med Public Health. 2010;41:1447–53. [PubMed] [Google Scholar]
  • 88.Cetinkaya H, Haktanir D, Arun S, Vurusaner C. Molecular detection and prevalence of feline hemotropic mycoplasmas in Istanbul, Turkey. Acta Parasitol. 2016. 10.1515/ap-2016-0022. [DOI] [PubMed] [Google Scholar]
  • 89.Muz MN, Erat S, Mumcuoglu KY. Protozoan and microbial pathogens of house cats in the province of Tekirdag in Western Turkey. Pathogens. 2021;10:1114. 10.3390/pathogens10091114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Georges K, Ezeokoli C, Auguste T, Seepersad N, Pottinger A, Sparagano O, et al. A comparison of real-time PCR and reverse line blot hybridization in detecting feline haemoplasmas of domestic cats and an analysis of risk factors associated with haemoplasma infections. BMC Vet Res. 2012;8:103. 10.1186/1746-6148-8-103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Willi B, Tasker S, Boretti FS, Doherr MG, Cattori V, Meli ML, et al. Phylogenetic analysis of ‘Candidatus Mycoplasma turicensis’ isolates from pet cats in the United Kingdom, Australia, and South Africa with analysis of risk factors for infection. J Clin Microbiol. 2006;44:4430–5. 10.1128/JCM.00987-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Eberhardt JM, Neal K, Shackelford T, Lappin MR. Prevalence of selected infectious disease agents in cats from Arizona. J Feline Med Surg. 2006;8:164–8. 10.1016/j.jfms.2005.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Beatty JA, Troyer RM, Carver S, Barrs VR, Espinasse F, Conradi O, et al. Felis catus gammaherpesvirus 1; a widely endemic potential pathogen of domestic cats. Virology. 2014;460–461:100–7. 10.1016/j.virol.2014.05.007. [DOI] [PubMed] [Google Scholar]
  • 94.Levy JK, Lappin MR, Glaser AL, Birkenheuer AJ, Anderson TC, Edinboro CH. Prevalence of infectious diseases in cats and dogs rescued following Hurricane Katrina. J Am Vet Med Assoc. 2011;238:311–7. 10.2460/javma.238.3.311. [DOI] [PubMed] [Google Scholar]
  • 95.Bennett AD, Gunn-Moore DA, Brewer M, Lappin MR. Prevalence of Bartonella species, haemoplasmas and Toxoplasma gondii in cats in Scotland. J Feline Med Surg. 2011;13:553–7. 10.1016/j.jfms.2011.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Lawrence AL, Hii SF, Chong R, Webb CE, Traub R, Brown G, et al. Evaluation of the bacterial microbiome of two flea species using different DNA-isolation techniques provides insights into flea host ecology. FEMS Microbiol Ecol. 2015;91:1–11. 10.1093/femsec/fiv134. [DOI] [PubMed] [Google Scholar]
  • 97.Reagan KL, Clarke LL, Hawley JR, Lin P, Lappin MR. Assessment of the ability of Aedes species mosquitoes to transmit feline Mycoplasma haemofelis and ‘Candidatus Mycoplasma haemominutum’. J Feline Med Surg. 2017;19:798–802. 10.1177/1098612X16658317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Pennisi MG, La Camera E, Giacobbe L, Orlandella BM, Lentini V, Zummo S, et al. Molecular detection of Bartonella henselae and Bartonella clarridgeiae in clinical samples of pet cats from Southern Italy. Res Vet Sci. 2010;88:379–84. 10.1016/j.rvsc.2009.11.005. [DOI] [PubMed] [Google Scholar]
  • 99.Dean RS, Helps CR, Jones TJG, Tasker S. Use of real-time PCR to detect Mycoplasma haemofelis and ‘Candidatus Mycoplasma haemominutum’ in the saliva and salivary glands of haemoplasma-infected cats. J Feline Med Surg. 2008;10:413–7. 10.1016/j.jfms.2007.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Flint JC, Roepke MH, Jensen R. Feline infectious anemia. I. clinical aspects. Am J Vet Res. 1958;19:164–8. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data utilized for meta-analysis are available in the supplementary data file.


Articles from Parasites & Vectors are provided here courtesy of BMC

RESOURCES