Skip to main content
Animal Models and Experimental Medicine logoLink to Animal Models and Experimental Medicine
. 2023 Feb 15;7(2):179–188. doi: 10.1002/ame2.12298

Development of RPA‐Cas12a‐fluorescence assay for rapid and reliable detection of human bocavirus 1

Weidong Qian 1, Xuefei Wang 1, Ting Wang 1, Jie Huang 1, Qian Zhang 2, Yongdong Li 3,✉, Si Chen 4,✉
PMCID: PMC11079142  PMID: 36794352

Abstract

Human bocavirus (HBoV) 1 is considered an important pathogen that mainly affects infants aged 6–24 months, but preventing viral transmission in resource‐limited regions through rapid and affordable on‐site diagnosis of individuals with early infection of HBoV1 remains somewhat challenging. Herein, we present a novel faster, lower cost, reliable method for the detection of HBoV1, which integrates a recombinase polymerase amplification (RPA) assay with the CRISPR/Cas12a system, designated the RPA‐Cas12a‐fluorescence assay. The RPA‐Cas12a‐fluorescence system can specifically detect target gene levels as low as 0.5 copies of HBoV1 plasmid DNA per microliter within 40 min at 37°C without the need for sophisticated instruments. The method also demonstrates excellent specificity without cross‐reactivity to non‐target pathogens. Furthermore, the method was appraised using 28 clinical samples, and displayed high accuracy with positive and negative predictive agreement of 90.9% and 100%, respectively. Therefore, our proposed rapid and sensitive HBoV1 detection method, the RPA‐Cas12a‐fluorescence assay, shows promising potential for early on‐site diagnosis of HBoV1 infection in the fields of public health and health care. The established RPA‐Cas12a‐fluorescence assay is rapid and reliable method for human bocavirus 1 detection. The RPA‐Cas12a‐fluorescence assay can be completed within 40 min with robust specificity and sensitivity of 0.5 copies/μl.

Keywords: CRISPR‐Cas12a, detection, human bocavirus 1, on‐site diagnosis, recombinase polymerase amplification


The established RPA‐Cas12a‐fluorescence assay is rapid and reliable method for human bocavirus 1 detection. The RPA‐Cas12a‐fluorescence assay can be completed within 40 min with robust specificity and sensitivity of 0.5 copies/μl.

graphic file with name AME2-7-179-g004.jpg

1. INTRODUCTION

Human bocavirus (HBoV) is a non‐enveloped, icosahedral, and single‐stranded DNA virus belonging to the Parvoviridae family and the Bocaparvovirus genus, which was first identified in human nasopharyngeal specimens in September 2005. 1 Since then, HBoV has been frequently detected worldwide in both respiratory samples collected from children with acute respiratory infection and stool samples collected from patients with gastroenteritis. 2 , 3 , 4 , 5 , 6 Currently, HBoV pathogenicity cannot yet be fully clarified, in part, owing to the scarcity of a suitable in vitro culture system. 6 The situation has worsened further due to the fact that HBoV has been commonly simultaneously detected with other pathogens in respiratory or enteric specimens. 7 , 8 , 9 Notably, in addition to the presence of HBoV in different types of clinical samples, including blood, saliva, feces, and urine, and in environmental specimens, 10 sewage, 11 , 12 , 13 and Bivalve Shellfish, 14 a recent study has reported the potential demonstration of HBoV in transfusion medicine. 15

Currently, HBoV is categorized into four subtypes (HBoV1‐4), among which HBoV2, HBoV3 and HBoV4, are found primarily in human stool samples. 16 , 17 , 18 By contrast, several previous studies have shown prevalence rates of HBoV1 ranging from 1.5% to 33% in individuals with severe respiratory infection. 19 , 20 , 21 , 22 Furthermore, the detection rate of HBoV1 antibodies in serum samples is highly consistent with that of HBoV1 nucleic acid. 22 HBoV1 infection can cause several symptoms, ranging from mild to life‐threatening reproductive tract infections (RTIs). 8 , 22 In addition, HBoV1 can cause respiratory distress, hypoxia, wheezing and other serious respiratory symptoms. 22 , 23 , 24 Unfortunately, to date there is no effective therapeutic or vaccine approved for the management of HBoV1 infection, 25 and thus effective treatment of clinically relevant HBoV1 infections still entails rapid and early identification.

Current methods for diagnosis of HBoV involve immunological tests including enzyme‐linked immunosorbent assay, and molecular diagnostic methods such as polymerase chain reaction (PCR) and real‐time quantitative PCR (qPCR). 26 , 27 , 28 However, the sensitivity of immunological‐based techniques varies since they depend mainly on the production of high‐quality, well‐validated antigen or antibody proteins. Furthermore, the traditional molecular‐based methods for HBoV detection, such as PCR and qPCR, require expensive sophisticated instruments and well‐trained personnel. Therefore, there is an urgent need to establish efficient detection techniques of nucleic acids for use in resource‐limited settings.

Recently, there has been a substantial advance in exploiting isothermal amplification techniques for nucleic acids, such as loop mediated isothermal amplification, 29 nucleic acid sequence‐based amplification 30 and recombinase polymerase amplification (RPA). 31 Among these techniques, RPA has attracted wide attention recently due to its high amplification efficiency at a relatively low temperature. 32 RPA has been widely exploited for the detection of various pathogens and is both a time‐efficient and cost‐effective technique 33 , 34 , 35 , 36 ; nevertheless, RPA suffers from a few inherent flaws. 32 For instance, RPA is less sensitive than qPCR, the gold standard.

The CRISPR/Cas system comprising clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR‐related protein (Cas) has been extensively explored for the diagnosis for infectious pathogens. 37 , 38 , 39 , 40 This system employs the target‐activated, programmable nuclease activity of Cas12a effector, which can be achieved through specific binding of a guide RNA (crRNA) to the target gene. Subsequently, the measurable signal can be mediated by the cleavage activity of the activated Cas12a. 37 , 38 Recently, by integrating it with isothermal nucleic acid amplification techniques, the CRISPR/Cas system can achieve simultaneously excellent simplicity, rapidity, and specificity, and has emerged as a promising technique for pathogen diagnosis, particularly in low‐resource situations. 40 , 41 , 42 For instance, the DETECTR method was created by combining the advantages of both the reverse transcription LMAP assay and the CRISPR/Cas12a system. 38 Since then, the combination strategy has been widely explored to establish diagnostic techniques for detection of various pathogens. 38 , 42

Here, we present a novel detection method for HBoV1 that integrates the RPA assay with the CRISPR/Cas12a system, designated the RPA‐Cas12a‐fluorescence assay, to target the nucleoprotein 1 (NP1) gene of HBoV1 (Figure 1). The RPA‐Cas12a‐fluorescence assay only takes 40 min with a limit of detection of 0.5 copies DNA of HBoV1 per microliter. Real‐time and end‐point fluorescence detection in the RPA‐Cas12a‐fluorescence assay is performed by a fluorescence detector; a positive signal can be observed with the naked eye using a UV illuminator. This newly established method shows promise as a potential method for early on‐site HBoV1 diagnosis.

FIGURE 1.

FIGURE 1

(A) Schematic diagram of the RPA‐Cas12a‐fluorescence assay for HBoV1 detection based on the combination of recombinase polymerase amplification (RPA) and CRISPR/Cas platform. The HBoV1 genomic DNA extracted from clinical samples was first pre‐amplified by RPA into double‐stranded DNA (dsDNA). In the Cas12‐mediated detection assay, the complex of pre‐amplified dsDNA, Cas12a and crRNA enables Cas12a activation, which then cuts the single‐stranded DNA molecules (ssDNA reporter). Finally, visualization of the RPA‐Cas12a‐fluorescence assay results is achieved by fluorescence and naked eye readouts. (B) and (C) Visualization of primers and probe for RPA (B) and crRNA spacer sites (C) within the target nucleoprotein 1 (NP1) gene of the HBoV1 genome. RPA primers, probe and crRNA are indicated by red, yellow and blue colored text, respectively.

2. METHODS

2.1. Clinical samples

Twenty‐two clinical samples (<30 Ct) were confirmed to be HBoV1‐positive based on a previously described method, 43 collected from patients with respiratory symptoms, and 6 samples diagnosed as HBoV1‐negative were employed as the negative control. All the samples were collected by Ningbo Municipal Center for Disease Control and Prevention (NCDC) between February, 2016 and December, 2019.

2.2. Preparation of DNA standard template

Five published genome sequences of HBoV1 (JN632495.1, MG953830.1, LC651175.1, OL519569.1, and KJ634207.1) were obtained from GenBank and aligned using MEGA X. Sequence comparison analysis of the HBoV1 genome demonstrated that the gene segment of nuclear protein 1 (NP1), ranging from 2490 to 2829 bp, is highly conserved, and therefore NP1 was determined as the target (Figure 1B,C). The conserved DNA fragments for the NP1 gene were produced by Sangon Biotech Co., Ltd., and cloned into the pBluescript II SK (+) plasmid to obtain pBluescript‐NP1. pBluscript‐NP1 was then transformed into Escherichia coli TOP10 for the production of recombinant pBluescript‐NP1 and stored at −80°C.

2.3. Primer design and RPA‐basic reactions

One pair of RPA primers and three pairs of oligonucleotides for production of crRNA targeting the conserved region of the NP1 gene were designed according to the Assay Design Manual of the TwistAmp™ DNA Amplification Kit, and synthesized by Suzhou GENEWIZ biotech, as listed in Table 1. The basic RPA reaction was carried out using the TwistAmp exo kit (TwistDX), which comprises 25 μl of rehydration buffer, 2 μl of each primer at 10 μM, 5 μl of DNA standard template at a concentration of 102 copies/μl, 13.5 μl of DNase‐free water, and 2.5 μl of magnesium acetate. The reactions were performed in an Axxin T8‐Isothermal Instrument based on the manufacturer's recommendations.

TABLE 1.

The oligonucleotide sequences for primers, crRNA and probe for RPA‐Cas12a‐fluorescence assay of HBoV1.

Assay Oligonucleotide sequences Sequence (5′‐3′) Product size (bp)
RPA HBoV1‐F CTGGCAGACAACTCATCACAGGAGCAGGAG 341
HBoV1‐R CATTATCAATTTGTAGCTGTTGAAACTGTT
HBoV1‐probe GACACAATGGGGAGAGAGGCTCGGGCTCAT(ROX)(THF)T(BHQ1)CATCAGGAACACCC‐block
Cas12a detection HBoV1‐crRNA1‐F GAAATTAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATCCCGATGTACTCTCCCTCGT
HBoV1‐crRNA1‐R ACGAGGGAGAGTACATCGGGATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC
HBoV1‐crRNA2‐F GAAATTAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATCAATGCGAGTAGAGTGCCAG
HBoV1‐crRNA2‐R CTGGCACTCTACTCGCATTGATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC
HBoV1‐crRNA3‐F GAAATTAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATAAACTGTTGTTTCATTTCAT
HBoV1‐crRNA3‐R ATGAAATGAAACAACAGTTTATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTAATTTC
ssDNA reporter‐FB 6‐FAM‐TTATTATT‐BHQ1

2.4. Sensitivity and specificity of RPA‐fluorescence assay

The RPA‐fluorescence assay was performed using the basic RPA reaction with the addition of 1 μl HBoV1‐probe (10 μM) (Table 1). The limit of detection of the RPA‐fluorescence assay was determined using a serial diluted recombinant DNA plasmid containing the target gene fragment ranging from 0.05 to 1000 copies/μl as the template. The specificity of the RPA‐fluorescence assay was established using genomic DNA or cDNA from HBoV1, human metapneumovirus (HmPV), adenovirus (ADV), and norovirus (NOV), as well as Candida albicans SC154 and Escherichia coli ATCC25922 as the template samples. The viral genomic DNA and RNA were extracted from 150 μl aliquots of the samples using the QIAampMinElute Virus Spin kit (Qiagen). The total RNA was reverse transcribed into cDNA products using the SuperScript III First‐Strand Synthesis System (Invitrogen). The genomic DNA and cDNA products were used to examine the specificity of the RPA‐fluorescence assay. An HBoV1‐specific probe (λex: 575 nm; λem: 602 nm) was used in the assay. In addition, there were three replicates per reaction, and the experiment was conducted three times.

2.5. crRNA preparation

For preparation of in vitro‐transcribed crRNA, three pairs of oligonucleotides were first annealed to produce the double‐stranded DNA (dsDNA) using the annealing buffer. The dsDNA was then transcribed into crRNA using the HiScribeTM T7 In Vitro Transcription Kit (NEB). 44 In vitro‐transcribed crRNA was further treated with DNase I to fully digest untranscribed dsDNA. Subsequently, crRNA concentrations were measured by B‐500 Biophotometer (Metash Instruments).

2.6. Screening of optimal crRNA for RPA‐Cas12a‐fluorescence assay

The basic RPA assay was carried out using the the TwistAmp exo kit as described above. The resulting RPA products were examined with the CRISPR/Cas12a system. The collateral cleavage assay mediated by Cas12a was carried out according to previous reports. 41 , 44 Briefly, 2 μl of 1000 nM Cas12a (NEB, Ipswich, Massachusetts, USA), 5 μl of 10 × NEB buffer 2.1, 2 μl of 1000 nM crRNA, 2 μl of 1000 nM ssDNA reporter‐FB, 34 μl of DNase‐free and RNase‐free water and 5 μl of RPA products were mixed in a microcentrifuge tube, and incubated for 20 min at 37°C in the preheated Axxin T8 isothermal instrument. During the reaction, fluorescent signals were collected every 10 s with ssDNA reporter‐FB (λex: 494 nm; λem: 517 nm) as the substrates. In addition, fluorescent signals were visualized by eye using a UV light illuminator. In this study, the optimal crRNA for the RPA‐Cas12a‐fluorescence assay was determined by assessing the intensity of fluorescent signal.

2.7. Sensitivity and specificity of RPA‐Cas12a‐fluorescence assay

To determine the sensitivity of RPA‐Cas12a‐fluorescence assay, a concentration gradient of DNA standard samples with specific concentration values ranging from 0.05 to 100 copies/μl, was employed as the template. To examine the specificity of the RPA‐Cas12a‐fluorescence assay, DNA or cDNA samples of other respiratory viruses or pathogens at a concentration of 100 copies/μl, including HBoV1, HmPV, NOV, ADV, C. albicans SC5314 and E. coli ATCC25922, were employed in this study. The resulting RPA products were further examined using the Cas12a‐mediated detection assay. Each reaction process was replicated three times and the results were evaluated by fluorescence.

2.8. qPCR assay

A qPCR assay was used to diagnose HBoV1 using the HBoV detection kit and an ABI 7500 Real‐Time PCR System (Applied Biosystems). The reaction sequence involved an initial incubation at 48 °C for 3 min, then 95°C for 10 min, 35 cycles of 95°C for 30 s, 60°C for 30 s and finally 72°C for 30 s.

2.9. Statistical analysis

For group comparison, statistical analysis was performed using the GraphPad‐Prism 8. Analysis of variance was performed to determine any significant difference (p ≤ 0.05).

3. RESULTS

3.1. Sensitivity and specificity of RPA‐fluorescence assay

The sensitivity of RPA‐fluorescence assay evaluated using a serial dilution of DNA standard

template is shown in Figure 2A. The limit of detection of the RPA‐fluorescence assay was excellent, with a relatively low concentration of 1 × 102 copies/μl. The fluorescence intensities could be evaluated in parallel using real‐time, end‐point fluorescence measurement, and conventional evaluation using a UV light illuminator, and were all identical (Figure 2B,C). The specificity of RPA‐fluorescence assay assessed using various templates is shown in Figure 2D. The primers of RPA and HBoV1‐probe targeting NP1 gene sequence were highly specific for HBoV1 without cross‐reactivity with other pathogens tested. There was a significant difference in the fluorescence intensities between the HBoV1 template and other samples at 30 min (Figure 2E). Similarly, fluorescence was observed by the naked eye under a UV light illuminator (Figure 2F). However, the sensitivity of the RPA‐fluorescence assay was less than that of qPCR, and thus the assay was further improved by combining with the Cas12a‐mediated cascade detection method.

FIGURE 2.

FIGURE 2

(A)–(C) Sensitivity analysis of the RPA‐fluorescence assay for HBoV1 detection. The sensitivity of the RPA‐fluorescence assay was performed using HBoV1 standard DNA in a gradient concentration ranging from 0.05 to 1000 copies/μl with the HBoV1‐probe. The outputs of the RPA‐fluorescence assay for HBoV1 detection were achieved using real‐time (A) and end‐point (B) fluorescence using a fluorescence detector and by naked eye observation under a UV illuminator (C). The end‐point fluorescence intensities generated by RPA‐fluorescence assay were separately collected at 10, 20 and 30 min. Three replicates were conducted for each sample. Error bars indicate the standard deviations of three replicates (n = 3). Statistical analysis was applied to determine the difference between detection and negative control groups at corresponding time points. ***p < 0.001, ****p < 0.0001. NC, negative control. (D)–(F) Specificity analysis of RPA‐fluorescence assay for HBoV1 detection. The specificity of RPA‐fluorescence assay for the detection of HBoV1 with the HBoV1‐probe was examined using genomic DNA extracted from HBoV1, Candida albicans SC5314 or Escherichia coli ATCC25922, and cDNA products of common respiratory viral pathogens. The results of the RPA‐fluorescence assay were obtained using real‐time (D) and end‐point (E) fluorescence intensities using a fluorescence detector or by naked eye observation under a UV illuminator (F). Error bars represent the standard deviations of three replicates (n = 3). Statistical analysis was used to determine the difference between detection groups and negative controls (****p < 0.0001). NC, negative control.

3.2. Screening of optimal crRNA for RPA‐Cas12a‐fluorescence assay

To achieve the optimal crRNA, the RPA‐Cas12a‐fluorescence assay was performed with a standard DNA template and each crRNA. As presented in Figure 3A, the predicted fluorescence signals of each reaction were visible; nevertheless, with a combination of equal proportions of HBoV1‐crRNA1 and HBoV1‐crRNA3 the fluorescence intensity reached a plateau after only approximately 7 min, indicating the high detection efficiency mediated by this combination. Similar results were observed in an examination of end‐point fluorescence values; Figure 3B shows that there was a significant difference between the fluorescence intensities of the Cas12a reactions induced by HBoV1‐crRNA1, HBoV1‐crRNA2, HBoV1‐crRNA3 or their combinations and the negative control after 5 min of Cas12a‐mediated reaction; however, the combination of HBoV1‐crRNA1 and HBoV1‐crRNA3 in equal proportion produced the most‐intense fluorescence. Moreover, Figure 3C shows that a crRNA‐mediated appearance of a strong red fluorescence was observed for the combined HBoV1‐crRNA1 and HBoV1‐crRNA3‐treated group using the naked eye under a UV light illuminator. Therefore, the combination of HBoV1‐crRNA1 and HBoV1‐crRNA3 was used for subsequent RPA‐Cas12a‐fluorescence assays.

FIGURE 3.

FIGURE 3

Screening of optimal crRNA for the RPA‐Cas12a‐fluorescence assay for HBoV1 detection. (A) and (B) Real‐time (A), and end‐point (B) fluorescence readouts from the RPA‐Cas12a‐fluorescence assay based on RPA products were obtained after incubation with various crRNAs or a combination of crRNAs for 5 min at 37°C. (C), Visualization of RPA‐Cas12a‐fluorescence detection assay results under a UV light. Error bars represent the standard deviations of three replicates (n = 3). Statistical analysis was used to determine the difference between test groups and negative controls. **p < 0.05, ***p < 0.001, ****p < 0.0001. NC, negative control.

3.3. Sensitivity and specificity of RPA‐Cas12a‐fluorescence assay

As demonstrated in Figure 4A, a gradual increase in the standard DNA concentration in the RPA‐Cas12a‐fluorescence assay resulted in continuous fluorescence signal enhancement. Figure 4A–C shows clearly that the RPA‐Cas12a‐fluorescence assay could consistently achieve a limit of detection of 0.5 copies/μl of HBoV1 standard DNA using both real‐time and end‐point fluorescence measurement.

FIGURE 4.

FIGURE 4

(A)–(C) Sensitivity analysis of the RPA‐Cas12a‐fluorescence assay. An increase in the fluorescence signal from 0.5 to 100 copies/reaction using real‐time (A) and end‐point (B) fluorescence intensity readouts was observed, while a color shift between 0.5 or higher and 0.1 or lower copies/reaction was visualized by the naked eye (C). Error bars indicate the standard deviations of three replicates (n = 3). Statistical analysis was employed to determine the difference between detection groups and the negative control at the corresponding time point. ****p < 0.0001. NC, negative control. (D)–(F) Specificity analysis of RPA‐Cas12a‐fluorescence assay. The specificity of the developed RPA‐fluorescence assay for the detection of HBoV1 was examined using genomic DNA extracted from HBoV1, Candida albicans SC5314 or Escherichia coli ATCC25922, or cDNA products of common respiratory viral pathogens as the template. HBoV1 produced greater amplification of intensity signals using real‐time (D) and end‐point (E) fluorescence readouts and naked eye observation (F) compared with the other viral, C. albicans SC5314 or E. coli ATCC25922 samples and the negative control. Error bars indicate the standard deviations of three replicates (n = 3). Statistical analysis was employed to determine the difference between detection groups to negative control. ****p < 0.001. NC, negative control.

Next, the specificity of the RPA‐Cas12a‐fluorescence assay was assessed using other pathogen DNA or cDNA samples. As shown in Figure 4D, the real‐time fluorescence data from the RPA‐Cas12a‐fluorescence assay delivered a high specific capability without cross‐reactivity with non‐HBoV1 targets, that could be detected within 30 min. Figure 4E clearly shows that the RPA‐Cas12a‐fluorescence assay was capable of highly efficient and specific detection of HBoV1 by comparing end‐point fluorescence values after 30 min of detection reaction. Similarly, our RPA‐Cas12a‐fluorescence assay yielded an easy‐to‐observe visual readout for detecting the presence or absence of a target DNA using the naked eyes (Figure 4F).

3.4. Comparison of qPCR results and RPA‐Cas12‐fluorescence assay results with clinical samples

Twenty‐eight genomic samples were tested to compare the results of both qPCR and the RPA‐Cas12a‐fluorescence assay. As shown in Table 2, the results from our RPA‐Cas12a‐fluorescence readouts were highly consonant with those obtained with the qPCR method for detection of HBoV1 in 22 positive samples. The positive predictive agreement of the RPA‐Cas12a‐fluorescence assay with qPCR was 90.9%, while the negative predictive agreement was 100%.

TABLE 2.

Comparison of clinical sample results between RPA‐Cas12a‐fluorescence assay and qPCR for HBoV1

Assay Amount of samples Detection coincidence rate
Positive Negative Total
RPA‐Cas12a‐fluorescence assay 20 8 28 90.9%
qPCR 22 6 28

4. DISCUSSION

HBoV1 is predominantly found to be a respiratory pathogen causing mild to life‐threatening acute respiratory tract infections, particularly in children and immunocompromised individuals. According to epidemiological studies based on nucleic acid‐based methods, the detection rate of HBoV1 in children with symptoms of RTIs is between 1.6% and 21.5%, typically during winter and spring. 45 Among individuals positive for HBoV1, there is a significant association with between HBoV1 viral load and severe illness, including unspecified severe lower RTIs, encephalitis, and community‐acquired pneumonia. The wide distribution of HBoV1 coupled with the clinical symptoms emphasizes the critical need for a prompt and accurate diagnosis of HBoV1 infections. Currently, the reported techniques for the diagnosis of HBoV1 in serum and in nasal samples include serology 28 , 46 and real‐time qPCR, 47 which mainly requires use of a PCR instrument; these techniques are relatively expensive and labor intensive, and are not convenient for use in on‐site detection and resource‐poor circumstances. Recently, the mariPOC test system (ArcDia International Oy Ltd.) provided a rapid alternative for HBoV1 antigen testing, which is an automated and point‐of‐care compatible test; nevertheless, its disadvantage is that the overall sensitivity is lower. 28

In the present study, we first developed an RPA‐fluorescence assay for the detection of HBoV1. Through the alignment of the genome sequence of HBoV1, the conserved region of the NP1 gene was determined as the detection target to identify HBoV1. Both primers and the probe were then designed according to the conserved region of NP1 gene, thus ensuring a high specificity of HBoV1 detection. The sensitivity of our established RPA‐fluorescence was similar to standard qPCR (9 copies/reaction) but without the need for expensive equipment. 26

To further enhance the sensitivity, CRISPR/Cas was introduced into our proposed method as CRISPR/Cas can achieve rapid detection of even a single nucleotide polymorphism (SNP) via a crRNA that specifically recognizes the target DNA region of interest and directs the Cas nuclease to cut DNA reporter molecules. 48 Moreover, several research studies have revealed that the most significant increase in the cutting efficiency of Cas12a mediated by crRNA can be achieved by enhancing the stability of the complex between optimal crRNA and target DNA. In this study, three HBoV1 specific crRNAs targeting different domains of the NP1 gene were designed and evaluated to obtain robust cleavage efficiency induced by the Cas12a‐crRNA‐target DNA complex. Notably, the combined crRNA1–crRNA3‐mediated group elicited the fastest fluorescence response, and the fluorescence signal saturated at approximately 7 min, significantly enhancing detection specificity and speed. To date, several studies have explored optimal crRNAs for Cas12a‐mediated cutting of DNA reporter molecules, but there are no generally recognized principles for the design of optimal crRNAs across different target DNAs. 49 Thus, we speculated that optimization of crRNA is essential to achieve the desired high‐efficiency cutting in the reaction. By optimizing the crRNA and incorporating detection amplification strategies, we developed the RPA‐Cas12a‐fluorescence assay to detect HBoV1, which only takes within 40 min, and can detect HBoV1 DNA at concentrations as low as 0.5 copies/μl.

Next, the specificity analysis showed that only HBoV1 could be detected using both the RPA‐fluorescence and the RPA‐Cas12a‐fluorescence assay, suggesting that the sequences of the RPA primers and crRNA spacer were feasible for high‐specificity detection. The feasibility of this method for the diagnosis of HBoV1 in respiratory secretions samples was then evaluated. The results showed that the RPA‐Cas12a‐fluorescence assay along with naked eye observation could detect HBoV1 in the respiratory samples with an efficiency similar to the qPCR method, with 90.9% positive predictive agreement and 100% negative predictive agreement between the methods. This indicates the robust potential of this assay for on‐site HBoV1 detection.

In this study, the RPA‐Cas12a‐fluorescence assay used liquid‐stable reagents, such as crRNA, non‐specific reporter and Cas12a protein, which increases experimental flexibility and ease‐of‐use. However, the storage of these temperature‐sensitive reagents typically requires freezers, which provide safe and low‐temperature storage conditions, thus highlighting the importance of reliable medical cold chain solutions. 42 Lyophilized reagents can eliminate dependence on cold chain shipping and storage. Thus, stability testing of these reagents for RPA‐CRISPR‐based diagnostics in clinical cohorts needs to be further explored for therapeutic applications.

In conclusion, by integrating the RPA assay with Cas12a detection system, we developed the RPA‐Cas12a‐fluorescence assay, which satisfies the growing demand for high‐speed, flexibility, specificity and sensitivity in HBoV1 identification without the need for sophisticated equipment. The RPA‐Cas12a‐fluorescence assay shows huge potential for the early detection and field‐diagnostics of HBoV1, especially in resource‐limited situations.

AUTHOR CONTRIBUTIONS

WQ, YL and SC designed the study and wrote the paper. XW, JH, TW, and QZ carried out the experiments, and provided revision suggestions. All authors contributed to the article and approved the manuscript.

CONFLICT OF INTEREST

The authors declare that they have no conflict of interest. Qian Zhang is an Editorial Board member of AMEM and a co‐author of this article. To minimize bias, she was excluded from all editorial decision‐making related to the acceptance of this article for publication.

ETHICS STATEMENT

The study was carried out in accordance with ethical standards of Ningbo Municipal Center for Disease Control and Prevention.

ACKNOWLEDGMENTS

This study was supported partially by the Natural Science Foundation of China (No. 81973531), the Fundamental Research Project of Shenzhen Science and Technology Innovation Commission (No. 20200812211704001), the Science and Technology Project of Weiyang District (202208), the Medical Scientific Research Foundation of Guangdong Province (No. A2019502), and the Scientific Research Program Funded by Shaanxi Provincial Education Department (No. 22JC010).

Qian W, Wang X, Wang T, et al. Development of RPA‐Cas12a‐fluorescence assay for rapid and reliable detection of human bocavirus 1. Anim Models Exp Med. 2024;7:179‐188. doi: 10.1002/ame2.12298

Contributor Information

Yongdong Li, Email: liyd@nbcdc.org.cn.

Si Chen, Email: chensi@szu.edu.cn.

REFERENCES

  • 1. Allander T, Tammi MT, Eriksson M, Bjerkner A, Tiveljung‐Lindell A, Andersson B. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci USA. 2005;102:12891‐12896. doi: 10.1073/pnas.0504666102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Tozer SJ, Lambert SB, Whiley DM, et al. Detection of human bocavirus in respiratory, fecal, and blood samples by real‐time PCR. J Med Virol. 2009;81:488‐493. doi: 10.1002/jmv.21409 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Martin ET, Taylor J, Kuypers J, et al. Detection of bocavirus in saliva of children with and without respiratory illness. J Clin Microbiol. 2009;47:4131‐4132. doi: 10.1128/jcm.01508-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Wang K, Wang W, Yan HJ, et al. Correlation between bocavirus infection and humoral response, and co‐infection with other respiratory viruses in children with acute respiratory infection. J Clin Virol. 2010;47:148‐155. doi: 10.1016/j.jcv.2009.11.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Schlaberg R, Ampofo K, Tardif KD, et al. Human bocavirus capsid messenger RNA detection in children with pneumonia. J Infect Dis. 2017;216:688‐696. doi: 10.1093/infdis/jix352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Christensen A, Kesti O, Elenius V, et al. Human Bocaviruses and paediatric infections. Lancet Child Adolescent Health. 2019;3:418‐426. doi: 10.1016/s2352-4642(19)30057-4 [DOI] [PubMed] [Google Scholar]
  • 7. Tong R, Shen LP, Yin WJ, et al. Prevalence of human parvovirus B19, bocavirus, and PARV4 in blood samples from the general population of China and lack of a correlation between parvovirus and hepatitis B Co‐infection. PLoS One. 2013;8:8. doi: 10.1371/journal.pone.0064391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Guido M, Tumolo MR, Verri T, et al. Human bocavirus: current knowledge and future challenges. World J Gastroenterol. 2016;22:8684‐8697. doi: 10.3748/wjg.v22.i39.8684 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Wang HP, Gu JL, Li XN, et al. Broad range detection of viral and bacterial pathogens in bronchoalveolar lavage fluid of children to identify the cause of lower respiratory tract infections. BMC Infect Dis. 2021;21:21. doi: 10.1186/s12879-021-05834-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Hamza IA, Jurzik L, Wilhelm M, Überla K. Detection and quantification of human bocavirus in river water. J Gen Virol. 2009;90:2634‐2637. doi: 10.1099/vir.0.013557-0 [DOI] [PubMed] [Google Scholar]
  • 11. Bibby K, Peccia J. Identification of viral pathogen diversity in sewage sludge by metagenome analysis. Environ Sci Technol. 2013;47:1945‐1951. doi: 10.1021/es305181x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Blinkova O, Rosario K, Li L, et al. Frequent detection of highly diverse variants of cardiovirus, cosavirus, bocavirus, and circovirus in sewage samples collected in the United States. J Clin Microbiol. 2009;47:3507‐3513. doi: 10.1128/jcm.01062-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Hamza H, Leifels M, Wilhelm M, Hamza IA. Relative abundance of human bocaviruses in urban sewage in greater Cairo, Egypt. Food Environ Virol. 2017;9:304‐313. doi: 10.1007/s12560-017-9287-3 [DOI] [PubMed] [Google Scholar]
  • 14. La Rosa G, Purpari G, Guercio A, et al. Detection of human Bocavirus species 2 and 3 in bivalve shellfish in Italy. Appl Environ Microbiol. 2018;84:e02754‐17. doi: 10.1128/aem.02754-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Li HX, He M, Zeng PB, et al. The genomic and seroprevalence of human bocavirus in healthy Chinese plasma donors and plasma derivatives. Transfusion. 2015;55:154‐163. doi: 10.1111/trf.12785 [DOI] [PubMed] [Google Scholar]
  • 16. Kapoor A, Slikas E, Simmonds P, et al. A newly identified bocavirus species in human stool. J Infect Dis. 2009;199:196‐200. doi: 10.1086/595831 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Arthur JL, Higgins GD, Davidson GP, Givney RC, Ratcliff RM. A novel bocavirus associated with acute gastroenteritis in Australian children. PLoS Pathog. 2009;5:5. doi: 10.1371/journal.ppat.1000391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Kapoor A, Simmonds P, Slikas E, et al. Human bocaviruses are highly diverse, dispersed, recombination prone, and prevalent in enteric infections. J Infect Dis. 2010;201:1633‐1643. doi: 10.1086/652416 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Bicer S, Giray T, Col D, et al. Virological and clinical characterizations of respiratory infections in hospitalized children. Ital J Pediatr. 2013;39:39. doi: 10.1186/1824-7288-39-22 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Moreno B, Abrego L, Carrera JP, et al. Detection of human bocavirus type 1 infection in Panamanian children with respiratory illness. J Med Virol. 2016;88:389‐394. doi: 10.1002/jmv.24346 [DOI] [PubMed] [Google Scholar]
  • 21. Li L, Zhu T, Chen ZR, et al. Detection of human bocavirus in nasopharyngeal aspirates versus in broncho‐alveolar lavage fluids in children with lower respiratory tract infections. J Med Virol. 2016;88:211‐215. doi: 10.1002/jmv.24338 [DOI] [PubMed] [Google Scholar]
  • 22. Liu WK, Liu Q, Chen DH, et al. Epidemiology of HBoV1 infection and relationship with meteorological conditions in hospitalized pediatric patients with acute respiratory illness: a 7‐year study in a subtropical region. BMC Infect Dis. 2018;18:18. doi: 10.1186/s12879-018-3225-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Arnott A, Vong S, Rith S, et al. Human bocavirus amongst an all‐ages population hospitalised with acute lower respiratory infections in Cambodia. Influenza Other Respi Viruses. 2013;7:201‐210. doi: 10.1111/j.1750-2659.2012.00369.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Zhou LL, Zheng SY, Xiao QY, et al. Single detection of human bocavirus 1 with a high viral load in severe respiratory tract infections in previously healthy children. BMC Infect Dis. 2014;14:14. doi: 10.1186/1471-2334-14-424 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Kailasan S, Garrison J, Ilyas M, et al. Mapping antigenic epitopes on the human bocavirus capsid. J Virol. 2016;90:4670‐4680. doi: 10.1128/jvi.02998-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Kantola K, Sadeghi M, Antikainen J, et al. Real‐time quantitative PCR detection of four human bocaviruses. J Clin Microbiol. 2010;48:4044‐4050. doi: 10.1128/jcm.00686-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Christensen A, Dollner H, Skanke LH, Krokstad S, Moe N, Nordbø SA. Detection of spliced mRNA from human Bocavirus 1 in clinical samples from children with respiratory tract infections. Emerg Infect Dis. 2013;19:574‐580. doi: 10.3201/eid1904.121775 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Bruning AHL, Susi P, Toivola H, et al. Detection and monitoring of human Bocavirus 1 infection by a new rapid antigen test. New Microbes New Infect. 2016;11:17‐19. doi: 10.1016/j.nmni.2016.01.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Notomi T, Okayama H, Masubuchi H, et al. Loop‐mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28:E63‐E663. doi: 10.1093/nar/28.12.e63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Compton J. Nucleic acid sequence‐based amplification. Nature. 1991;350:91‐92. doi: 10.1038/350091a0 [DOI] [PubMed] [Google Scholar]
  • 31. Piepenburg O, Williams CH, Stemple DL, Armes NA. DNA detection using recombination proteins. PLoS Biol. 2006;4:e204. doi: 10.1371/journal.pbio.0040204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Lobato IM, O'Sullivan CK. Recombinase polymerase amplification: basics, applications and recent advances. Trac‐Trends Anal Chem. 2018;98:19‐35. doi: 10.1016/j.trac.2017.10.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Faye M, Abd El Wahed A, Faye O, et al. A recombinase polymerase amplification assay for rapid detection of rabies virus. Sci Rep. 2021;11:3131. doi: 10.1038/s41598-021-82479-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Abd El Wahed A, Patel P, Maier M, et al. Suitcase lab for rapid detection of SARS‐CoV‐2 based on recombinase polymerase amplification assay. Anal Chem. 2021;93:2627‐2634. doi: 10.1021/acs.analchem.0c04779 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Liang L‐G, Zhu M‐J, He R, et al. Development of a multi‐recombinase polymerase amplification assay for rapid identification of COVID‐19, influenza a and B. J Med Virol. 2022;95:e28. doi: 10.1002/jmv.28139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Wang H, Ding XL, Sun WB, et al. Recombinase polymerase amplification assay for rapid detection of Seneca Valley virus. Anal Biochem. 2022;642:642. doi: 10.1016/j.ab.2022.114564 [DOI] [PubMed] [Google Scholar]
  • 37. Hille F, Charpentier E. CRISPR‐Cas: biology, mechanisms and relevance. Philos Trans R Soc B‐Biol Sci. 2016;371:371. doi: 10.1098/rstb.2015.0496 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Broughton JP, Deng XD, Yu GX, et al. CRISPR‐Cas12‐based detection of SARS‐CoV‐2. Nat Biotechnol. 2020;38:870‐874. doi: 10.1038/s41587-020-0513-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Gootenberg JS, Abudayyeh OO, Kellner MJ, Joung J, Collins JJ, Zhang F. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science. 2018;360:439‐+. doi: 10.1126/science.aaq0179 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Wang XJ, Zhong MT, Liu Y, et al. Rapid and sensitive detection of COVID‐19 using CRISPR/Cas12a‐based detection with naked eye readout, CRISPR/Cas12a‐NER. Sci Bull. 2020;65:1436‐1439. doi: 10.1016/j.scib.2020.04.041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Aman R, Marsic T, Rao GS, et al. iSCAN‐V2: a one‐pot RT‐RPA‐CRISPR/Cas12b assay for point‐of‐care SARS‐CoV‐2 detection. Front Bioeng Biotechnol. 2022;9:9. doi: 10.3389/fbioe.2021.800104 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Kaminski MM, Abudayyeh OO, Gootenberg JS, Zhang F, Collins JJ. CRISPR‐based diagnostics. Nature. Biomed Eng. 2021;5:643‐656. doi: 10.1038/s41551-021-00760-7 [DOI] [PubMed] [Google Scholar]
  • 43. Yan Z, Deng X, Qiu J. Human bocavirus 1 infection of well‐differentiated human airway epithelium. Curr Protoc Microbiol. 2020;58:e107. doi: 10.1002/cpmc.107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Qian W, Huang J, Wang X, Wang T, Li Y. CRISPR‐Cas12a combined with reverse transcription recombinase polymerase amplification for sensitive and specific detection of human norovirus genotype GII.4. Virology. 2021;564:26‐32. doi: 10.1016/j.virol.2021.09.008 [DOI] [PubMed] [Google Scholar]
  • 45. Dunn JJ, Miller MB. Emerging respiratory viruses other than influenza. Clin Lab Med. 2014;34:409‐430. doi: 10.1016/j.cll.2014.02.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Guido M, Zizza A, Bredl S, et al. Seroepidemiology of human Bocavirus in Apulia, Italy. Clin Microbiol Infect. 2012;18:E74‐E76. doi: 10.1111/j.1469-0691.2011.03756.x [DOI] [PubMed] [Google Scholar]
  • 47. Kantola K, Hedman L, Allander T, et al. Serodiagnosis of human Bocavirus infection. Clin Infect Dis. 2008;46:540‐546. doi: 10.1086/526532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Ding RH, Long JZ, Yuan MZ, et al. CRISPR/Cas system: a potential Technology for the prevention and control of COVID‐19 and emerging infectious diseases. Front Cell Infect Microbiol. 2021;11:639108. doi: 10.3389/fcimb.2021.639108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Hanna RE, Doench JG. Design and analysis of CRISPR‐Cas experiments. Nat Biotechnol. 2020;38:813‐823. doi: 10.1038/s41587-020-0490-7 [DOI] [PubMed] [Google Scholar]

Articles from Animal Models and Experimental Medicine are provided here courtesy of Wiley

RESOURCES