Abstract
PU.1 and BSAP are transcription factors crucial for proper B-cell development. Absence of PU.1 results in loss of B, T, and myeloid cells, while absence of BSAP results in an early block in B-cell differentiation. Both of these proteins bind to the immunoglobulin κ chain 3′ enhancer, which is developmentally regulated during B-cell differentiation. We find here that BSAP can repress 3′ enhancer activity. This repression can occur in plasmacytoma lines or in a non-B-cell line in which the enhancer is activated by addition of the appropriate enhancer binding transcription factors. We show that the transcription factor PU.1 is a target of the BSAP-mediated repression. Although PU.1 and BSAP can physically interact through their respective DNA binding domains, this interaction does not affect DNA binding. When PU.1 function is assayed in isolation on a multimerized PU.1 binding site, BSAP targets a portion of the PU.1 transactivation domain (residues 7 to 30) for repression. The BSAP inhibitory domain (residues 358 to 385) is needed for this repression. Interestingly, the coactivator protein p300 can eliminate this BSAP-mediated repression. We also show that PU.1 can inhibit BSAP transactivation and that this repression requires PU.1 amino acids 7 to 30. Transfection of p300 resulted in only a partial reversal of PU.1-mediated repression of BSAP. When PU.1 function is assayed in the context of the immunoglobulin κ chain 3′ enhancer and associated binding proteins, BSAP represses PU.1 function by a distinct mechanism. This repression does not require the PU.1 transactivation or PEST domains and cannot be reversed by p300 expression. The possible roles of BSAP and PU.1 antagonistic activities in hematopoietic development are discussed.
Changes in gene regulation are critical for proper cellular differentiation. Many transcription factors play important roles in controlling the processes needed for lineage development. In the B-cell lineage, a variety of transcription factors are necessary for proper development including PU.1, Pip, NF-κB, Ikaros, Blimp-1, E2A, EBF, and BSAP/Pax-5 (reviewed in reference 16). PU.1 is an Ets family transcription factor specifically expressed in erythroid, myeloid, and B cells (25, 46). Gene-targeting experiments of the PU.1 locus in mice indicate that PU.1 is necessary for the development of granulocytes, monocytes, B cells, and T cells (30, 58). Exogenous addition of PU.1 DNA binding site oligonucleotides inhibits hematopoietic colony formation in vitro, whereas overexpression of PU.1 in erythroid cells can lead to erythroleukemia (34–36, 57, 66). PU.1 also appears to play a role in terminal differentiation within the macrophage lineage (14, 21, 38, 44) and may be crucial for the proper tissue-specific and temporal regulation of immunoglobulin κ chain (Igκ) gene rearrangement (20, 22). Interestingly, high levels of PU.1 protein in hematopoietic precursors appears to favor the myeloid lineages while low levels favor the B-cell lineage (60). Therefore, any mechanism that regulates PU.1 function could have a profound effect on lineage development. Indeed, functional antagonism between PU.1 and the hematopoietic transcription factors GATA-1 and GATA-2 can result in repressed transcriptional activity and altered erythroid cell development (54, 72). It is possible that transcription factors expressed in other lineages also interact with PU.1 and modulate its function.
BSAP (Pax-5) is a bifunctional transcription factor capable of repressing or activating transcription (reviewed in reference 4). Genes activated by BSAP include CD19, mb1, blk, RAG2, N-myc, LEF-1, CD72, and the Igɛ germ line promoter (10, 13, 19, 26–28, 37, 42, 43, 63, 64, 67, 71, 73, 74). In contrast, the Ig heavy-chain 3′α enhancer element, the Ig J chain gene, the PD-1 gene, and the hXBP gene are repressed by BSAP (39, 40, 42, 53, 55, 61). BSAP expression in the hematopoietic lineage is limited to B lymphocytes, although BSAP is also expressed in some nonlymphoid tissues. BSAP is expressed throughout B-cell differentiation until the mature B-cell stage and subsequently ceases at the plasma cell stage. BSAP-deficient mice fail to develop B cells due to a block at an early stage (65). In adult bone marrow, the arrest is at the pro-B-cell stage, but the block is earlier in fetal liver (37, 43). Interestingly, lack of BSAP enables immature pro-B cells to differentiate into multiple hematopoietic lineages (41). Therefore, BSAP expression appears to suppress lineage alternatives and to direct the cell to the B-cell lineage. Similar to PU.1, control of BSAP function could thus be very important for hematopoietic development.
The immunoglobulin κ chain 3′ enhancer binds PU.1 and BSAP as well as c-fos, c-jun, Pip, CREM, ATF1, E2A, YY1, and SP1 (7, 23, 31, 45, 48, 49, 51, 52, 56, 59). A subset of the above proteins (PU.1, Pip, c-fos, and c-jun) can form a specific enhanceosome complex over the enhancer, which can activate the enhancer in non-B cells (50). During early B-cell development (pro-B- and pre-B-cell stages), the 3′ enhancer is silent, whereas later in development (B-cell and plasma cell stages), the enhancer is active. The κ locus, which is fundamentally important for proper B-cell development, has a similar pattern of transcriptional activity. Thus, understanding the mechanisms of regulating enhancer activity may reveal mechanisms critical for B-cell development.
We show here that BSAP can repress Igκ 3′ enhancer activity. This repression is mediated by targeting the transcriptional function of PU.1. We show a physical interaction between the PU.1 Ets and BSAP paired-box DNA binding domains, but this interaction does not affect PU.1 DNA binding. Instead, we found the BSAP can repress PU.1 transactivation by at least two mechanisms. When PU.1 function was assayed in isolation using a reporter construct containing a multimerized PU.1 binding site, a portion of the PU.1 transactivation domain (residues 7 to 30) was the target of BSAP-mediated repression. This repression by BSAP required the carboxy-terminal BSAP inhibitory domain. Interestingly, the coactivator protein p300 could overcome this BSAP-mediated repression of PU.1. In the context of the Igκ 3′ enhancer and the other enhancer binding proteins, we found that BSAP repressed PU.1 by a distinct mechanism. In this case, repression did not require the PU.1 transactivation or PEST domains and could not be overcome by p300 expression. Finally, using an artificial BSAP-inducible reporter, we also showed that PU.1 can repress BSAP transactivation and that this repression could be partially overcome by p300. The potential roles of BSAP-PU.1 antagonistic interactions in hematopoietic development are discussed.
MATERIALS AND METHODS
Plasmid constructs.
To prepare various full-length or mutant BSAP plasmids, a BSAP clone (a gift from Barbara Birshtein, Albert Einstein Medical School) was used as a template for PCR. Primers contained either the BSAP start or stop codons with adjacent EcoRI restriction sites (FEcoBSAPATG or REcoBSAPUGA). PCR products were extracted with phenol-chloroform, precipitated with ethanol, and digested with EcoRI. Digested fragments were purified by agarose gel electrophoresis using the Qiagen Qiaex kit and then ligated with either EcoRI-cut Bluescript KS(+), cytomegalovirus CMV expression plasmid (CB6+), or GEX-2TK to produce KS+BSAP1–391, CMV-BSAP1–391, or GST-BSAP, respectively. For BSAP deletion mutants, PCR was performed with the FEcoBSAPATG forward primer and various 3′ primers (with HindIII sites [Table 1]) that amplified the appropriate sequences. Amplified products were digested with EcoRI and HindIII and ligated into EcoRI-HindIII-cut Bluescript KS(+), or CB6+ to produce the appropriate deletion clones (BSAP1–143, BSAP1–319, BSAP1–357, and BSAPΔ2–143). Plasmid CMV-BSAP1–385 plus a serine-to-glycine mutation at residue 283 was a gift from John Monroe (University of Pennsylvania). Internal BSAP deletion mutants (Δ144–303 and Δ228–259) were created by amplifying a full-length BSAP template with the FEcoBSAPATG forward primer and an RBSAPΔ144–303 or REcoBSAPAUG reverse primer and with a FBSAPΔ144–303 forward primer in separate reactions. The two products were gel purified (Qiaex) and used as template for a second PCR using FEcoBSAPATG and REcoBSAPAUG primers. Amplified products were gel purified, digested with EcoRI, and ligated into EcoRI-cut CMV. Plasmid CMV-p300 was a gift from Paul Liberman (Wistar Institute). Plasmids CMVPip, CMV-Fos, CMV-Jun, (Fos/Jun)4LBKCAT, (PU.1/Pip)4LBKCAT, CMVPU.1Δ7–30, and CMVPU.1Δ33–100 were described previously (50). CMV-PU.1 was described in reference 52. CMVPU.1Δ118–160 was described in reference 47. Bluescript plasmids PU.1Δ7–30, PU.1Δ30–100, PU.1Δ119–160, and PU.1Δ245–272 were described in reference 51, and plasmids PU.1Δ201–272 and PU.1Δ255–272 were described in reference 47. CORELBKCAT and GST-PU.1 were described in reference 48. CORETKCAT (construct E), (PU.1/Pip)4TKCAT (oligo 5), and (Fos/Jun)4TKCAT (oligo 2) were described in reference 49. CMVGAL-PU.1 was a gift from Tom Kadesch (University of Pennsylvania). Plasmids CMVGALPU.1 1–160 and CMVGALPU.1 1–200 were prepared by PCR using plasmid CMVPU.1 as a template. Following synthesis, PCR products were digested with EcoRI and XbaI and ligated into EcoRI-XbaI-cut CMVGAL (3). The GALE1bCAT reporter was a gift from Robert Ricciardi (University of Pennsylvania). GALYY1:1–143 was described previously (3). To prepare (BSAP)4(PU.1/Pip)4TKCAT and (BSAP)4(Fos/Jun)4TKCAT, a HindIII sticky-blunt DNA fragment with the multimerized BSAP binding site from the Igκ3′ enhancer was ligated into the blunted SalI-sticky HindIII sites of plasmid (PU.1/Pip)4TKCAT and (Fos/Jun)4TKCAT, respectively. These plasmids were cut with BamHI and HindIII to release the regulatory sequences and ligated into BamHI-BglII-cut LBKCAT to produce (BSAP)4(PU.1/Pip)4LBKCAT and (BSAP)4(Fos/Jun)4LBKCAT, respectively. BSAP2CAT was a gift from John Monroe.
TABLE 1.
Oligonucleotides used for plasmid construction
| Oligonucleotide | Sequence |
|---|---|
| FEcoBSAPATG | GCGGAATTCAAATGGATTTAGAGAAAAATTACCCG |
| REcoBSAPAUG | GCGGAATTCTCAGTGGCGGTCGTACGCAGT |
| RHind3BSAP1–357AUG | GCGAAGCTTTCACCAAGAATCATTGTAGGAAG |
| FHind3BSAPΔ2–143ATG | GCGAAGCTTATGAATCAGCCGGTCCCAGCTTCCAGT |
| RHind3BSAP1–143AUG | GCGAAGCTTTCATACTTTTGTCCGAATGATCC |
| RPU.1XbaPU.11–160AUG | CGTCTAGAAATCAACCTGGCCCAGGCTCCAAGCC |
| RPU.1XbaPU.11–200AUG | CGTCTAGAAATCAGGTACCTTTGTCCTTGTCCA |
| FGAL4ATG | CATCATCATCGGAAGAG |
| FBSAPΔ144–303 | ATTCGGACAAAAGTAGGCCGAGACTTGGCG |
| RBSAPΔ144–303 | CGCCAAGTCTCGGCCTACTTTTGTCCGAAT |
| FBSAPΔ228–254 | CAGATGCGGGGAGACCCCATCAAGCCAGAA |
| RBSAPΔ228–254 | TTCTGGCTTGATGGGGTCTCCCCGCATCTG |
| RHIND3BSAPΔ320–391 | GCGAAGCTTTCATGCAGAGTAGCTGCCCTGTCC |
| RECOBSAPΔ1–143AUG | GCGGAATTCTTCATACTTTTGTCCGAATGATCC |
Cell culture and transfections.
S194 plasmacytoma cells were grown and transfected by the DEAE-dextran procedure as previously described (49). Each transfection contained 1 μg of a β-galactosidase-expressing plasmid to normalize transfection efficiencies, 3 μg of the appropriate reporter plasmid, and 3 μg of either empty expression vector (CMV) or CMV-BSAP. NIH 3T3 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and were transfected by the calcium phosphate coprecipitation method (18). Cells were harvested 36 to 48 h posttransfection. Transfection efficiencies were initially normalized using β-galactosidase activity and chloramphenicol acetyltransferase (CAT) assays followed by thin-layer chromatography were performed as described by Gorman et al. (17). The percent CAT activity was calculated by scintillation counting of the acetylated product and substrate spots. Transfections were performed three to five times, and the data shown are the averages of all transfections.
Preparation of GST fusion proteins.
Escherichia coli BL21 cells containing the appropriate plasmid were inoculated overnight and diluted the following morning. Cultures were induced with 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) for 2 to 3 h. The cells were centrifuged, subjected to a freeze-thaw cycle, and resuspended in NETN (100 mM NaCl, 1 mM EDTA, 20 mM Tris-HCl [pH 8], 0.5% Nonidet P-40) containing lysozyme. After incubation for 20 min on ice, the cells received five 15-s sonication bursts. The solution was centrifuged at 2,000 rpm in a Sorvall RTH-750 rotor for 10 min, and the remaining supernatant was incubated at 4°C overnight with 1.5 ml of glutathione beads. The following morning, the beads were centrifuged and stored at 4°C.
GST chromatography.
A 20-μl volume of solution containing glutathione S-transferase (GST) fusion protein or an equivalent amount of GST protein alone was incubated with 5 to 15 μl of recombinant protein made by in vitro transcription and translation (TNT kit; Promega) in a 100-μl reaction mixture containing NETN. Samples were rocked for 1 to 3 h at 4°C and washed three to five times with 300 μl of NETN. The samples were loaded onto denaturing polyacrylamide gels, run for 1 to 2 h at 150 V, dried, and subjected to autoradiography overnight.
RESULTS
BSAP represses Igκ 3′ enhancer activity.
BSAP, or a BSAP-like protein, can bind to the Igκ 3′ enhancer (56, 59). However, the role of BSAP in controlling Igκ 3′ enhancer function has never been elucidated. BSAP expression inversely correlates with Igκ 3′ enhancer function, suggesting that BSAP may negatively regulate enhancer activity. Therefore, we tested the ability of BSAP to regulate the expression of a CAT reporter gene driven by the thymidine kinase promoter adjacent to the Igκ 3′ enhancer (enhancer residues 390 to 523 [32]). This reporter (CORETKCAT) was transfected into S194 plasmacytoma cells with either empty expression vector (CMV) or a BSAP expression plasmid (CMV-BSAP). CORETKCAT activity was repressed two- to threefold by CMV-BSAP compared to empty vector alone (Fig. 1, lanes 1 and 2). Therefore, BSAP expression in plasmacytoma cells, which normally lack BSAP, appears to repress Igκ 3′ enhancer activity.
FIG. 1.

BSAP represses Igκ 3′ enhancer activity. The CORETKCAT reporter plasmid was transfected into S194 plasmacytoma cells either with empty CMV expression plasmid (lane 1) or with CMV-BSAP expression plasmid (lane 2). CAT activities of cell extracts from transfected cells are shown. Repression averaged 2.0- ± 0.4-fold in six independent experiments.
The Igκ 3′ enhancer is normally quiescent in non-B cells. However, we previously demonstrated that the enhancer can be activated in NIH 3T3 cells by exogenous addition of PU.1, Pip, c-fos, and c-jun (50). Since BSAP repressed enhancer activity in plasmacytoma cells, we tested whether BSAP could also regulate the induction of enhancer activity in NIH 3T3 fibroblasts. We placed the 3′ enhancer core sequences adjacent to the liver-bone-kidney (LBK) alkaline phosphatase minimal promoter, which is normally inactive in NIH 3T3 cells. Consistent with our previous results (50), this reporter plasmid (CORELBKCAT) was activated over 20-fold by transfection with plasmids expressing PU.1, Pip, c-fos, and c-jun (Fig. 2A). Addition of BSAP greatly repressed this induction (Fig. 2A). Therefore, BSAP can repress 3′ enhancer activity induced by PU.1, Pip, c-fos, and c-jun in NIH 3T3 cells.
FIG. 2.
BSAP represses enhancer activity by inhibiting PU.1 function. (A) BSAP represses Igκ 3′ enhancer activity in NIH 3T3 cells. NIH 3T3 cells were transfected with the CORELBKCAT reporter, and plasmids expressing PU.1, Pip, c-Jun and c-Fos. The presence (+) or absence (−) of CMV-BSAP is indicated above the lanes. Repression averaged 5.3- ± 1.8-fold in five independent experiments. (B) PU.1 must be present for BSAP repression. NIH 3T3 cells were transfected with the CORELBKCAT reporter and the various expression plasmids shown below the histograms. Transfections were performed in either the absence (cross-hatched columns) or the presence (dark shaded columns) of CMV-BSAP. Percent activity is plotted, with 100% defined as the amount of activity in the absence of BSAP for each transfection mix. Error bars indicate standard deviation. Activities in the absence of PU.1 or Pip averaged about 20% of the activity with all four proteins, while removal of c-fos had a minimal effect on overall enhancer activity. (C) Map of the TKCAT constructs used for transfection. Locations of the multimerized BSAP, PU.1/Pip, and c-fos/c-jun binding sites are indicated upstream of the TK promoter driving the CAT gene. (D) BSAP represses the activity of a PU.1/Pip-dependent reporter but not a c-Fos/c-Jun-dependent reporter. NIH 3T3 cells were transfected with the reporter plasmids diagrammed in panel C. Lanes 1 to 4 received CMV-PU.1 and CMV-Pip, while lanes 5 to 8 received CMV-Fos and CMV-Jun. The presence or absence of CMV-BSAP in the transfections is indicated above each lane. BSAP repression of constructs 1 and 2 averaged 10-fold, while constructs 3 and 4 and the TKCAT vector were minimally affected. (E) NIH 3T3 cells were transfected with the LBKCAT reporter plasmids diagrammed below the histogram. The locations of the multimerized BSAP, PU.1/Pip, and c-fos/c-jun binding sites are indicated upstream of the LBK promoter driving the CAT gene. Reporter constructs 1 and 2 were cotransfected with CMV-PU.1 and CMV-Pip, whereas reporter constructs 3 and 4 were cotransfected with CMV-Fos and CMV-Jun. Transfections receiving CMV-BSAP are designated by +, and those receiving empty CMV vector are designated by −. Percent activity is plotted, with 100% defined as the amount of activity in the absence of BSAP for each transfection mix. Error bars indicate standard deviation. (F) BSAP represses the activity of a PU.1/Pip-dependent reporter plasmid in B cells. S194 plasmacytoma cells were transfected with a PU.1/Pip-dependent reporter plasmid (PU.1/Pip)4LBKCAT and either empty CMV vector (lane 1) or CMV-BSAP (lane 2). BSAP repressed activity eightfold.
BSAP repression targets PU.1 activity.
We next sought to identify the protein target of BSAP repression. If BSAP targets a specific enhancer binding protein, removal of that component from the transfection mix should alleviate the repression. Thus, we performed transfections in which we systematically removed individual transcription factor components (PU.1, Pip, c-fos, or c-jun) from the transfection. This resulted in reduced, but still relatively robust transcriptional activity. Removal of c-fos had no effect on the ability of BSAP to repress enhancer activity (Fig. 2B, compare lane 1 with lane 4). Similarly, BSAP repressed enhancer activity in the absence of Pip (compare lane 1 with lane 3). However, removal of PU.1 greatly reduced the ability of BSAP to repress transcription (compare lane 1 with lane 2). Absence of c-jun resulted in complete loss of enhancer activity (data not shown), thus preventing us from determining its role in BSAP repression.
The above data indicate that PU.1 is a likely target of the BSAP-mediated repression. We wished to use a second approach to confirm these results and to determine whether c-jun was a target of BSAP repression. Our second approach utilized reporter constructs (diagrammed in Fig. 2C) containing multimerized copies of the BSAP binding site from the 3′ enhancer adjacent to multimerized copies of either the PU.1/Pip or c-fos/c-jun elements (constructs 1 and 3, respectively). Reporter plasmid 1 (Fig. 2C) can be activated by cotransfection with PU.1 and Pip expression plasmids, whereas reporter plasmid 3 can be activated by cotransfection of plasmids expressing c-fos and c-jun. If BSAP targets PU.1 but not c-jun, the PU.1/Pip-inducible reporter should be repressed whereas the c-fos/c-jun-inducible reporter should not be affected. As expected, PU.1-Pip activity was repressed approximately 10-fold by BSAP (Fig. 2D, lanes 1 and 2). However, the c-fos/c-jun-responsive reporter was minimally repressed (lanes 5 and 6). These results are consistent with the conclusion that PU.1 is a target of BSAP-mediated repression. In addition, these results indicate that c-jun is not a target of repression.
We also sought to determine whether the above repression required BSAP DNA binding. PU.1/Pip- and c-fos/c-jun-dependent reporter constructs were created which lacked the BSAP binding site (constructs 2 and 4, respectively [Fig. 2C]). Interestingly, the PU.1/Pip-responsive reporter plasmid lacking the BSAP binding site was efficiently repressed by BSAP (Fig. 2D, lanes 3 and 4). No repression was observed with the c-fos/c-jun-responsive reporter lacking the BSAP binding site (lanes 7 and 8). Therefore, BSAP repression of PU.1 activity does not depend upon BSAP binding to DNA.
The ability of BSAP to specifically repress PU.1 function in the absence of a BSAP DNA binding site was unexpected. We prepared additional reporter constructs containing the same Igκ 3′ enhancer regulatory elements adjacent to the LBK promoter driving the CAT gene to verify that this repression mechanism was not due to some unusual property of the reporter plasmids used. Once again, BSAP primarily repressed the PU.1/Pip-dependent reporters and repression did not require a BSAP DNA binding site (Fig. 2E).
The PU.1/Pip element was also tested as a target for BSAP repression in plasmacytoma cells. We performed transfections in S194 plasmacytoma cells (Fig. 2F) with the PU.1/Pip-dependent reporter plasmid (Fig. 2E, construct 2). This reporter plasmid shows high levels of transcriptional activity due to endogenous PU.1 and Pip in plasmacytoma cells. Once again, addition of CMV-BSAP completely repressed reporter activity. As a negative control, the ribosomal protein gene L32 promoter driving CAT (RPCAT) was tested and was found to be unaffected by BSAP (data not shown). In summary, our results indicate that BSAP can repress Igκ 3′ enhancer activity. This repression mechanism targets the transcription factor PU.1 which binds to the Igκ 3′ enhancer but does not require BSAP to bind DNA.
The PU.1 Ets domain physically interacts with BSAP.
Since PU.1 was clearly a target of the BSAP-mediated repression but BSAP did not need to bind to DNA for repression, we sought to determine if BSAP could physically interact with PU.1. We tested whether PU.1 protein prepared by in vitro translation could interact with bacterially produced GST-BSAP. Indeed, a strong interaction was observed between BSAP and PU.1 (Fig. 3A, lane 6). Minimal PU.1 binding was observed with the GST beads alone (lane 5).
FIG. 3.
BSAP physically interacts with PU.1 through the PU.1 Ets domain. (A and B) PU.1 and various PU.1 deletion mutants were prepared by in vitro translation. Translated products were incubated with either GST or GST-BSAP as indicated above the lanes. The PU.1 samples used in each assay are indicated at the top. After incubation, samples were washed and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis; 20% input samples are shown in lanes 1 to 4. (C) PU.1 residues 201 to 255 are necessary for interaction with BSAP. A diagram of each PU.1 mutant is shown. Sequences deleted are indicated on the left, and the ability to physically bind to GST-BSAP is indicated on the right.
To determine the segment of PU.1 necessary for this interaction, we tested a panel of PU.1 deletion mutants against GST-BSAP (Fig. 3A and B). PU.1 deletions spanning the amino-terminal transcriptional activation domain (Δ7–30 and Δ33–100) or the internal PEST domain (Δ119–160) bound to GST-BSAP (but not to GST) as efficiently as did wild-type PU.1 (Fig. 3A, lanes 7 to 12). An extreme carboxy-terminal deletion of PU.1 (Δ255–272) also retained binding to GST-BSAP (Fig. 3B, lanes 11 and 12). However, deletion of an additional 10 amino acids (Δ245–272) resulted in very weak specific binding (lanes 9 and 10), and deletion of amino acids 201 to 272 resulted in a complete loss of binding to BSAP, indicating the importance of the Ets domain for interaction with BSAP (lanes 7 and 8). The above results are summarized in Fig. 3C. We attempted to determine if the PU.1 Ets domain (amino acids 160 to 255) was sufficient for BSAP interaction. However, we were unable to produce a stable protein using rabbit reticulocyte or wheat germ translation extracts. Therefore, we prepared a GST-PU.1-Ets domain construct. The GST-Ets domain protein interacted only weakly with BSAP (data not shown). However, this protein may not be folded properly, since it bound to DNA very poorly. Thus, although the Ets domain is clearly necessary for interaction with BSAP, we were unable to determine if it is sufficient. In conclusion, our data indicate that PU.1 sequences within the PU.1 Ets domain (residues 201 to 255) are required for physical interaction with BSAP.
BSAP requires the paired-box domain for in vitro interaction with PU.1.
We conducted reciprocal protein-protein interaction assays to confirm the above results and to localize the region of BSAP involved in physical interaction with PU.1. Wild-type BSAP protein prepared by in vitro translation was incubated with bacterially produced GST-PU.1 protein. As expected, a specific interaction between BSAP and GST-PU.1 was detected (Fig. 4A, lanes 5 and 6).
FIG. 4.
The BSAP paired-box domain is necessary and sufficient for interaction with PU.1. (A) BSAP and various BSAP deletion mutants were prepared by in vitro translation. Translated products were incubated with either GST or GST-PU.1 as indicated above the lanes. The BSAP samples used in each assay are indicated at the top. Lanes 11 and 12 received unprogrammed rabbit reticulocyte lysate. (B) PU.1 prepared by in vitro translation was incubated with either GST-BSAP 1–391 or GST-BSAP 1–143. After incubation, samples were washed and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis; 20% input samples are shown in lanes 1 to 4 of panel A and lane 1 of panel B. (C) Results of the interaction studies are summarized. The locations of the BSAP paired-box domain, homeodomain (HD), activation domain (AD), and inhibitory domain (Inh) are indicated. The ability of each BSAP construct to interact with PU.1 is shown on the right.
We next tested BSAP mutants lacking either the extreme carboxy-terminal region (Δ358–391) or the amino-terminal segment (Δ2–143). The region from 358 to 391 corresponds to an inhibitory domain, which was shown by Dorfler and Busslinger (11) to be able to modulate the activity of the adjacent BSAP transactivation domain. Amino acids 1 to 143 comprise the paired-box domain necessary for BSAP DNA binding (1, 8). This region was also shown to interact with other Ets family proteins (15, 69). The BSAP mutant lacking the extreme carboxy-terminal 33 amino acids (Δ358–391) bound to GST-PU.1 as well as did wild-type BSAP (Fig. 4A, lanes 7 and 8). However, a mutant lacking the amino-terminal paired-box domain (Δ2–143) did not bind to GST-PU.1 (lanes 9 and 10). To determine whether the paired-box domain was sufficient for interaction with PU.1, we fused BSAP residues 1 to 143 to GST and tested its ability to interact with full-length PU.1. The paired-box domain protein interacted as well as full-length BSAP did (Fig. 4B, lanes 3 and 4). Therefore, the BSAP paired-box DNA binding domain is necessary and sufficient for interaction with PU.1. The above results are summarized in Fig. 4C.
BSAP does not inhibit PU.1 DNA binding.
Since BSAP interacts with PU.1 through the Ets DNA binding domain, we first sought to determine if BSAP inhibited PU.1 DNA binding. Electrophoretic mobility shift assays did not reveal an effect of BSAP on PU.1 DNA binding (data not shown), suggesting that displacement of PU.1 from the DNA was not part of the repression mechanism by BSAP. If the BSAP repression mechanism does not involve inhibition of PU.1 DNA binding, then a chimeric PU.1 protein consisting of PU.1 fused to a heterologous DNA binding domain should also be repressed by BSAP. We fused the GAL4 heterologous DNA binding domain (residues 1 to 147) to PU.1. The fusion protein was cotransfected with a GAL4-dependent reporter (GALE1bCAT), and activity was measured in the presence or absence of BSAP. Indeed, BSAP repressed GAL-PU.1 transactivation, indicating that DNA binding through the PU.1 Ets domain is not involved in the repression mechanism (Fig. 5A, lane 1).
FIG. 5.
BSAP repression does not involve the Ets domain and targets a portion of the PU.1 transactivation domain. (A) BSAP-mediated repression does not require the PU.1 Ets domain. NIH 3T3 cells were transfected with a GAL4-responsive reporter (GALE1bCAT) and various GAL-PU.1 or GAL-YY1 fusion constructs. Fold repression in the presence of BSAP is plotted. Histograms that fall below the horizontal line represent no repression by BSAP. Error bars indicate standard deviation. Basal activities of GALPU.1 1–160 and GALPU.1 1–200 were 13- and 7-fold higher, respectively, than that of GALPU.1 1–272. GALYY1 1–143 activity was 1.7-fold higher than that of GALPU.1 1–272. (B) BSAP repression targets a portion of the PU.1 transactivation domain. NIH 3T3 cells were transfected with the (PU.1/Pip)4LBKCAT reporter and plasmids expressing wild-type PU.1 or various PU.1 deletion mutants. Fold repression in the presence of BSAP is plotted. Error bars indicate standard deviation. PU.1Δ7–30 showed 20% of the activity of wild-type PU.1, whereas PU.1Δ33–100 and PU.1Δ118–160 were equivalent to wild-type PU.1. (C) Summary of BSAP repression data. The positions of the PU.1 activation domain (AD), PEST domain, and DNA binding Ets domain are indicated. The ability of BSAP to repress each construct is indicated on the right.
To determine if the PU.1 Ets domain was required for the repression, we fused PU.1 amino acids 1 to 200 and 1 to 160 to GAL4. Both GAL-PU.1 1–200 and GAL-PU.1 1–160 were repressed by BSAP (Fig. 5A, lanes 2 and 3). The activity of an unrelated transcription factor fusion protein, GAL-YY1:1–143, was not inhibited by BSAP (lane 4). In summary, these data indicate that physical interaction of PU.1 with BSAP is unnecessary for the repression (although we cannot rigorously exclude the possibility of very weak interactions in vivo that are undetectable by GST pulldown assays). Our results also demonstrate that displacement of PU.1 from DNA is not part of the repression mechanism.
The amino-terminal region of PU.1 is required for the BSAP repression mechanism.
To identify the PU.1 sequences that are the target of BSAP repression, several deletion mutants were tested. These deletions (Δ7–30, Δ33–100, and Δ119–160) can still activate a PU.1-dependent reporter, (PU.1/Pip)4 LBKCAT, in NIH 3T3 cells. Wild-type or individual PU.1 mutants were transfected in either the presence or absence of BSAP, and the repression was measured. The activities of PU.1Δ33–100 and PU.1Δ119–160 were repressed to levels similar to, or higher than, that of wild-type PU.1 (Fig. 5B, compare lane 1 with lanes 3 and 4). However, deletion of PU.1 amino acids 7 to 30 abolished the ability of BSAP to repress transcription (lane 2). These data indicate that PU.1 amino acids 7 to 30 are a target for the BSAP repression mechanism. The above results are summarized in Fig. 5C.
The carboxy-terminal portion of BSAP is necessary for repression.
We sought to determine the BSAP sequences necessary for repression of PU.1 transcriptional activity. Using mutant BSAP constructs, transient transfections were conducted comparing the level of repression of these mutants to that of wild-type BSAP. Expression of full-length BSAP (WT BSAP 1–391) resulted in significant levels of repression (Fig. 6A, lane 2). Expression of the paired box domain alone (BSAP 1–143) was not capable of mediating BSAP repression, again confirming that physical interaction of PU.1 with BSAP is not sufficient for repression (lane 8). Deletion of amino acids 358 to 391, which constitute the inhibitory domain (lane 4), yielded a protein that had lost the ability to repress the activity of PU.1. However, another BSAP mutant protein which has an amino acid change (S to G) at residue 283 and a frameshift at amino acid 385 which deletes the C-terminal 6 amino acids but adds 25 heterologous residues (BSAP 1–385;S283G) repressed PU.1 activity (lane 3). A larger carboxy-terminal deletion removing amino acids 320 to 391 did not repress PU.1 activity (lane 5). An internal deletion (Δ228–259) that deletes the internal homeodomain, and which was recently demonstrated by Eberhard and Busslinger (12) to interact with TBP and RB, also repressed PU.1 activity (lane 6). A larger internal deletion (BSAPΔ144–303), which deletes all residues between the paired-box domain and the BSAP transactivation domain, still repressed PU.1 activity (lane 7). We also tested the repression properties of several BSAP constructs fused to the GAL4 heterologous DNA binding domain. Full-length BSAP (GAL-BSAP 1–391) repressed PU.1 transactivation (lane 9). Deletion of the BSAP inhibitory domain (GAL-BSAP 1–357) abolished BSAP repression (lane 10). Finally, an amino-terminal mutant which removes the paired-box domain (GAL-BSAP 144–391) repressed PU.1 transactivation (lane 11). Western blots of nuclear extracts isolated from transfected cells showed that the appropriate mutant BSAP proteins were expressed in vivo (data not shown). The BSAP constructs used above and their ability to repress PU.1 activity are summarized in Fig. 6B.
FIG. 6.
(A) The BSAP inhibitory domain is necessary for repression of PU.1 activity. NIH 3T3 cells were transfected with the (PU.1/Pip)4LBKCAT reporter and CMV-PU.1. Various BSAP expression plasmids included in the transfection are indicated below each histogram. CAT activities of cell extracts from transfected cells are shown, and error bars indicate standard deviation. (B) Maps of BSAP constructs used for transfection. The positions of the BSAP paired-box domain, homeodomain (HD), activation domain (AD), and inhibitory domain (Inh) are indicated. The ability of each BSAP construct to repress PU.1 transactivation is shown on the right.
The above results indicate that residues 358 to 385, which constitute the BSAP inhibitory domain, are necessary for repression of PU.1 activity. On the other hand, the paired-box domain, the homeodomain, and all sequences between the paired-box domain and the activation domain are dispensable for repression. Therefore, BSAP repression requires some feature of the inhibitory domain but does not require physical interaction via the paired-box domain.
Coactivator protein p300 can reverse BSAP repression.
Previously, it was shown that c-jun and CBP can function as coactivators of PU.1 activity (2, 70). Repression by BSAP could be due to BSAP targeting some function of a PU.1 coactivator protein. Our results described above showed that c-jun is not a target of BSAP repression (Fig. 2D and E), but coactivators with histone acetyltransferase (HAT) activity could possibly be part of the repression mechanism. We tested a variety of HAT proteins for their ability to function with PU.1 and found that p300 stimulated PU.1 transcriptional activity most strongly (Y. Bai and M. Atchison, unpublished data). Therefore, we tested whether the coactivator p300 could abolish the repression mediated by BSAP. Transient-expression assays were performed with PU.1 alone, PU.1 plus BSAP, or PU.1 plus BSAP and increasing doses of p300. Indeed, we found that p300 could completely reverse the inhibition mediated by BSAP (Fig. 7). Therefore, the repression mechanism of BSAP apparently involves disrupting the function of p300 with PU.1.
FIG. 7.
p300 can reverse the BSAP inhibition of PU.1 transactivation. (A) NIH 3T3 cells were transfected with the (PU.1/Pip)4LBKCAT reporter and the various expression plasmids indicated above each lane. BSAP represents clone BSAP Δ228–254. Lanes 4 to 6 contain 50 ng, 2.5 μg, and 5.0 μg of p300 expression plasmid, respectively. (B) Histogram of the p300 reversal of BSAP repression experiment in panel A. A duplicate experiment showed the same results.
PU.1 can repress BSAP transactivation.
While our results described above indicated that BSAP could repress PU.1 function, in other systems PU.1 antagonizes the function of other transcription factors. For instance, PU.1 can inhibit the function of the transcription factor GATA-1, resulting in inhibition of erythroid cell differentiation (54, 72). Therefore, we set out to determine whether PU.1 could inhibit BSAP function. BSAP can activate the synthetic reporter construct (BSAP)2CAT. We transfected the (BSAP)2CAT reporter with BSAP in the presence or absence of PU.1. Indeed, we found that PU.1 repressed BSAP transcriptional activity (Fig. 8). Interestingly, deletion of the PU.1 target sequences necessary for BSAP-mediated repression of PU.1 (Δ7–30) greatly reduced the ability of PU.1 to repress BSAP function (Fig. 8). This suggested that PU.1 could be repressing BSAP by targeting p300. If this is true, exogenous p300 should reverse the PU.1-mediated repression of BSAP activity. Cotransfection of p300 partially reversed the PU.1-mediated repression (Fig. 8, lane 4). Therefore, PU.1 and BSAP can antagonize each other by targeting p300 function.
FIG. 8.
PU.1 can inhibit BSAP transactivation. NIH 3T3 cells were transfected with the (BSAP)2CAT reporter and various expression plasmids shown below the histogram. The activity of the reporter plasmid and BSAP expression vector is defined as 100%. Error bars indicate standard deviation.
BSAP represses PU.1 function by a distinct mechanism in the context of the Igκ 3′ enhancer.
PU.1 can function in a variety of contexts within various promoters and enhancers. Our results described above indicate that when PU.1 function is assayed in isolation (i.e., in the absence of other DNA binding proteins), BSAP repression requires PU.1 sequences 7 to 30 and involves disruption of p300 function. In the context of the Igκ 3′ enhancer, however, we previously found that PU.1 sequences 7 to 30 are dispensable for mediating enhancer activity (50). However, BSAP represses PU.1 function in the context of this enhancer (Fig. 1 and 2). This suggested that BSAP may repress PU.1 function by a distinct mechanism in the context of the Igκ 3′ enhancer. To test this, we performed transfections with the CORELBKCAT reporter and plasmids expressing Pip, c-jun, c-fos, and various mutant PU.1 proteins. As shown in Fig. 2B, BSAP repressed transcription in the presence of wild-type PU.1 (Fig. 9A). However, in contrast to our results with a multimerized PU.1 binding site, 3′ enhancer activity was repressed by BSAP in the presence of PU.1Δ7–30 (Fig. 9A). Repression was also observed with PU.1 mutants Δ33–100, Δ2–118, and Δ118–168 (Fig. 9A). Thus, BSAP repressed PU.1 function even in the complete absence of the PU.1 transactivation domain (construct Δ2–118) or the PEST domain (Δ118–168).
FIG. 9.
BSAP represses PU.1 function by a distinct mechanism in the context of the Igκ 3′ enhancer. (A) The PU.1 transactivation and PEST domains are dispensable for repression. NIH 3T3 cells were transfected with the CORELBKCAT reporter and plasmids expressing Pip, c-Jun, c-Fos, and various PU.1 mutants. The presence (+) or absence (−) of each transcription factor is indicated below the lanes. For each transfection mix, activity in the absence of BSAP is defined as 100%. In the presence of Pip, c-jun, and c-fos, the PU.1 mutants supported similar enhancer activity. Error bars indicate standard deviation. (B) Coactivator p300 cannot reverse BSAP repression in the context of the 3′ enhancer. The presence (+) of each transcription factor is indicated below the lanes. Error bars indicate standard deviation. (C) The BSAP inhibitory domain is necessary for complete repression. The presence (+) of each transcription factor is indicated below the lanes. Error bars indicate standard deviation.
The above results suggested that BSAP represses PU.1 by a distinct mechanism in the context of the 3′ enhancer. If this is true, p300 should not reverse the BSAP-mediated repression. Indeed, we found that overexpression of p300 had no effect on the ability of BSAP to repress transcription (Fig. 9B). We tested two BSAP mutants for their ability to repress transcription in this context. Deletion of the BSAP inhibitory domain (BSAP 1–357) partially relieved the BSAP-mediated repression, whereas the BSAP DNA binding domain alone (BSAP 1–143) was completely incapable of repressing transcription (Fig. 9C). Our results indicate that BSAP can repress PU.1 function by two distinct mechanisms. One mechanism involves p300 and requires a portion of the PU.1 transactivation domain, and the second mechanism is independent of p300 and occurs in the absence of the PU.1 transactivation and PEST domains.
DISCUSSION
We found that BSAP can repress the activity of the Igκ 3′ enhancer in plasmacytoma cells or in NIH 3T3 cells after stimulation by transcription factors PU.1, Pip, c-fos, and c-jun. PU.1 is a target of BSAP repression based on a variety of criteria. First, removal of PU.1 from the transfection mix greatly reduced BSAP repression. Second, a PU.1/Pip-dependent reporter, but not a c-fos/c-jun-dependent reporter, was repressed by BSAP. Third, GAL-PU.1 but not GAL-YY1 activation was repressed by BSAP. We found that BSAP sequences 358 to 385, which constitute the BSAP inhibitory domain (11), are needed for repression. Interestingly, we found that BSAP can repress PU.1 function by at least two different mechanisms depending upon the context of PU.1. PU.1 sequences 7 to 30, which include a portion of the PU.1 transactivation domain (24), are the targets of BSAP-mediated repression when PU.1 function is assayed in isolation (i.e., on a multimerized PU.1 binding site). This repression mechanism involves the coactivator protein p300. Furthermore, we found that PU.1 can repress BSAP transcriptional activation and that this repression also requires PU.1 sequences 7 to 30 and can be partially reversed by p300.
In the context of the Igκ 3′ enhancer, however, BSAP repression did not require the PU.1 transactivation or PEST domains and repression could not be reversed by p300. Based on transfections performed in the absence of Pip (Fig. 2B and 9B), this repression mechanism appears to disrupt synergy between PU.1 and c-jun/c-fos. Interestingly, Zhang et al. (72) also found that GATA-1 and GATA-2 can disrupt PU.1–c-jun synergy. Functional repression by GATA-1 and GATA-2 coincided with disruption of PU.1–c-jun physical interactions. Interestingly, PU.1 interacts with c-jun, GATA-1, and GATA-2 via the PU.1 Ets domain β3/β4 region (72). This is the PU.1 region that we observed to bind to BSAP (Fig. 3). Therefore, it is likely that, similar to GATA-1 and GATA-2, BSAP can disrupt interactions between PU.1 and c-jun, resulting in transcriptional repression. However, it should be noted that the BSAP paired-box domain, which physically interacts with PU.1, is incapable of mediating repression. It is also interesting that, similar to our case with BSAP, the GATA factors do not inhibit PU.1 DNA binding (72).
BSAP has recently been shown to interact with regulatory proteins including TATA binding protein, the underphosphorylated form of the retinoblastoma protein, AML1, and Ets-1 (12, 15, 29). The TATA binding protein and retinoblastoma protein interactions require the internal homeodomain of BSAP. However, we found that these sequences are unnecessary for BSAP-mediated repression of PU.1 activity. In the case of the Ets-1 interaction, Fitzsimmons et al. (15) showed that in the context of the mb-1 promoter, BSAP can form a ternary complex with specific Ets family proteins and that this ternary complex is necessary for efficient promoter activity. Ternary-complex formation requires only the BSAP paired-box domain. Although we demonstrated that PU.1 can physically interact with the BSAP paired-box domain through its own Ets domain, PU.1 lacks the critical amino acids required for ternary-complex formation (69). In addition, the BSAP paired-box domain alone in insufficient for both of the repression mechanisms that we observed here. Instead, BSAP regulation of PU.1 transcriptional activity is distinct from the previously demonstrated BSAP regulatory mechanisms observed with other Ets proteins. Indeed, rather than activating expression, BSAP inhibits PU.1 function.
Dorfler and Busslinger (11) found that the BSAP inhibitory domain can inhibit or mask the activity of the BSAP transcriptional activation domain. The inhibitory sequences appeared to function as part of a unit including the adjacent activation domain, because inhibitory-domain repression was not transferable to a heterologous DNA binding domain (11). Our data, however, indicate an active role for the inhibitory domain. Rather than passively masking the BSAP activation domain, the BSAP inhibitory domain actively repressed PU.1 activity. Our cotransfection studies indicated that at least one functional target of the BSAP inhibitory domain is the coactivator protein, p300.
It is interesting that BSAP also negatively regulates the expression of the Ig J-chain gene promoter (55) and the activity of the Ig heavy-chain 3′ α enhancer (33, 39, 40, 61). Both of these regulatory elements contain PU.1 binding sites which could be the targets of BSAP repression. Both of these regulatory elements exhibit expression patterns similar to the Igκ 3′ enhancer. The Ig heavy-chain 3′ α enhancer, in particular, mirrors Igκ 3′ enhancer activity. Both enhancers are most active at late stages of B-cell development (plasma cell stage) and are inactive early in B-cell development (pro-B- and pre-B-cell stages). It will be very interesting to determine whether these two enhancers use similar mechanisms to control activity.
The functional competitions between PU.1, BSAP, p300, and c-jun that we observed here could be important for hematopoietic lineage development. PU.1 is necessary for myeloid and lymphoid cell development, whereas BSAP is necessary for B-cell development past the pro-B-cell stage (9, 14, 21, 30, 38, 44, 58). Interestingly, PU.1 does not appear to be necessary for myeloid lineage commitment but, rather, is needed for further development after commitment to the lineage has been initiated (21). BSAP may play a role in this lineage development by controlling the level of PU.1 activity and thereby reducing the plasticity of early B cells to differentiate into myeloid cells. Since PU.1 is known to influence macrophage proliferation (5), BSAP expression in early B-cell precursors could limit the expansion of cells into the myeloid pathway by inhibiting PU.1 function. Indeed, BSAP appears to reduce the clonal expansion of early myeloid cells (M. Chiang and J. Monroe, personal communication). On the other hand, PU.1 could limit the ability of BSAP to drive B-cell differentiation toward later stages. Absence of BSAP in pro-B cells enables cells at early stages of lymphopoiesis to “reverse” their differentiated state and to progress into other hematopoietic lineages (41). Inhibition of BSAP function by PU.1 could therefore drive cells toward the myeloid lineages. This would be analogous to the antagonistic interactions between PU.1 and GATA-1 during erythroid cell differentiation (54, 72). Therefore, functional interplay between PU.1, BSAP, p300, and c-jun could participate in the mechanisms for controlling hematopoietic lineage development.
A variety of regulatory options are possible for controlling the functional interactions between PU.1 and BSAP. Expression levels of either protein might be modulated. For instance, interleukin-2 can down-regulate BSAP expression, thereby relieving BSAP repression of the Ig J-chain gene (55). Similarly, BSAP expression is silenced in mice lacking the interleukin-7 receptor (6). BSAP or PU.1 could also be functionally regulated. The DNA binding function of BSAP may be altered by mitogenic stimuli, by reduction potential, or during B-cell development (59, 62, 68). Activity of the BSAP inhibitory domain, which we found is necessary for PU.1 repression, may also be regulated (11). This segment of BSAP is very rich in serine and tyrosine, and its function could potentially be differentially regulated by phosphorylation during B-cell differentiation. On the other hand, PU.1 functional interactions might be regulated. For example, phosphorylation of PU.1 serine 148 is known to regulate its ability to recruit transcription factor Pip to DNA (52). Similar posttranslational modifications might control the ability of PU.1 to interact with BSAP or p300. Thus, control of lineage development may depend upon signals that regulate the ability of either BSAP or PU.1 to repress one another's transcriptional activity. Additional experiments are necessary to elucidate these possible regulatory mechanisms.
ACKNOWLEDGMENTS
We thank Barbara Birshtein, John Monroe, Tom Kadesch, Paul Lieberman, and Robert Ricciardi for plasmids and Carl Costanzi, John Pehrson, and Yuchen Bai for comments on the manuscript. We also thank members of the Atchison laboratory for technical assistance.
This work was supported by National Institutes of Health grant GM42415 to M.A. and American Heart Association Pennsylvania Affiliate grants P98108E and 9910079U to S.M.
REFERENCES
- 1.Adams B, Dorfler P, Aguzzi A, Kozmik Z, Urbanek P, Mauer-Fogy I, Busslinger M. Pax-5 encodes the transcription factor BSAP and is expressed in B lymphocytes, the developing CNS, and adult testis. Genes Dev. 1992;6:1589–1607. doi: 10.1101/gad.6.9.1589. [DOI] [PubMed] [Google Scholar]
- 2.Behre G, Whitmarsh A J, Coghlan M P, Hoang T, Carpenter C L, Zhang D-E, Davis R J, Tenen D G. c-Jun is a JNK-independent coactivator of the PU.1 transcription factor. J Biol Chem. 1999;274:4939–4946. doi: 10.1074/jbc.274.8.4939. [DOI] [PubMed] [Google Scholar]
- 3.Bushmeyer S, Park K, Atchison M L. Characterization of functional domains within the multifunctional transcription factor, YY1. J Biol Chem. 1995;270:30213–30220. doi: 10.1074/jbc.270.50.30213. [DOI] [PubMed] [Google Scholar]
- 4.Busslinger M, Nutt S L, editors. Role of the transcription factor BSAP (Pax-5) in B-cell development. Totowa, N.J: Humana Press Inc.; 1998. [Google Scholar]
- 5.Celada A, Borras F E, Soler C, Lloberas J, Klemsz M, van Beveren C, McKercher S, Maki R A. The transcription factor PU.1 is involved in macrophage proliferation. J Exp Med. 1996;184:61–69. doi: 10.1084/jem.184.1.61. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Corcoran A E, Riddell A, Krooshoop D, Venkitaraman A R. Impaired immunoglobulin gene rearrangement in mice lacking the IL-7 receptor. Nature. 1998;391:904–907. doi: 10.1038/36122. [DOI] [PubMed] [Google Scholar]
- 7.Costa M W, Atchison M L. Identification of an Sp1-like element within the immunoglobulin κ 3′ enhancer necessary for maximal enhancer activity. Biochemistry. 1996;35:8662–8669. doi: 10.1021/bi952801y. [DOI] [PubMed] [Google Scholar]
- 8.Czerny T, Schaffner G, Busslinger M. DNA sequence recognition by Pax proteins: bipartite structure of the paired domain and its binding site. Genes Dev. 1993;7:2048–2061. doi: 10.1101/gad.7.10.2048. [DOI] [PubMed] [Google Scholar]
- 9.DeKoter R P, Walsh J C, Singh H. PU.1 regulates both cytokine-dependent proliferation and differentiation of granulocyte/macrophage progenitors. EMBO J. 1998;17:4456–4468. doi: 10.1093/emboj/17.15.4456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.De Monte L, Thienes C P, Monticelli S, Busslinger M, Gould H J, Vercelli D. Regulation of human epsilon germline transcription: role of B-cell-specific activator protein. Int Arch Allergy Immunol. 1997;113:35–38. doi: 10.1159/000237501. [DOI] [PubMed] [Google Scholar]
- 11.Dorfler P, Busslinger M. C-terminal activating and inhibitory domains determine the transactivation potential of BSAP (Pax-5), Pax-2 and Pax-8. EMBO J. 1996;15:1971–1982. [PMC free article] [PubMed] [Google Scholar]
- 12.Eberhard D, Busslinger M. The partial homeodomain of the transcription factor Pax-5 (BSAP) is an interaction motif for the retinoblastoma and TATA-binding proteins. Cancer Res. 1999;59:1716S–1725S. [PubMed] [Google Scholar]
- 13.Feldhaus A L, Mbangkollo D, Arvin K L, Klug C A, Singh H. BLyF, a novel cell-type and stage-specific regulator of the B-lymphocyte gene mb-1. Mol Cell Biol. 1992;12:1126–1133. doi: 10.1128/mcb.12.3.1126-1133.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Fisher R C, Olson M C, Pongubala J M R, Perkel J M, Atchison M L, Scott E W, Simon M C. Normal myeloid development requires both the glutamine-rich transactivation domain and the PEST region of transcription factor PU.1 but not the potent acidic transactivation domain. Mol Cell Biol. 1998;18:4347–4357. doi: 10.1128/mcb.18.7.4347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Fitzsimmons D, Hodsdon W, Wheat W, Maira S-M, Wasylyk B, Hagman J. Pax-5 (BSAP) recruits Ets proto-oncogene family proteins to form functional ternary complexes on a B-cell-specific promoter. Genes Dev. 1996;10:2198–2211. doi: 10.1101/gad.10.17.2198. [DOI] [PubMed] [Google Scholar]
- 16.Glimcher L H, Singh H. Transcription factors in lymphocyte development—T and B cells get together. Cell. 1999;96:13–23. doi: 10.1016/s0092-8674(00)80955-1. [DOI] [PubMed] [Google Scholar]
- 17.Gorman C M, Moffat L F, Howard B H. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol. 1982;2:1044–1051. doi: 10.1128/mcb.2.9.1044-1051.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Graham F L, Van der Eb A J. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology. 1973;52:456–467. doi: 10.1016/0042-6822(73)90341-3. [DOI] [PubMed] [Google Scholar]
- 19.Hagman J, Travis A, Grosschedl R. A novel lineage-specific nuclear factor regulates mb-1 gene transcription at early stages of B cell differentiation. EMBO J. 1991;10:3409–3417. doi: 10.1002/j.1460-2075.1991.tb04905.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hayashi R, Takemori T, Kodama M, Suzuki M, Tsuboi A, Nagawa F, Sakano H. The PU.1 binding site is a cis-element that regulates pro-B/pre-B specificity of Vκ-Jκ joining. J Immunol. 1997;159:4145–4149. [PubMed] [Google Scholar]
- 21.Henkel G W, McKercher S R, Leenen P J, Maki R A. Commitment to the monocytic lineage occurs in the absence of the transcription factor PU.1. Blood. 1999;93:2849–2858. [PubMed] [Google Scholar]
- 22.Hiramatsu R, Akagi K, Matsuoka M, Sakumi K, Nakamura H, Kingsbury L, David C, Hardy R R, Yamamura K-i, Sakano H. The 3′ enhancer region determines the B/T specificity and pro-B/pre-B specificity of immunoglobulin Vκ-Jκ joining. Cell. 1995;83:1113–1123. doi: 10.1016/0092-8674(95)90138-8. [DOI] [PubMed] [Google Scholar]
- 23.Judde J-G, Max E E. Characterization of the human immunoglobulin kappa gene 3′ enhancer: functional importance of three motifs that demonstrate B-cell-specific in vivo footprints. Mol Cell Biol. 1992;12:5206–5216. doi: 10.1128/mcb.12.11.5206-5216.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Klemsz M J, Maki R A. Activation of transcription by PU.1 requires both acidic and glutamine domains. Mol Cell Biol. 1996;16:390–397. doi: 10.1128/mcb.16.1.390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Klemsz M J, McKercher S R, Celada A, Van Beveren C, Maki R. The macrophage and B cell-specific transcription factor PU.1 is related to the Ets oncogene. Cell. 1990;61:113–124. doi: 10.1016/0092-8674(90)90219-5. [DOI] [PubMed] [Google Scholar]
- 26.Kozmik Z, Wang S, Dorfler P, Adams B, Busslinger M. The promoter of the CD19 gene is a target for the B-cell-specific transcription factor BSAP. Mol Cell Biol. 1992;12:2662–2672. doi: 10.1128/mcb.12.6.2662-2672.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lauring J, Schlissel M S. Distinct factors regulate the murine RAG-2 promoter in B- and T-cell lines. Mol Cell Biol. 1999;19:2601–2612. doi: 10.1128/mcb.19.4.2601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Liao F, Birshtein B K, Busslinger M, Rothman P. The transcription factor BSAP (NF-HB) is essential for immunoglobulin germ-line epsilon transcription. J Immunol. 1994;152:2904–2911. [PubMed] [Google Scholar]
- 29.Libermann T A, Pan Z, Akbarali Y, Hetherington C J, Boltax J, Yergeau D A, Zhang D E. AML (CBFalpha2) cooperates with B cell-specific activating protein (BSAP/PAX5) in activation of the B cell-specific BLK gene promoter. J Biol Chem. 1999;274:24671–24676. doi: 10.1074/jbc.274.35.24671. [DOI] [PubMed] [Google Scholar]
- 30.McKercher S R, Torbett B E, Anderson K L, Henkel G W, Vestal D J, Baribault H, Klemsz M, Feeney A J, Wu G E, Paige C J, Maki R A. Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J. 1996;15:5647–5658. [PMC free article] [PubMed] [Google Scholar]
- 31.Meyer K B, Ireland J. Activation of the immunoglobulin κ 3′ enhancer in pre-B cells correlates with the suppression of a nuclear factor binding to a sequence flanking the active core. Nucleic Acids Res. 1994;22:1576–1582. doi: 10.1093/nar/22.9.1576. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Meyer K B, Neuberger M S. The immunoglobulin κ locus contains a second, stronger B-cell-specific enhancer which is located downstream of the constant region. EMBO J. 1989;8:1959–1964. doi: 10.1002/j.1460-2075.1989.tb03601.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Michaelson J S, Singh M, Snapper C M, Sha W C, Baltimore D, Birshtein B K. Regulation of the 3′ IgH enhancers by a common set of factors including κB-binding proteins. J Immunol. 1996;156:2828–2839. [PubMed] [Google Scholar]
- 34.Moreau-Gachelin F, Ray D, Mattei M-G, Tambourin P, Tavitian A. The putative oncogene Spi-1: murine chromosomal localization and transcriptional activation in murine acute erythroleukemias. Oncogene. 1989;4:1449–1456. [PubMed] [Google Scholar]
- 35.Moreau-Gachelin F, Tavitian A, Tambourin P. Spi-1 is a putative oncogene in virally induced murine erythroleukemias. Nature. 1988;331:277–280. doi: 10.1038/331277a0. [DOI] [PubMed] [Google Scholar]
- 36.Moreau-Gachelin F, Wendling F, Monina T, Denis N, Titeux M, Grimber G, Briand P, Vainchenker W, Tavitian A. Spi-1/PU.1 transgenic mice develop multistep erythroleukemias. Mol Cell Biol. 1996;16:2453–2463. doi: 10.1128/mcb.16.5.2453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Morrison A M, Nutt S L, Thevenin C, Rolink A, Busslinger M. Loss- and gain-of-function mutations reveal an important role of BSAP (Pax-5) at the start and end of B cell differentiation. Semin Immunol. 1998;10:133–142. doi: 10.1006/smim.1998.0115. [DOI] [PubMed] [Google Scholar]
- 38.Nerlov C, Graf T. PU.1 induces myeloid lineage commitment in multipotent hematopoietic progenitors. Genes Dev. 1998;12:2403–2412. doi: 10.1101/gad.12.15.2403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Neurath M F, Max E E, Strober W. Pax5 (BSAP) regulates the murine immunoglobulin 3′α enhancer by suppressing binding of NF-αP, a protein that controls heavy chain transcription. Proc Natl Acad Sci USA. 1995;92:5336–5340. doi: 10.1073/pnas.92.12.5336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Neurath M F, Strober W, Wakatsuki Y. The murine Ig 3′α enhancer is a target site with repressor function for the B cell lineage-specific transcription factor BSAP (NF-HB, Sα-BP) J Immunol. 1994;153:730–742. [PubMed] [Google Scholar]
- 41.Nutt S L, Heavey B, Rolink A G, Busslinger M. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature. 1999;401:556–562. doi: 10.1038/44076. [DOI] [PubMed] [Google Scholar]
- 42.Nutt S L, Morrison A M, Dorfler P, Rolink A, Busslinger M. Identification of BSAP (Pax-5) target genes in early B-cell development by loss-and gain-of-function experiments. EMBO J. 1998;17:2319–2333. doi: 10.1093/emboj/17.8.2319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Nutt S L, Thevenin C, Busslinger M. Essential functions of Pax-5 (BSAP) in pro-B cell development. Immunobiology. 1997;198:227–235. doi: 10.1016/S0171-2985(97)80043-5. [DOI] [PubMed] [Google Scholar]
- 44.Olson M C, Scott E W, Hack A A, Su G H, Tenen D G, Singh H, Simon M C. PU.1 is not essential for early myeloid gene expression but is required for terminal myeloid differentiation. Immunity. 1995;3:703–714. doi: 10.1016/1074-7613(95)90060-8. [DOI] [PubMed] [Google Scholar]
- 45.Park K, Atchison M L. Isolation of a candidate repressor/activator, NF-E1 (YY-1, δ), that binds to the immunoglobulin κ 3′ enhancer and the immunoglobulin heavy-chain μE1 site. Proc Natl Acad Sci USA. 1991;88:9804–9808. doi: 10.1073/pnas.88.21.9804. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Paul R, Schuetz S, Kozak S L, Kozak C A, Kabat D. The Sfpi-1 proviral integration site of Friend erythroleukemia virus encodes the ets-related transcription factor PU.1. J Virol. 1991;65:464–467. doi: 10.1128/jvi.65.1.464-467.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Perkel J M, Atchison M L. A two-step mechanism for recruitment of Pip by PU.1. J Immunol. 1998;160:241–252. [PubMed] [Google Scholar]
- 48.Pongubala J M R, Atchison M L. Activating transcription factor 1 and cyclic AMP response element modulator can modulate the activity of the immunoglobulin κ 3′ enhancer. J Biol Chem. 1995;270:10304–10313. doi: 10.1074/jbc.270.17.10304. [DOI] [PubMed] [Google Scholar]
- 49.Pongubala J M R, Atchison M L. Functional characterization of the developmentally controlled immunoglobulin kappa 3′ enhancer: regulation by Id, a repressor of helix-loop-helix transcription factors. Mol Cell Biol. 1991;11:1040–1047. doi: 10.1128/mcb.11.2.1040-1047.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Pongubala J M R, Atchison M L. PU.1 can participate in an active enhancer complex without its transcriptional activation domain. Proc Natl Acad Sci USA. 1997;94:127–132. doi: 10.1073/pnas.94.1.127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Pongubala J M R, Nagulapalli S, Klemsz M J, McKercher S R, Maki R A, Atchison M L. PU.1 recruits a second nuclear factor to a site important for immunoglobulin κ 3′ enhancer activity. Mol Cell Biol. 1992;12:368–378. doi: 10.1128/mcb.12.1.368-378.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Pongubala J M R, Van Beveren C, Nagulapalli S, Klemsz M J, McKercher S R, Maki R A, Atchison M L. Effect of PU.1 phosphorylation on interaction with NF-EM5 and transcriptional activation. Science. 1993;259:1622–1625. doi: 10.1126/science.8456286. [DOI] [PubMed] [Google Scholar]
- 53.Reimold A M, Ponath P D, Li Y S, Hardy R R, David C S, Strominger J L, Glimcher L H. Transcription factor B cell lineage-specific activator protein regulates the gene for human X-box binding protein 1. J Exp Med. 1996;183:393–401. doi: 10.1084/jem.183.2.393. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Rekhtman N, Radparvar R, Evans T, Skoultchi A I. Direct interaction of hematopoietic transcription factors PU.1 and GATA-1: functional antagonism in erythroid cells. Genes Dev. 1999;13:1398–1411. doi: 10.1101/gad.13.11.1398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Rinkenberger J L, Wallin J J, Johnson K W, Koshland M E. An interleukin-2 signal relieves BSAP (PAX-5)-mediated repression of the immunoglobulin J chain gene. Immunity. 1993;5:377–386. doi: 10.1016/s1074-7613(00)80263-0. [DOI] [PubMed] [Google Scholar]
- 56.Roque M C, Smith P A, Blazquez V C. A developmentally modulated chromatin structure at the mouse immunoglobulin κ 3′ enhancer. Mol Cell Biol. 1996;16:3138–3155. doi: 10.1128/mcb.16.6.3138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Schuetze S, Sternberg P E, Kabat D. The Ets-related transcription factor PU.1 immortalizes erythroblasts. Mol Cell Biol. 1993;13:5670–5678. doi: 10.1128/mcb.13.9.5670-5678.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Scott E W, Simon M C, Anastasi J, Singh H. Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science. 1994;265:1573–1577. doi: 10.1126/science.8079170. [DOI] [PubMed] [Google Scholar]
- 59.Shaffer A L, Peng A, Schlissel M S. In vivo occupancy of the κ light chain enhancers in primary pro- and pre-B cells: a model for κ locus activation. Immunity. 1997;6:131–143. doi: 10.1016/s1074-7613(00)80420-3. [DOI] [PubMed] [Google Scholar]
- 60.Singh, H., R. P. DeKoter, and J. C. Walsh. PU.1, a shared transcriptional regulator of lymphoid and myeloid cell fates. Cold Spring Harbor Symp. Quant. Biol., in press. [DOI] [PubMed]
- 61.Singh M, Birshtein B K. NF-HB (BSAP) is a repressor of the murine immunoglobulin heavy-chain 3′ α enhancer at early stages of B-cell differentiation. Mol Cell Biol. 1993;13:3611–3622. doi: 10.1128/mcb.13.6.3611-3622.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Tell G, Scaloni A, Pellizzari L, Formisano S, Pucillo C, Damante G. Redox potential controls the structure and DNA binding activity of the paired domain. J Biol Chem. 1998;273:25062–25072. doi: 10.1074/jbc.273.39.25062. [DOI] [PubMed] [Google Scholar]
- 63.Theines C P, De Monte L, Monticelli S, Busslinger M, Gould H J, Vercelli D. The transcription factor B cell-specific activator protein (BSAP) enhances both IL-4- and CD40-mediated activation of the human epsilon germline promoter. J Immunol. 1997;158:5874–5882. [PubMed] [Google Scholar]
- 64.Travis A, Hagman J, Grosschedl R. Heterogeneously initiated transcription from the pre-B-and B-cell-specific mb-1 promoter: analysis of the requirement for upstream factor binding sites and initiation site sequences. Mol Cell Biol. 1991;11:5756–5766. doi: 10.1128/mcb.11.11.5756-5766.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Urbanek P, Wang Z Q, Fetka I, Wagner E F, Busslinger M. Complete block of early B cell differentiation and altered patterning of the posterior midbrain in mice lacking pax 5/BSAP. Cell. 1994;79:901–912. doi: 10.1016/0092-8674(94)90079-5. [DOI] [PubMed] [Google Scholar]
- 66.Voso M T, Burn T C, Wulf G, Lim B, Leone G, Tenen D G. Inhibition of hematopoiesis by competitive binding of transcription factor PU.1. Proc Natl Acad Sci USA. 1994;91:7932–7936. doi: 10.1073/pnas.91.17.7932. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Wallin J J, Gackstetter E R, Koshland M E. Dependence of BSAP repressor and activator functions on BSAP concentration. Science. 1998;279:1961–1964. doi: 10.1126/science.279.5358.1961. [DOI] [PubMed] [Google Scholar]
- 68.Wakatsuki Y W, Neurath M F, Max E E, Strober W. The B-cell specific transcription factor BSAP regulates B cell proliferation. J Exp Med. 1994;179:1099–1108. doi: 10.1084/jem.179.4.1099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Wheat W, Fitzsimmons D, Lennox H, Krautkramer S R, Gentile L N, McIntosh L P, Hagman J. The highly conserved β-hairpin of the paired DNA-binding domain is required for assembly of Pax-Ets ternary complexes. Mol Cell Biol. 1999;19:2231–2241. doi: 10.1128/mcb.19.3.2231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Yamamoto H, Kihara-Negishi F, Yamada T, Hashimoto Y, Oikawa T. Physical and functional interactions between the transcription factor PU.1 and the coactivator CBP. Oncogene. 1999;18:1495–1501. doi: 10.1038/sj.onc.1202427. [DOI] [PubMed] [Google Scholar]
- 71.Ying H, Healy J I, Goodnow C C, Parnes J R. Regulation of mouse CD72 gene expression during B lymphocyte development. J Immunol. 1998;161:4760–4767. [PubMed] [Google Scholar]
- 72.Zhang P, Behre G, Pan J, Iwama A, Wara-Aswapati N, Radomska H S, Auron P E, Tenen D G, Sun Z. Negative cross-talk between hematopoietic regulators: GATA proteins repress PU.1. Proc Natl Acad Sci USA. 1999;96:8705–8710. doi: 10.1073/pnas.96.15.8705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Zwollo P, Desiderio S. Specific recognition of the blk promoter by the B-lymphoid transcription factor B-cell specific activator protein. J Biol Chem. 1994;269:15310–15317. [PubMed] [Google Scholar]
- 74.Zwollo P, Rao S, Wallin J J, Gackstetter E R, Koshland M E. The transcription factor NF-kappaB/p50 interacts with the blk gene during B cell activation. J Biol Chem. 1998;273:18647–18655. doi: 10.1074/jbc.273.29.18647. [DOI] [PubMed] [Google Scholar]









