Abstract
Staphylococcus aureus is an important human and veterinary pathogen. The present study aimed to determine the prevalence of antibiotic resistance among S. aureus isolated from samples obtained from free-flying wild pigeons and houseflies from different locations surrounding a local hospital in the Greater Durban area in KwaZulu-Natal Province, South Africa. Environmental fecal samples were obtained from wild pigeons that inhabits the grounds of a local public hospital located on the South Beach area, Durban, South Africa. Housefly samples were collected from three different locations (Kenneth Stainbank Nature Reserve, Montclair/Clairwood, and Glenwood/Berea) in the greater Durban area, all within a close proximity to the hospital. Following enrichment, identification, and antimicrobial resistance profiling, S. aureus isolates were subjected to DNA extraction using the boiling method. It was found that 57 out of 252 samples (22.62%) were positive for S. aureus. The Kirby-Bauer disk diffusion method of antibiotic susceptibility testing was performed and revealed that antibiotic resistance rates to penicillin and rifampicin were the most common, with both returning 48 (84.2%) out of the 57 S. aureus isolates being resistant to penicillin and rifampicin. Antibiotic resistance rates to clindamycin, linezolid, erythromycin, tetracycline, cefoxitin, and ciprofloxacin were 82.5%, 78.9%, 73.7%, 63.2%, 33.3%, and 15.8% respectively. Antibiotic resistance genes were detected using primer-specific PCR and it was found that the prevalence rates of tetM, aac(6′)–aph(2″), mecA, tetK, ermc, and blaZ genes were 66.7%, 40.4%, 40.4%, 38.6%, 24.6%, and 3.51% respectively. Statistical analysis revealed significant (p < 0.05) relationships between the tetM, aac(6′)–aph(2″), and ermC genes and all parameters tested. A significant correlation between the aac(6′)–aph(2″) gene and the tetM (0.506) and ermC (−0.386) genes was identified. It was found that 23 (40.3%) S. aureus isolates were mecA positive, of which 10 (52.6%) out of 19 cefoxitin-resistant isolates were mecA positive and 13 (35.1%) out of 37 cefoxitin-sensitive isolates were mecA positive. The results of the present study demonstrated the detection of methicillin and multidrug resistant S. aureus isolated from samples obtained from wild pigeons and houseflies in the surroundings of a local public hospital in the Greater Durban area in South Africa. The findings of the study may account for the emergence of multidrug-resistant staphylococcal infections. The findings highlight the significant role of wild pigeons and houseflies in the spread of drug-resistant pathogenic S. aureus including MRSA. The conclusions of the present study highlight the improtant role of wildlife and the environment as interconnected contributors of One Health.
Keywords: Staphylococcus aureus, Antimicrobial resistance, Wild pigeons, Columba domestica livia, Columba livia, Houseflies, Musca domestica, One health, Antibiotic resistance genes, MRSA, mecA, methicillin resistance
Highlights
-
•
Wild pigeons are reservoirs of plethora of bacteria, viruses, fungi and parasitic pathogens of zoonotic potential. No information is available concerning the isolation and antimicrobial profiling of S. aureus or other bacterial pathogens isolated from wild pigeons in South Africa.
-
•
The study is the first in South Africa to report the detection of multidrug resistant S. aureus isolated from fecal and feather samples of wild pigeons, and housefly samples.
-
•
S. aureus isolates in the present study were alarmingly resistant to commonly used antibiotics representing increased concerns to public health and veterinary health.
-
•
The wild pigeons in the present study originated from flocks inhabiting the surroundings of a local public hospital and are close to human activities in the Greater Durban area which poses public health concerns.
-
•
The conclusions of the present study highlight the significance of wildlife and the environment as interconnected contributors of One Health.
1. Introduction
Antimicrobial resistance is one of the major and foremost threats to public health globally, where the interconnected transmission and emergence are contributing aspects to its development [1]. While the use of antibiotics in humans significantly contributes to the development and emergence of antibiotic resistance, a number of ecosystems play synergistic roles in the dissemination of antimicrobial resistance across various species [2]. Environmental wastewater, livestock, companion animals, and wildlife are important contributors to the development and emergence of antibiotic resistance [[2], [3], [4]]. Antimicrobial resistance is considered a One Health dilemma. The potential causes and interconnected human-animal- environment driving factors which contribute to the spread of antimicrobial resistance in a One Health perspective were recently reported and reviewed elsewhere [2,5,6].
Wild birds of different taxa and species are major reservoirs of diverse antimicrobial resistance genetic pools [[7], [8], [9], [10]]. The presence of antimicrobial resistance in wildlife is directly related to the anthropogenic activity pressure on the ecosystems [4,8]. It was previously reported that several wildlife species can be considered sentinels for the environmental pressure of antimicrobial resistance, and wildlife surveillance for antimicrobial resistance should be a priority [11].
Feral pigeons (rock pigeons) (Columba livia or Columba livia forma urbana)) also called city doves, city pigeons, or street pigeons, are descended from domestic pigeons (Columba livia domestica Protonym: Columba domestica livia) that have returned to the wild [12]. Wild pigeons (Columba livia [wild type] (= Columba livia) Family Columbidae Order Columbiformes) (Protonym: Columba domestica livia Family Columbidae Order Columbiformes) commonly known as rock doves are one of the most common wild birds found globally, with twelve subspecies having been identified [12]. Among bird species, wild pigeons are considered good sentinels for antimicrobial resistance studies and different resistant pathogens have been previously reported in wild pigeons such as E. coli, Staphylococcus aureus, Salmonella, Chlamydia, Listeria, Campylobacter, and Acinetobacter, among other species including fungi such as Cryptococcus and Candida, and parasites as well as different viruses [[13], [14], [15], [16], [17], [18], [19]]. Wild pigeons may be responsible for the zoonotic spread of antimicrobial resistance genes and diverse pathogens due to their wide spectrum flying ability between different locations and their proximity to humans [7,20,21]. Moreover, the ability of wild pigeons to adapt diverse urban habitats and their indoor nesting behaviour altogether contribute to their potential role as a source of infection in other susceptible hosts incluidng humans [22].
Feral pigeons are so widely distributed in large populations and thrive in urban and rural areas in South Africa. Pigeons frequently come in close contact with other hosts including humans, livestock and wild birds in parks, public gardens, temples, and farms. Recently, the increase in wild pigeon populations has raised public health and animal health concerns [23].
There is very limited data regarding the detection of antimicrobial resistance in bacterial pathogens incluidng Staphylococcus aureus (S. aureus) isolated from wild pigeons in South Africa. S. aureus causes staphylococcal food poisoning and is implicated in several difficult-to-treat infections in animals and humans. S. aureus is one of the most common pathogens in pigeons [13] and it is included among the ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter spp.) list of high priority pathogens [24,25].
It was previously reported that S. aureus was detected in public hospital environments in KwaZulu-Natal Province in South Africa [26]. Recently, we reported the isolation and molecular detection of virulence determinants in S. aureus isolated from fecal and feather samples obtained from feral pigeons in KwaZulu-Natal Province , South Africa [27]. The fecal droppings of wild pigeons may act as reservoir of several pathogens which have a relevant impact on human and livestock health and may cause severe diseases and economic losses [28]. We hypothesized that wild pigeons and houseflies could be apparent contributing factors in the transmission of staphylococcal infections where pigeon populations inhabit the grounds and surroundings of public hospitals. In this context, the objective of the present study was to determine the prevalence and antimicrobial resistance profiling of S. aureus isolated from samples obtained from wild pigeons and houseflies, and to detect different antimicrobial resistance determinants using PCR methods in these bacterial isolates.
2. Materials and methods
2.1. Ethical approval
The project was approved by the Animal Research Ethics Committee of the University of KwaZulu-Natal (Reference, AREC 071/017, and AREC 014/018). The field sampling protocols and the research were conducted in full compliance with Section 20 of the Animal Diseases Act of 1984 (Act No 35 of 1984) and were approved by the South African Department of Agriculture, Forestry and Fisheries (DAFF) (Section 20 approval reference number 12/11/1/5).
2.2. Sample collection
Samples tested in the present study were collected from different locations in the Greater Durban area in South Africa as shown in Fig. 1 as previously reported [27]. In brief, environmental fecal material and feather samples were collected from wild pigeons outside a local public hospital, in the Greater Durban area in KwaZulu-Natal Province during winter (June to August) and spring (September to November) months between 2018 and 2022. Fresh fecal samples were obtained from wild pigeons using sterile Amies agar transport swabs (Thermo Fisher Scientific, Waltham, MA, USA). Free pigeon feathers that appeared fresh and uncontaminated by pigeon feces were collected from the sampling site and were placed in screw cap tubes containing 10 mL of 0.1% peptone water. Whole flies were collected using disposable fly traps which were placed around the sample sites. The captured flies were then placed in tubes containing 70% ethanol. All samples were then transferred to the laboratory for further analysis.
Fig. 1.
Geographic map showing the locations in the Greater Durban area in KwaZulu-Natal, South Africa where samples in the present study were collected from feral pigeons and houseflies. The map was created using ArcGIS software and was reproduced with permission from [27].
2.3. Bacterial isolation
Isolation of S. aureus was performed as previously reported [27] by culturing in 0.1% peptone water and brain heart infusion broth followed by isolation on selective media using S. aureus ChromoSelect agar supplemented by egg yok tellurite emulsion (Sigma-Aldrich, St. Louis, MO, USA). Environmental fecal and feathers samples collected from wild pigeons, and samples from houseflies were used to isolate presumptive S. aureus colonies (brownish black colonies) which were then kept as glycerol stocks for further analysis.
2.4. Genomic DNA extraction from S. aureus
Genomic DNA was extracted from presumptively-identified S. aureus colonies using the standard boiling method as previously reported [26,29] and was used as a template for amplification. In brief, a volume of 400 μL from overnight bacterial culture in Tryptone Soya Broth (Sigma-Aldrich, St. Louis, MO, USA) was placed into a sterile microcentrifuge tube and centrifuged for 15 min at 15000 ×g. The supernatant was removed, and the pellet was reconstituted into 200 μL of molecular-grade, nuclease-free water, and was centrifuged for 10 min at 15000 ×g. The pellet was reconstituted in 100 μL of TE buffer and it was then boiled at 100 °C for 10 min. After boiling, the samples were centrifuged for 1 min at 15000 ×g. The final supernatant was placed in a sterile microfuge tube and DNA concentration was measured using Nanorop as previously reported [27].
2.5. PCR confirmation of S. aureus
Presumptively identified S. aureus isolates were confirmed using species-specific thermonuclease (nuc) gene PCR as previously reported [30]. Primers (Table 1) were purchased from Inqaba Biotech (Pretoria, South Africa) and successful PCR amplification of the nuc gene confirmed the presence of S. aureus. The PCR consisted of 12.5 μL 2× DreamTaq Green PCR master mix (Thermo Fisher Scientific, Waltham, MA,), 4 μL template DNA, 6.5 μL nuclease-free water, and 1 μL each of the forward and reverse primers (20 μM primer concentration), making the total volume in the tube 25 μL as previously reported [27]. PCR amplicons were visualized using 1.5% agarose gel electrophoresis using the molecular weight marker 100 bp DNA ladder (Thermo Fisher Scientific, Waltham, MA, USA). The molecular weight marker used was the 100 bp DNA ladder.
Table 1.
Staphylococcal gene specific-primers used for polymerase chain reaction for the identification and detection of antibiotic resistance determinants of S. aureus in the present study.
| Target gene | Primer name | Sequence (5′-3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|
| nuc | Primer 1 | GCGATTGATGGTGATACGGTT | 270 | [30] |
| Primer 2 | AGCCAAGCCTTGACGAACTAAAGC | |||
| mecALGA251 | mecALGA251 MultiFP | GAAAAAAAGGCTTAGAACGCCTC | 138 | [32] |
| mecALGA251 MultiRP | GAAGATCTTTTCCGTTTTCAGC | |||
| tetK | Primer K1 | CAGCAGATCCTACTCCTT | 168 | [33] |
| Primer K2 | TCGATAGGAACAGCAGTA | |||
| tetM | Primer M1 | GTGGACAAAGGTACAACGAG | 405 | [33] |
| Primer M2 | CGGTAAAGTTCGTCACACAC | |||
| ermC | Primer F | GCTAATATTGTTTAAATCGTCAATTCC | 572 | [34] |
| Primer R | GGATCAGGAAAAGGACATTTTAC | |||
| blaZ | Primer 487 | TAAGAGATTTGCCTATGCTT | 377 | [35] |
| Primer 373 | TTAAAGTCTTACCGAAAGCAG | |||
| aac (6′) – aph (2′′) | aacA-aphD 1 | TAATCCAAGAGCAATAAGGGC | 227 | [36] |
| aacA-aphD 2 | GCCACACTATCATAACCACTA |
2.6. Antimicrobial susceptibility testing
Antimicrobial susceptibility profiling was performed using the Kirby-Bauer disk diffusion method according to the Clinical Laboratory Standards Institute (CLSI) guidelines [31]. An inoculum of S. aureus isolate (0.5 McFarland standard) was added onto the surface of Mueller-Hinton agar plate (Oxoid, England), and the inoculum was allowed to dry. Antibiotic discs were placed onto the surface of the agar plates using sterile forceps. S. aureus isolates were tested for their susceptibility against ciprofloxacin (5 μg), rifampicin (5 μg), clindamycin (2 μg), linezolid (30 μg), tetracycline (30 μg), penicillin (10 units), cefoxitin (30 μg), and erythromycin (15 μg). The plates were incubated for 24 h and results were reported as the zone of inhibition (nearest whole mm) and were interpreted according to the CLSI breakpoints as previously reported [31].
2.7. Molecular detection of antimicrobial resistance genes
Antibiotic resistance genes for methicillin, tetracycline, erythromycin, β-lactamase, and aminoglycosides (mecA, tetK and tetM, ermC, blaZ, and aac (6′) – aph (2″), respectively were detected by PCR using genomic DNA as the template using specific primers as shown in (Table 1). PCR products were analyzed by electrophoresis using 1.5% agarose gels.
2.8. Statistical analysis
Pearson's Chi-Square and Fisher's Exact tests were performed using the software program SPSS version 28 (IBM SPSS Statistics) to determine significant relationship between the sample type, season of collection, and the resistance genes. A relationship was considered significant if the p value was <0.05. Association between the presence/absence of one gene to another was assessed via Pearson's Correlation.
3. Results
In the present study, we tested 57 nuc gene PCR-positive S. aureus isolates for their antibiotic susceptibility profiling and the isolates were screened for the presence of different antibiotic resistance genes using staphylococcal primer-specific PCR (Table 1). The 57 (22.62%) S. aureus isolates were obtained from 150 samples from wild pigeons (88 fecal samples and 62 feather samples) and 102 housefly samples as was recently reported [27].
Of the 57 S. aureus isolates, 48 (84.2%) isolates were resistant to penicillin, 36 (63.2%) isolates were resistant to tetracycline, 42 (73.7%) isolates were resistant to erythromycin, 45 (78.9%) isolates were resistant to linezolid, 9 (15.8%) isolates were resistant to ciprofloxacin, 47 (82.5%) isolates were resistant to clindamycin, 19 (33.3%) isolates were resistant to cefoxitin, and 48 (84.2%) isolates were resistant to rifampicin as shown in Table 2.
Table 2.
Antibiotic Susceptibility results of S. aureus isolates tested in the present study.
| Antibiotic | Susceptible* | Intermediate* | Resistant* |
|---|---|---|---|
| Penicillin | 9 | 0 | 48 |
| Tetracycline | 16 | 5 | 36 |
| Erythromycin | 10 | 5 | 42 |
| Linezolid | 12 | 0 | 45 |
| Ciprofloxacin | 42 | 6 | 9 |
| Clindamycin | 8 | 2 | 47 |
| Cefoxitin | 37 | 1 | 19 |
| Rifampicin | 8 | 1 | 48 |
Concerningly, 50 out of the 57 S. aureus isolates were resistant to two or more different antibiotic agents. One isolate was resistant to two antibiotic agents, four isolates were resistant to three antibiotic agents, two isolates were resistant to four antibiotic agents, 10 isolates were resistant to five antibiotic agents, 14 isolates were resistant to six antibiotic agents, 13 isolates were resistant to seven antibiotics, and six isolates were resistant to eight antibiotics tested. It was found that 49 isolates were resistant to three or more antimicrobial categories (classes) and were defined as multidrug resistant pathogens as previously reported [37]. One isolate was resistant to two antimicrobial categories, four isolates were resistant to three antimicrobial categories, two isolates were resistant to four antimicrobial categories, 13 isolates were resistant to five antimicrobial categories, 20 isolates were resistant to six antimicrobial categories, 10 isolates were resistant to seven antimicrobial categories as shown in Fig. 2.
Fig. 2.
Multidrug resistance of S. aureus in the present study. The figure shows the number of S. aureus isolates resistant to two, three, four, five, six and seven antimicrobial categories. It was found that 49 out of 57 isolates were resistant to three or more antimicrobial categories and were defined as multidrug resistant S. aureus as previously reported [37].
The 57 S. aureus isolates were screened for different antimicrobial resistance determinants using primer-specific PCR. It was found that out of the 57 tested isolates, 23 (40.4%) isolates were positive for the mecA gene. The most prevalent resistance gene was the tetM gene with 38 (66.7%) positive isolates, followed by the aac (‘6′) – aph (2″) gene with 23 (40.4%) positive isolates, and the tetK gene with 22 (38.6%) positive isolates.
In the present study, it was found that the antibiotic resistance gene with the lowest prevalence rate was the blaZ gene, with only two (3.5%) isolates were positive, followed by 14 (24.6%) isolates for the ermC gene. It was found that 42 (73.7%) isolates out of the 57 S. aureus isolates were positive for two or more antibiotic resistance genes, eight (14%) isolates were positive only for one antibiotic resistance gene and none of the tested six antibiotics genes were detected in seven (12.3%) S. aureus isolates in the present study. None of the isolates were positive for five or six resistance genes.
Fig. 3, Fig. 4, Fig. 5, Fig. 6 show the number of S. aureus isolates positive for each antibiotic resistance gene from different host species (Fig. 3), sample type (Fig. 4), season of sample collection (Fig. 5), and location of sample collection (Fig. 6). It was found that 21 out of 57 S. aureus isolates were positive for two resistance genes, 12 isolates were positive for three resistance genes, nine isolates were positive for four resistance genes, and none of the 57 S. aureus isolates were positive for all six resistance genes tested.
Fig. 3.
Different antimicrobial resistance genes identified in Staphylococcus aureus isolated from wild pigeons and houseflies in the present study. The figure shows that the ermC gene was detected almost exclusively in samples obtained from wild pigeons, while the aac (6’) – aph (2’’) gene was almost exclusively found in housefly samples.
Fig. 4.
Different antimicrobial resistance genes identified in S. aureus isolated from different sample types of wild pigeons and houseflies in the present study. The figure shows that the aac (6’) – aph (2’’) gene was detected more frequenty in housefly samples than in pigeon faecal samples, and was not detected in pigeon feather samples.
Fig. 5.
Different antimicrobial resistance genes identified in S. aureus isolated from wild pigeons and houseflies in different seasons (winter and spring) in the present study. The figure shows that ermC gene was found more frequently in samples collected in the winter than in samples collected in the spring, and that the aac (6’) – aph (2’’) gene was found more commonly in samples collected in the spring than in samples collected in the winter.
Fig. 6.
Different antimicrobial resistance genes identified in S. aureus isolated from wild pigeons and houseflies from four different locations in the Greater Durban area in KwaZulu-Natal Province in the present study. The figure shows different distribution of the detected resistance genes in the samples collected from different locations. Among the sampling locations, location D appeared to have a greater number of isolates carrying antimicrobial resistance genes than the other locations.
Pearson's Chi Square and Fisher's Exact tests were performed to determine if there was a statistically significant (p < 0.05) relationship between the sample type, season of sample collection, location of sample collection, and host species and whether the different antimicrobial resistance genes were present (Table 3). Analysis revealed that there is a statistically significant relationship (p < 0.05) between the sample type and tetM, ermC, and aac (6′) – aph (3″) antimicrobial resistance genes, as well as these three antimicrobial resistance genes and the location of sample collection and the host species. Analysis also revealed a statistically significant relationship between the season of sample collection and ermC and aac (6′) – aph (2″) antimicrobial resistance genes. Analysis showed significant correlations between aac (6′) – aph (2″) gene and the tetM gene (0.506) and the ermC gene (−0.386), but no other significant correlations were found (Table 4).
Table 3.
Probability values for Fisher's Exact and Pearson's Chi-Square tests used to test the relationship between the detected antimicrobial resistance genes and the sample type, season, location, and host species.
|
Antibiotic Resistance Gene |
Sample Type |
Season |
Location |
Host Species |
||||
|---|---|---|---|---|---|---|---|---|
|
P-Values |
||||||||
| Pearson's Chi Square | Fisher's Exact | Pearson's Chi Square | Fisher's Exact | Pearson's Chi Square | Fisher's Exact | Pearson's Chi Square | Fisher's Exact | |
| mecA | 0.624 | 0.624 | 0.117 | 0.117 | 0.142 | 0.118 | 0.138 | 0.138 |
| tetK | 0.498 | 0.498 | 0.566 | 0.566 | 0.311 | 0.425 | 0.201 | 0.201 |
| tetM | <0.001⁎ | <0.001⁎ | 0.151 | 0.151 | <0.001⁎ | <0.001⁎ | <0.001⁎ | <0.001⁎ |
| ermC | 0.002⁎ | <0.001⁎ | 0.018⁎ | 0.018⁎ | 0.004⁎ | <0.001⁎ | <0.001⁎ | <0.001⁎ |
| blaZ | 1 | 1 | 0.254 | 0.254 | 0.071 | 0.071 | 0.709 | 0.709 |
| aac-aph | <0.001⁎ | <0.001⁎ | <0.001⁎ | <0.001⁎ | <0.001⁎ | <0.001⁎ | <0.001⁎ | <0.001⁎ |
Figure is significant at the 0.05 level.
Table 4.
Pearson's Correlation values used to determine the association between antibiotic resistance genes, p-values were shown in brackets.
|
Correlations |
||||||
|---|---|---|---|---|---|---|
| mecA | tetK | tetM | ermC | blaZ | aac_aph | |
| mecA | 1 | 0.156 (0.247) | 0.126 (0.349) | −0.054 (0.690) | 0.038 (0.782) | 0.125 (0.353) |
| tetK | 0.156 (0.247) | 1 | 0.025 (0.851) | 0.217 (0.104) | −0.151 (0.262) | 0.009 (0.947) |
| tetM | 0.126 (0.349) | 0.025 (0.851) | 1 | −0.202 (0.132) | 0.135 (0.317) | 0.506⁎ (<0.001) |
| ermC | −0.054 (0.690) | 0.217 (0.104) | −0.202 (0.132) | 1 | 0.113 (0.404) | −0.386⁎ (0.003) |
| blaZ | 0.038 (0.782) | −0.151 (0.262) | 0.135 (0.317) | 0.113 (0.404) | 1 | 0.038 (0.782) |
| aac_aph | 0.125 (0.353) | 0.009 (0.947) | 0.506⁎ (<0.001) | −0.386⁎ (0.003) | 0.038 (0.782) | 1 |
Correlation is significant at the 0.05 level (2-tailed).
4. Discussion
S. aureus is among the most common pathogenic bacteria found in animals and humans. S. aureus produces a variety of extracellular virulence factors and proteases resulting in several infections globally such as infective endocarditis, bacteraemia, respiratory tract, urinary tract, food poisoning, and wound infections [27,38]. The prevalence of this bacterium in recent years can be explained by the difficulty in treating staphylococcal infections due to its escalating resistance levels to commonly used antibiotic agents. Furthermore, the inevitable emergence of resistant strains and multidrug resistance (MDR) is alarming, which is mainly due to the inappropriate use of antibiotics in healthcare and agricultural sectors such as livestock growth promoters and for prophylaxis [39]. The increasing trends in MDR in S. aureus isolates was reported from South Africa [26,40,41] and other countries [[42], [43], [44], [45]].
In the current study, we determined the antibiotic resistance profiling and investigated six antibiotic resistance genes using PCR in 57 S. aureus which were isolated from 252 samples obtained from wild pigeons and houseflies in the Greater Durban area in KwaZulu-Natal Province, South Africa as previosuly reported [27].
In the present study, the prevalence rate (22.62%) of S. aureus obtained from wild pigeons and housefly samples was higher than the prevalence rate of 12.7% of S. aureus isolated from environmental samples collected from different frequently touched sites in public hospitals in KwaZulu-Natal province [26]. The prevalence rate in the present study was lower than prevalence rates of 53.6% and 53.8% from commercial broiler chicken and livestock samples, respectively as previously reported [40,41]. This may be explained by differences in sample types, hosts, location and time of sample collection between these studies in KwaZulu-Natal, South Africa.
Different prevalence rates of S. aureus were reported from other countries, such as in a study from Iran, a prevalence rate of 6.61% in raw milk samples collected from different shopping centres was reported [43]. A rate of 85% prevalence was reported from samples collected from two hospitals in Egypt [44]. Furthermore, different prevalence rates of 94%, 57.8%, 53.3%, 43.4%, 27.8%, 27.3%, and 3.9%, were reported from the UK, Greece, Brazil, New Zealand, USA, Japan, and China, respectively [[45], [46], [47], [48], [49], [50], [51], [52]].
Altogether, these studies demonstrate the widespread distribution of S. aureus in humans, livestock, and ubiquitous environments. In the present study, the detection of S. aureus in wild pigeons and houseflies in the surrounding environment of public hospitals is alarming.
The possibility of transmission of pigeon-originated S. aureus due to contamination of hospital surroundings from droppings of pigeons via fomites, and mechanical housefly vectors require close monitoring of hygienic practices within public hospitals and the surroundings as well as routine cleaning measures. It was reported that livestock fecal material with antimicrobial resistant pathogens can reach a wider environment via food, drinking water contaminated by pigeon droppings, nesting materials, or even dead carcasses or through the air, run off and aerosolization with the possibility of airborne transmission to other susceptible hosts [[53], [54], [55], [56], [57], [58]].
Furthermore, pigeons are identified as a reservoir of airborne pathogens which represent a health hazard and may be associated with exposure to airborne microorganisms and lead to airborne transmission when pigeons are in close proximity to humans, and other animal hosts. It was previously reported that pathogens of public health and veterinary health significance such as Escherichia coli, Enterococcus faecium, Clostridium spp., Salmonella sp., and Staphylococcus aureus were detected in the air in a Danish pigeon house [59,60].
Staphylococcus aureus is a risk Group 2 human pathogen which in livestock farms [41,59,61] can be present in an antibiotic-resistant variant known as methicillin-resistant S. aureus (MRSA), a highly resistant pathogen.
Alarmingly, in the present study, it was found that 49 S. aureus isolates were phenotypically resistant to three or more antimicrobial categories and were defined as multidrug resistant pathogens as previously reported [37]. Furthermore, it was found that 42 (73.7%) isolates out of the 57 S. aureus isolates were positive for two (n = 21), three (n = 12) or four (n = 9) antibiotic resistance genes, 8 (14%) isolates were positive only for one antibiotic resistance gene and none of the tested six antibiotics genes were detected in 7 (12.3%) S. aureus isolates in the present study.
In the present study, the 57 S. aureus isolates were highly resistant to penicillin and rifampicin with a rate of 84.2%, and these results concur with a previous study from KwaZulu-Natal Province [41]. The current findings were compared with those of Mkhize et al. [26], and an increase in the resistance rates of the tested antibiotics except for ciprofloxacin was observed for the isolates tested. However, the antibiotic susceptibility trends of S. aureus in the present study were different from data reported from other countries [62,63], most likely explained by differences in patterns of antibiotic usage in each country and sample hosts, types, and time of collection.
The escalating antimicrobial resistance levels detected in S. aureus is concerning and could result in difficult-to-treat infection [64]. The prevalence of β-lactam, tetracycline, erythromycin, and methicillin resistance genes in S. aureus isolates collected from different locations in KwaZulu-Natal Province was previously reported [26,40,41]. The detection of virulence factors and antibiotic resistance in Staphylococci isolated from pigeons was reported in other countries [[65], [66], [67], [68], [69], [70], [71]]. Few studies reported the detection of parasitic diseases [72], pigeon paramyxoviruses (Newcastle disease virus) [73], and opportunistic fungi [74] in feral pigeons in South Africa. To the authors' knowledge, no information is available related to the isolation and antimicrobial susceptibility of S. aureus and other bacterial pathogens isolated from wild pigeons in South Africa. Nonetheless, very few data is availabe on viral agents in wild pigeons in South Africa.
In the present study, the phenotypic resistance to penicillin, tetracycline, and erythromycin was supported by the molecular detection of blaZ, tetK/tetM, and ermC resistance genes, which is similar to previously studies which reported blaZ, mecA, aacA-aphD, ermB, ermC, tetK, tetL, and tetM resistance genes in antibiotic-resistant S. aureus isolates [[75], [76], [77]].
Methicillin-resistant S. aureus (MRSA) is a notorious pathogen, potential superbug and a major threat to hospitalized patients and the community [32]. In the present study, ten (52.6%) out of the 19 cefoxitin-resistant S. aureus isolates were mecA gene positive. In contrast, higher mecA gene occurrence rates of 82.7% and 100% of cefoxitin-resistant MRSA isolates were previously reported in China and Nigeria [78,79], and a lower mecA gene occurrence (5.5%) was previously reported in MRSA in Egypt [80].
In the present study, nine (47.4%) out of the 19 cefoxitin-resistant S. aureus isolates did not harbour mecA gene similar to a finding reported elsewhere [81]. The lack of mecA detection in cefoxitin-resistant S. aureus isolates in the present study requires further investigations, however it may be explained by possible existing resistance mechanisms such as mecA gene variant, hyperproduction of β-lactamases, and altered affinity of penicillin-binding protein [82].
Interestingly, it was found that 13 (56.5%) out of 23 mecA positive S. aureus were cefoxitin-sensitive, in other words 13 (35.1%) out of 37 cefoxitin-sensitive isolates were mecA positive in the present study. Such cryptic resistance among cefoxitin and oxacillin susceptible mecA-positive S. aureus was referred to as “stealth” MRSA [83] and was previously reported in strains isolated from patients and food worldwide [[84], [85], [86], [87]].
The finding of mecA positive S. aureus isolates in the present study requires further investigation and genomic characterization because the underlying mechanisms for this “stealth” MRSA may be complicated and several factors are involved in the resistance to methicillin-like antibiotics in MRSA [83].
The findings of the present study showed low prevalence rates of ermC and blaZ genes, encoding resistance to erythromycin and β-lactams, respectively. However, the results of the present study showed high prevalence rates of aac (6′) – aph (2″) gene encoding aminoglycoside resistance. The results of the current study differ from those reported in China, where the prevalence rates of β-lactams resistance genes were higher, but the prevalence rates of other tested genes were lower than the current results [88]. The antibiotic resistance rates of S. aureus isolated from pigeons in the present study were higher than resistance rates of S. aureus isolated from pigeons reported from Italy [70]. In contrast, the detection of different bacterial pathogens of public health importance isolated from pigeons in Egypt and their antibiotic susceptibility testing were reported and it was found that the prevalence rates of S. aureus isolated from pigeon samples were lower than those in the present study [89].
In the present study, 49 out of 57 S. aureus isolates displayed multidrug-resistant phenotype and mecA gene was detected in 23 isolates. In a study from Poland, high diversity of Staphylococcus species except S. aureus was reported and coagulase-negative staphylococci were predominantly isolated from pigeon samples [45]. Contrary to the findings of the present study, none of Staphylococcus isolates reported in the Polish pigeon study displayed a multidrug-resistant phenotype and mecA gene was not detected in the examined strains and no methicillin-resistant staphylococci were found in pigeons [45]. In contrast, all S. aureus strains isolated from fecal samples obtained from pigeons in Brazil were susceptible to the tested antibiotics [69]. The detection of MDR phenotype in S. aureus isolates in the present study was consistent with a study from Poland which reported methicillin resistance Staphylococcus strains isolated from pigeons [90]. Also, a methicillin-resistant S. aureus strain was isolated from a pigeon co-infected with pigeon pox virus [13] and MRSA isolates were detected in the air in pigeon exhibitions in Denmark [71]. A number of pigeon samples were tested and were found to be coinfected with other bacterial and viral pathogens which are beyond the scope of the present study and will be reported elsewhere (Unpublished data, manuscripts in preparation, El Zowalaty, M.E.). The differences in resistance trends between the present study and other studies elsewhere may be explained by the perplexing nature of antimicrobial resistance and multiple contributing factors such as different host species, sample types, time of sample collection, and practices and levels of antibiotic use in the different countries.
In the present study, statistical analysis showed that mecA, tetK, and blaZ genes had no statistically significant (p > 0.05) relationship with any variables assessed, but tetM, ermC, and aac (6′) – aph (3″) had statistically significant (p < 0.05) relationships to the sample type, location, and host species, and ermC and aac (6′) – aph (3″) genes had significant relationships to the season of sample collection.
Analysis also revealed that tetM gene detected in S. aureus isolated from housefly samples was significantly (p < 0.05) greater than the same gene found in S. aureus isolated from pigeon samples. The same finding was observed for ermC and aac (6′) – aph (2″) genes, and for ermC gene, a significantly greater number of positive isolates were detected in winter months (June, July, and August), and for aac (6′) – aph (2″) gene, a significantly greater number of positive isolates came from the spring months (September, October, and November).
Correlation analysis revealed that aac (6′) – aph (2″) gene was found to be significantly correlated to two other genes, tetM and ermC genes. There was a medium strength, positive correlation with tetM gene, meaning that if one of these genes was present, there was a significant chance of the other gene also being present, whereas with ermC gene, there was a medium strength negative correlation, meaning that if the gene was present there was a significant chance the other gene would not be present. This finding is similar to previous study by Mkhize et al. [26] which also reproted a positive correlation between aac (6′) – aph (2″) and tetM genes, but a positive, and not negative, correlation between ermC gene and aac (6′) – aph (2″) genes. This may be explained by the increase in aac (6′) – aph (2″) gene prevalence and decrease in ermC prevalence, which most likely influenced the results of the correlation analysis.
In conclusion, we report the detection of methicillin and multiple antibiotic resistant S. aureus in fecal droppings and feather samples obtained from free-flying wild pigeons in the vicinity of local public hospitals for the first time in South Africa. The wild pigeons included in the present study came from flocks inhabiting zones close to human activities; therefore, there is a possibility of contact between the pigeons and humans, which may result in zoonotic antimicrobial resistance and possibly zoonotic infections. S. aureus isolates in the present study were alarmingly resistant to commonly used antibiotics which represents an increased concern to public health and veterinary health concerning the possible transmission of S. aureus and other harbored viral, bacterial, fungal or parasitic agents to other susceptible hosts including human, animal, and poultry. Altogether, the findings of the present study highlight the significance of close monitoring of antimicrobial resistant S. aureus and surveillance for pathogens in wildlife. The findings of the present study demonstrated that the emergence and spread of methicillin-resistant S. aureus in wild pigeons in South Africa requires a special attention nationally and worldwide. The presented data strongly suggest and recommend the implementation of future studies to identify other bacterial species, viruses, fungal and parasitic pathogens, in addition to multidrug-resistant bacteria in order to delineate and explore the potential role of such birds in the dissemination of infectious diseases and to counteract future pandemics pigeons may be implicated in via zoonotic spillover events. The detection of methicillin and multidrug resistance in S. aureus isolated from wild pigeons in South Africa are of grave public health and veterinary health concerns since the pigeon-originated antibiotic resistance genes can potentially spread further to other hosts, local and global communities. Therefore, implementing molecular and genomic surveillance programs are significant for early detection of zoonotic transfer of antibiotic resistance genes. Additionally, strengthening infection prevention and control measures in urban public areas and the surrounding environment of hospitals, particularly on surfaces and areas where pigeons can access is crucial. Furthermore, the conclusions of the present study highlight the significance of wildlife and the environment as interconnected contributors of One Health.
Funding
This work was supported by the South African National Research Foundation through the Thuthuka Funding Instrument (grant number TTK170411226583).
CRediT authorship contribution statement
Trevor K. Wilson: Methodology, Formal analysis, Visualization, Data curation, Investigation, Validation, Writing – original draft, Writing – review & editing. Oliver T. Zishiri: Conceptualization, Methodology, Formal analysis, Investigation, Data curation, Supervision, Funding acquisition, Project administration, Resources, Software, Validation, Visualization, Writing – original draft, Writing – review & editing. Mohamed E. El Zowalaty: Conceptualization, Methodology, Investigation, Data curation, Formal analysis, Investigation, Visualization, Validation, Writing – original draft, Writing – review & editing, Project administration, Supervision, Funding acquisition.
Conflicts of interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this manuscript.
Acknowledgement
The authors would like to thank staff and postgraduate students from the Discipline of Genetics, University of KwaZulu-Natal, Westville Campus, for their continued support and administrative assistance.
Data availability
Data are available upon reasonable request.
References
- 1.Martinez J.L., Baquero F., Andersson D.I. Beyond serial passages: new methods for predicting the emergence of resistance to novel antibiotics. Curr. Opin. Pharmacol. 2011;11:439–445. doi: 10.1016/j.coph.2011.07.005. [DOI] [PubMed] [Google Scholar]
- 2.Laborda P., Sanz-García F., Ochoa-Sánchez L.E., Gil-Gil T., Hernando-Amado S., Martínez J.L. Wildlife and antibiotic resistance. Front. Cell. Infect. Microbiol. 2022;11(12) doi: 10.3389/fcimb.2022.873989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Giacopello C., Foti M., Mascetti A., Grosso F., Ricciardi D., Fisichella V., Piccolo F.L. Antimicrobial resistance patterns of Enterobacteriaceae in European wild bird species admitted in a wildlife rescue Centre. Vet. Ital. 2016;52:139–144. doi: 10.12834/VetIt.327.1374.2. [DOI] [PubMed] [Google Scholar]
- 4.Martín-Maldonado B., Vega S., Mencía-Gutiérrez A., Lorenzo-Rebenaque L., de Frutos C., González F., Revuelta L., Marin C. Urban birds: An important source of antimicrobial resistant Salmonella strains in Central Spain. Comp. Immunol. Microbiol. Infect. Dis. 2020;72 doi: 10.1016/j.cimid.2020.101519. [DOI] [PubMed] [Google Scholar]
- 5.Velazquez-Meza M.E., Galarde-López M., Carrillo-Quiróz B., Alpuche-Aranda C.M. Antimicrobial resistance: one health approach. Vet World. 2022;15(3):743–749. doi: 10.14202/vetworld.2022.743-749. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.McEwen S.A., Collignon P.J. Antimicrobial resistance: a one health perspective. Microbiol Spectr. 2018;6(2) doi: 10.1128/microbiolspec.ARBA-0009-2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Russo T.P., Pace A., Varriale L., Borrelli L., Gargiulo A., Pompameo M., Fioretti A., Dipineto L. Prevalence and antimicrobial resistance of enteropathogenic bacteria in yellow-legged gulls (Larus michahellis) in southern Italy. Animals. 2021;11:275. doi: 10.3390/ani11020275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Marcelino V.R., Wille M., Hurt A.C., et al. Meta-transcriptomics reveals a diverse antibiotic resistance gene pool in avian microbiomes. BMC Biol. 2019;17:31. doi: 10.1186/s12915-019-0649-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Vittecoq M., Godreuil S., Prugnolle F., Durand P., Brazier L., Renaud N., et al. Antimicrobial resistance in wildlife. J. Appl. Ecol. 2016;53:519–529. [Google Scholar]
- 10.Carter D.L., Docherty K.M., Gill S.A., Baker K., Teachout J., Vonhof M.J. Antibiotic resistant bacteria are widespread in songbirds across rural and urban environments. Sci. Total Environ. 2018;627:1234–1241. doi: 10.1016/j.scitotenv.2018.01.343. [DOI] [PubMed] [Google Scholar]
- 11.White A., Hughes J.M. Critical importance of a one health approach to antimicrobial resistance. EcoHealth. 2019;16:404–409. doi: 10.1007/s10393-019-01415-5. [DOI] [PubMed] [Google Scholar]
- 12.Donegan T.M. Case 3692 Columba livia Gmelin, 1789 and Columba livia domestica Linnaeus, 1758 (Aves, Columbidae): proposed conservation of specific and subspecific names in conformance with prevailing usage. The Bulletin of Zoological Nomenclature. 2016;73(1):30–41. doi: 10.21805/bzn.v73i1.a20. [DOI] [Google Scholar]
- 13.Chrobak-Chmiel D., Kwiecień E., Golke A., Dolka B., Adamczyk K., Biegańska M.J., Spinu M., Binek M., Rzewuska M. Pigeons as carriers of clinically relevant multidrug-resistant pathogens-A clinical case report and literature review. Front Vet Sci. 2021;24(8) doi: 10.3389/fvets.2021.664226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Morakchi H., Loucif L., Gacemi-Kirane D., Rolain J.M. Molecular characterisation of carbapenemases in urban pigeon droppings in France and Algeria. J Glob Antimicrob Resist. 2017;9:103–110. doi: 10.1016/j.jgar.2017.02.010. [DOI] [PubMed] [Google Scholar]
- 15.Vázquez B., Esperón F., Neves E., et al. Screening for several potential pathogens in feral pigeons (Columba livia) in Madrid. Acta Vet. Scand. 2010;52:45. doi: 10.1186/1751-0147-52-45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Lillehaug A., Monceyron Jonassen C., Bergsjo B., Hofshagen M., Tharaldsen J., Nesse L.L., Handeland K. Screening of feral pigeon (Colomba livia), mallard (Anas platyrhynchos) and graylag goose (Anser anser) populations for Campylobacter spp., Salmonella spp., avian influenza virus and avian paramyxovirus. Acta Vet. Scand. 2005;46:193–202. doi: 10.1186/1751-0147-46-193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Casanovas L., de Simon M., Ferrer M.D., Arques J., Monzon G. Intestinal carriage of campylobacters, salmonellas, yersinias and listerias in pigeons in the city of Barcelona. J. Appl. Bacteriol. 1995;78:11–13. doi: 10.1111/j.1365-2672.1995.tb01666.x. [DOI] [PubMed] [Google Scholar]
- 18.Bupasha Z.B., Begum R., Karmakar S., Akter R., Bayzid M., Ahad A., et al. Multidrug-resistant Salmonella spp. isolated from apparently healthy pigeons in a live bird market in Chattogram, Bangladesh. World’s. Vet. J. 2020;10(4):508–513. doi: 10.29252/scil.2020.wvj61. [DOI] [Google Scholar]
- 19.Magnino S., Haag-Wackernagel D., Geigenfeind I., Helmecke S., Dovc A., Prukner-Radovcić E., Residbegović E., Ilieski V., Laroucau K., Donati M., Martinov S., Kaleta E.F. Chlamydial infections in feral pigeons in Europe: review of data and focus on public health implications. Vet. Microbiol. 2009;135(1–2):54–67. doi: 10.1016/j.vetmic.2008.09.045. [DOI] [PubMed] [Google Scholar]
- 20.Perez-Sancho M., Garcia-Seco T., Porrero C., Garcia N., Gomez-Barrero S., Cámara J.M., Dominguez L., Álvarez J. A ten-year-surveillance program of zoonotic pathogens in feral pigeons in the City of Madrid (2005--2014): the importance of a systematic pest control. Res. Vet. Sci. 2020;128:293–298. doi: 10.1016/j.rvsc.2019.12.006. [DOI] [PubMed] [Google Scholar]
- 21.Rose E., Nagel P., Haag-Wackernagel D. Spatio-temporal use of the urban habitat by feral pigeons (Columba livia) Behav. Ecol. Soc. 2006;60:242–254. [Google Scholar]
- 22.Mia M.M., Hasan M., Hasnath M.R. Global prevalence of zoonotic pathogens from pigeon birds: A systematic review and meta-analysis. Heliyon. 2022;8(6) doi: 10.1016/j.heliyon.2022.e09732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Haag-Wackernagel D., Moch H. Health hazards posed by feral pigeons. J. Infect. 2004;48(4):307–313. doi: 10.1016/j.jinf.2003.11.001. [DOI] [PubMed] [Google Scholar]
- 24.WHO . World Health Organization; GLASS report, Geneva: 2017. Global antimicrobial resistance surveillance system.https://apps.who.int/iris/bitstream/handle/10665/279656/9789241515061-eng.pdf?ua=1 [Google Scholar]
- 25.Tacconelli E., Carrara E., Savoldi A., Harbarth S., Mendelson M., Monnet D.L., Pulcini C., Kahlmeter G., Kluytmans J., Carmeli Y., Ouellette M., Outterson K., Patel J., Cavaleri M., Cox E.M., Houchens C.R., Grayson M.L., Hansen P., Singh N., Theuretzbacher U., Magrini N., WHO Pathogens Priority List Working Group Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis. 2018;18(3):318–327. doi: 10.1016/S1473-3099(17)30753-3. [DOI] [PubMed] [Google Scholar]
- 26.Mkhize S., Amoako D.G., Shobo C.O., Zishiri O.T., Bester L.A. Genotypic and phenotypic characterizations of methicillin-resistant Staphylococcus aureus (MRSA) on frequently touched sites from public hospitals in South Africa. Int. J. Microbiol. 2021;23(2021):6011045. doi: 10.1155/2021/6011045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Wilson T.K., Zishiri O.T., El Zowalaty M.E. Molecular detection of virulence genes in Staphylococcus aureus isolated from wild pigeons (Columba domestica livia) in KwaZulu-Natal in South Africa. One Health. 2024;18:100656. doi: 10.1016/j.onehlt.2023.100656. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ebani V.V., Guardone L., Bertelloni F., Perrucci S., Poli A., Mancianti F. Survey on the presence of bacterial and parasitic zoonotic agents in the feces of wild birds. Vet Sci. 2021;8(9):171. doi: 10.3390/vetsci8090171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Queipo-Ortuño Maria I., et al. Preparation of bacterial DNA template by boiling and effect of immunoglobulin G as an inhibitor in real-time PCR for serum samples from patients with brucellosis. Clin. Vaccine Immunol. 2008;15(2):293–296. doi: 10.1128/CVI.00270-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Brakstad O.G., Aasbakk K., Maeland J.A. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 1992;30(7):1654–1660. doi: 10.1128/jcm.30.7.1654-1660.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Clinical Laboratory Standards Institute, C . Clinical and Laboratory Standards Institute; Wayne, PA: 2017. Performance Standards for Antimicrobial Susceptibility Testing; pp. 1–13. [Google Scholar]
- 32.Stegger M., Andersen P.S., Kearns A., Pichon B., Holmes M.A., Edwards G., Laurent F., Teale C., Skov R., Larsen A.R. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecALGA251. Clin. Microbiol. Infect. 2012;18:395–400. doi: 10.1111/j.1469-0691.2011.03715.x. [DOI] [PubMed] [Google Scholar]
- 33.Warsa U.C., Nonoyama M., Ida T., Okamoto R., Okubo T., Shimauchi C., Kuga A., Inoue M. Detection of tet(K) and tet(M) in Staphylococcus aureus of Asian countries by the polymerase chain reaction. J. Antibiot. 1996;49:1127–1132. doi: 10.7164/antibiotics.49.1127. [DOI] [PubMed] [Google Scholar]
- 34.Lina G., Quaglia A., Reverdy M.E., Leclercq R., Vandenesch F., Etienne J. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrob Agents Chemother. 1999;43(5):1062–1066. doi: 10.1128/AAC.43.5.1062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Olsen J.E., Christensen H., Aarestrup F.M. Diversity and evolution of blaZ from Staphylococcus aureus and coagulase-negative staphylococci. J. Antimicrob. Chemother. 2006;57:450–460. doi: 10.1093/jac/dki492. [DOI] [PubMed] [Google Scholar]
- 36.Strommenger B., Kettlitz C., Werner G., Witte W. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J Clin Microbiol. 2003;41(9):4089–4094. doi: 10.1128/JCM.41.9.4089-4094.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Magiorakos A.P., Srinivasan A., Carey R.B., Carmeli Y., Falagas M.E., Giske C.G., Harbarth S., Hindler J.F., Kahlmeter G., Olsson-Liljequist B., Paterson D.L., Rice L.B., Stelling J., Struelens M.J., Vatopoulos A., Weber J.T., Monnet D.L. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012;18(3):268–281. doi: 10.1111/j.1469-0691.2011.03570.x. [DOI] [PubMed] [Google Scholar]
- 38.Guo Y., et al. Prevalence and therapies of antibiotic-resistance in Staphylococcus aureus. Front. Cell. Infect. Microbiol. 2020;10:107. doi: 10.3389/fcimb.2020.00107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Algammal A.M., et al. Methicillin-resistant Staphylococcus aureus (MRSA): one health perspective approach to the bacterium epidemiology, virulence factors, antibiotic-resistance, and zoonotic impact. Infect Drug Resist. 2020;13:3255–3265. doi: 10.2147/IDR.S272733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Mkize N., Zishiri O.T., Mukaratirwa S. Genetic characterisation of antimicrobial resistance and virulence genes in Staphylococcus aureus isolated from commercial broiler chickens in the Durban metropolitan area, South Africa. J. S. Afr. Vet. Assoc. 2017;88(0):e1–e7. doi: 10.4102/jsava.v88i0.1416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Dweba C.C., Zishiri O.T., El Zowalaty M.E. Isolation and molecular identification of virulence, antimicrobial and heavy metal resistance genes in livestock-associated methicillin-resistant Staphylococcus aureus. Pathogens. 2019;8(2):1–22. doi: 10.3390/pathogens8020079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Gurung R.R., Maharjan P., Chhetri G.G. Antibiotic resistance pattern of Staphylococcus aureus with reference to MRSA isolates from pediatric patients. Future Science OA. 2020;6(4):FSO464. doi: 10.2144/fsoa-2019-0122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Rahi A., et al. Genotypic and phenotypic-based assessment of antibiotic resistance and profile of staphylococcal cassette chromosome mec in the methicillin-resistant Staphylococcus aureus recovered from raw Milk. Infect. Drug Resis. 2020;13:273–283. doi: 10.2147/IDR.S229499. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Nour El-Din H.T., et al. Phenotype-genotype characterization and antibiotic-resistance correlations among colonizing and infectious methicillin-resistant Staphylococcus aureus recovered from intensive care units. Infect. Drug Resis. 2021;14:1557–1571. doi: 10.2147/IDR.S296000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Szczuka E., Wesołowska M., Krawiec A., Kosicki J.Z. Staphylococcal species composition in the skin microbiota of domestic pigeons (Columba livia domestica) PLoS One. 2023;18(7) doi: 10.1371/journal.pone.0287261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Da Silva A.C., Rodrigues M.X., Silva N.C.C. Methicillin-resistant Staphylococcus aureus in food and the prevalence in Brazil: a review. Braz. J. Microbiol. 2020;51(1):347–356. doi: 10.1007/s42770-019-00168-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Dai J., et al. Prevalence and characterization of Staphylococcus aureus isolated from pasteurized Milk in China. Front. Microbiol. 2019;10:1–10. doi: 10.3389/fmicb.2019.00641. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Hirose M., et al. Prevalence and genetic characteristics of methicillin-resistant Staphylococcus aureus and coagulase-negative staphylococci isolated from Oral cavity of healthy children in Japan. Microb. Drug Resist. 2019;25(3):400–407. doi: 10.1089/mdr.2018.0333. [DOI] [PubMed] [Google Scholar]
- 49.Hobbs M.R., et al. Staphylococcus aureus colonisation and its relationship with skin and soft tissue infection in New Zealand children. Eur. J. Clin. Microbiol. Infect. Dis. 2018;37(10):2001–2010. doi: 10.1007/s10096-018-3336-1. [DOI] [PubMed] [Google Scholar]
- 50.Papadopoulos P., et al. Prevalence of Staphylococcus aureus and of methicillin-resistant S. Aureus (MRSA) along the production chain of dairy products in North-Western Greece. Food Microbiol. 2018;69:43–50. doi: 10.1016/j.fm.2017.07.016. [DOI] [PubMed] [Google Scholar]
- 51.Thapaliya D., et al. Prevalence and molecular characterization of Staphylococcus aureus in commercially available meat over a one-year period in Iowa, USA. Food Microbiol. 2017;65:122–129. doi: 10.1016/j.fm.2017.01.015. [DOI] [PubMed] [Google Scholar]
- 52.White DG, Ayers S, Maurer JJ, Thayer SG, Hofacre C. Antimicrobial susceptibilities of Staphylococcus aureus isolated from commercial broilers in northeastern Georgia. Avian Dis. 2003;47(1):203–10. doi: 10.1637/0005-2086(2003)047[0203:ASOSAI]2.0.CO;2. [DOI] [PubMed]
- 53.He Y., Yuan Q., Mathieu J., Stadler L., Senehi N., Sun R., Alvarez P.J. Antibiotic resistance genes from livestock waste: occurrence, dissemination, and treatment. NPJ Clean Water. 2020;3(1):4. [Google Scholar]
- 54.Huijbers P.M., Flach C.F., Larsson D.J. A conceptual framework for the environmental surveillance of antibiotics and antibiotic resistance. Environ. Int. 2019;130 doi: 10.1016/j.envint.2019.05.074. [DOI] [PubMed] [Google Scholar]
- 55.Woolhouse M., Ward M., Van Bunnik B., Farrar J. Antimicrobial resistance in humans, livestock and the wider environment. Philos. Trans. R. Soc. B. 2015;370(1670):20140083. doi: 10.1098/rstb.2014.0083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Luiken R.E., Heederik D.J., Scherpenisse P., Van Gompel L., van Heijnsbergen E., Greve G.D., Jongerius-Gortemaker B.G., Tersteeg-Zijderveld M.H., Fischer J., Juraschek K., Skarżyńska M., Zając M., Wasyl D., EFFORT-group, Wagenaar J.A., Smit L.A., Wouters I.M., Mevius D.J., Schmitt H. Determinants for antimicrobial resistance genes in farm dust on 333 poultry and pig farms in nine European countries. Environ. Res. 2022;15(208) doi: 10.1016/j.envres.2022.112715. [DOI] [PubMed] [Google Scholar]
- 57.Tanaka C., Miyazawa T., Watarai M., Ishiguro N. Bacteriological survey of feces from feral pigeons in Japan. J. Vet. Med. Sci. 2005;67(9):951–953. doi: 10.1292/jvms.67.951. [DOI] [PubMed] [Google Scholar]
- 58.Chae H., Park G., Kim S., Jo H., Kim J., Jeoung H., An D., Kim N., Shin B., Kang Y. Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene. Poult. Sci. 2012;91(8):1983–1989. doi: 10.3382/ps.2012-02307. [DOI] [PubMed] [Google Scholar]
- 59.Madsen A.M., Moslehi-Jenabian S., Islam M.Z., Frankel M., Spilak M., Frederiksen M.W. Concentrations of Staphylococcus species in indoor air as associated with other bacteria, season, relative humidity, air change rate, and S. aureus-positive occupants. Environ. Res. 2018;160:282–291. doi: 10.1016/j.envres.2017.10.001. [DOI] [PubMed] [Google Scholar]
- 60.Madsen A.M., White J.K., Nielsen J.L., Keskin M.E., Tendal K., Frederiksen M.W. A cross sectional study on airborne inhalable microorganisms, endotoxin, and particles in pigeon coops - risk assessment of exposure. Environ. Res. 2022;204(Pt D) doi: 10.1016/j.envres.2021.112404. [DOI] [PubMed] [Google Scholar]
- 61.Locatelli C., Cremonesi P., Caprioli A., Carfora V., Ianzano A., Barberio A., Morandi S., Casula A., Castiglioni B., Bronzo V., Moroni P. Occurrence of methicillin-resistant Staphylococcus aureus in dairy cattle herds, related swine farms, and humans in contact with herds. J. Dairy Sci. 2017;100(1):608–619. doi: 10.3168/jds.2016-11797. [DOI] [PubMed] [Google Scholar]
- 62.Senobar Tahaei S.A., et al. Correlation between biofilm-formation and the antibiotic resistant phenotype in Staphylococcus aureus isolates: A laboratory-based study in Hungary and a review of the literature. Infect. Drug Resis. 2021;14:1155–1168. doi: 10.2147/IDR.S303992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Varela-Ortiz D.F., et al. Antibiotic susceptibility of Staphylococcus aureus isolated from subclinical bovine mastitis cases and in vitro efficacy of bacteriophage. Vet. Res. Commun. 2018;42(3):243–250. doi: 10.1007/s11259-018-9730-4. [DOI] [PubMed] [Google Scholar]
- 64.Chen L., et al. Biofilm production ability, virulence and antimicrobial resistance genes in Staphylococcus aureus from various veterinary hospitals. Pathogens. 2020;9(4):264–281. doi: 10.3390/pathogens9040264. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Kizerwetter-Świda M., Chrobak-Chmiel D., Rzewuska M., Antosiewicz A., Dolka B., Ledwoń A., Czujkowska A., Binek M. Genetic characterization of coagulase-positive staphylococci isolated from healthy pigeons. Pol. J. Vet. Sci. 2015;18(3):627–634. doi: 10.1515/pjvs-2015-0081. [DOI] [PubMed] [Google Scholar]
- 66.Futagawa-Saito K., Sugiyama T., Karube S., Sakurai N., Ba-Thein W., Fukuyasu T. Prevalence and characterization of leukotoxin-producing Staphylococcus intermedius in isolates from dogs and pigeons. J. Clin. Microbiol. 2004;42(11):5324–5326. doi: 10.1128/JCM.42.11.5324-5326.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Schwarz S., Werckenthin C. Antibiotic resistance in staphylococci isolated from pigeons. Vet. Dermatol. 1994;5(1):9–12. doi: 10.1111/j.1365-3164.1994.tb00003.x. [DOI] [PubMed] [Google Scholar]
- 68.Wakita Y., Shimizu A., Hájek V., Kawano J., Yamashita K. Characterization of Staphylococcus intermedius from pigeons, dogs, foxes, mink, and horses by pulsed-field gel electrophoresis. J. Vet. Med. Sci. 2002;64(3):237–243. doi: 10.1292/jvms.64.237. [DOI] [PubMed] [Google Scholar]
- 69.Vasconcellos H.V.G., Silva K.F.B., Montenegro H., Miguel C.B., Tizioto P., Agostinho F., Araújo M.C., Ribas R.M., Silva M.V.D., Soares S.C., Rodrigues Júnior V., Batistão D.W.D.F., Oliveira C.J.F., Rodrigues W.F. Staphylococcus aureus and Enterococcus faecium isolated from pigeon droppings (Columba livia) in the external environment close to hospitals. Rev. Soc. Bras. Med. Trop. 2022;22(55) doi: 10.1590/0037-8682-0353-2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Losito P., Vergara A., Muscariello lT, Ianieri A. Antimicrobial susceptibility of environmental Staphylococcus aureus strains isolated from a pigeon slaughterhouse in Italy. Poult. Sci. 2005;84(11):1802–1807. doi: 10.1093/ps/84.11.1802. [DOI] [PubMed] [Google Scholar]
- 71.Madsen A.M., Zhang F., Zeng Y., Frederiksen M.W. Airborne methicillin-resistant Staphylococcus aureus, other bacteria, fungi, endotoxin, and dust in a pigeon exhibition. Environ. Res. 2023;216(Pt 2) doi: 10.1016/j.envres.2022.114642. [DOI] [PubMed] [Google Scholar]
- 72.Huchzermeyer F.W. An introduction to diseases of pigeons in South Africa. J. S. Afr. Vet. Assoc. 1978;49(2):107–108. [PubMed] [Google Scholar]
- 73.Abolnik C., Gerdes G.H., Kitching J., Swanepoel S., Romito M., Bisschop S.P. Characterization of pigeon paramyxoviruses (Newcastle disease virus) isolated in South Africa from 2001 to 2006. Onderstepoort J. Vet. Res. 2008;75(2):147–152. doi: 10.4102/ojvr.v75i2.13. [DOI] [PubMed] [Google Scholar]
- 74.Syakalima M., Ramatla T., Lubanza N. Opportunistic pathogenic fungi isolated from feces of feral pigeons in Mafikeng, north West Province of South Africa. Vet World. 2019;12(7):1066–1069. doi: 10.14202/vetworld.2019.1066-1069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Zehra A., Gulzar M., Singh R., Kaur S., Gill J.P.S. Prevalence, multidrug resistance and molecular typing of methicillin-resistant Staphylococcus aureus (MRSA) in retail meat from Punjab, India. J. Global Antimicrobial Res. 2019;16:152–158. doi: 10.1016/j.jgar.2018.10.005. [DOI] [PubMed] [Google Scholar]
- 76.Abbasi K., Tajbakhsh E., Momtaz H. Antimicrobial resistance, virulence genes, and biofilm formation in Staphylococcus aureus strains isolated from meat and meat products. J. Food Saf. 2021;41(6) doi: 10.1111/jfs.12933. [DOI] [Google Scholar]
- 77.Bernier-Lachance J., Arsenault J., Usongo V., Parent E., Labrie J., Jacques M., et al. Prevalence and characteristics of livestock-associated methicillin-resistant Staphylococcus aureus (LA-MRSA) isolated from chicken meat in the province of Quebec, Canada. PLoS One. 2020;15(1) doi: 10.1371/journal.pone.0227183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Igbinosa E.O., Beshiru A., Igbinosa I.H., Ogofure A.G., Ekundayo T.C., Okoh A.I. Prevalence, multiple antibiotic resistance and virulence profile of methicillin-resistant Staphylococcus aureus (MRSA) in retail poultry meat from Edo, Nigeria. Front. Cell. Infect. Microbiol. 2023;2(13):1122059. doi: 10.3389/fcimb.2023.1122059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Li Q., Li Y., Tan Y., Meng C., Ingmer H., Jiao X. Prevalence and characterisation of Staphylococcus aureus and Staphylococcus argenteus in chicken from retail markets in China. Food Control. 2019;96:158–164. doi: 10.1016/j.foodcont.2018.08.030. [DOI] [Google Scholar]
- 80.Abolghait S.K., Fathi A.G., Youssef F.M., Algammal A.M. Methicillin-resistant Staphylococcus aureus (MRSA) isolated from chicken meat and giblets often produces staphylococcal enterotoxin b (SEB) in nonrefrigerated raw chicken livers. Int. J. Food Microbiol. 2020;328 doi: 10.1016/j.ijfoodmicro.2020.108669. [DOI] [PubMed] [Google Scholar]
- 81.Cikman A., Aydin M., Gulhan B., Karakecili F., Kurtoglu M.G., Yuksekkaya S., Parlak M., Gultepe B.S., Cicek A.C., Bilman F.B., Ciftci I.H., Kara M., Atmaca S., Ozekinci T. Absence of the mecC gene in methicillin-resistant Staphylococcus aureus isolated from various clinical samples: the first multi-centered study in Turkey. J. Infect. Public Health. 2019;12(4):528–533. doi: 10.1016/j.jiph.2019.01.063. [DOI] [PubMed] [Google Scholar]
- 82.Laurent F., Chardon H., Haenni M., Bes M., Reverdy M., Madec J., et al. MRSA harbouring mecA variant gene mecC, France. Emerg. Infect. Dis. 2012;18:1465–1477. doi: 10.3201/eid1809.111920. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Liang B., Xiong Z., Liang Z., Zhang C., Cai H., Long Y., Gao F., Wang J., Deng Q., Zhong H., Xie Y., Huang L., Gong S., Zhou Z. Genomic basis of occurrence of cryptic resistance among oxacillin- and Cefoxitin-susceptible mecA-positive Staphylococcus aureus. Microbiol Spectr. 2022;10(3) doi: 10.1128/spectrum.00291-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Cuirolo A., Canigia L.F., Gardella N., Fernandez S., Gutkind G., Rosato A., Mollerach M. Oxacillin-and cefoxitin-susceptible meticillin-resistant Staphylococcus aureus (MRSA) Int. J. Antimicrob. Agents. 2011;37:178–179. doi: 10.1016/j.ijantimicag.2010.10.017. [DOI] [PubMed] [Google Scholar]
- 85.Goering R.V., Swartzendruber E.A., Obradovich A.E., Tickler I.A., Tenover F.C. Emergence of oxacillin resistance in stealth methicillin-resistant Staphylococcus aureus due to mecA sequence instability. Antimicrob. Agents Chemother. 2019;63 doi: 10.1128/AAC.00558-19. e00558–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Brahma U., Sharma P., Murthy S., Sharma S., Chakraborty S., Appalaraju S.N., Bhandari V. Decreased expression of femXAB genes and fnbp mediated biofilm pathways in OS-MRSA clinical isolates. Sci. Rep. 2019;9:16028. doi: 10.1038/s41598-019-52557-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Ariza-Miguel J., Hernández M., Fernández-Natal I., Rodríguez-Lázaro D. Methicillin-resistant Staphylococcus aureus harboring mecC in livestock in Spain. J. Clin. Microbiol. 2014;52(11):4067–4069. doi: 10.1128/JCM.01815-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Qu Y., et al. Molecular epidemiology and distribution of antimicrobial resistance genes of Staphylococcus species isolated from Chinese dairy cows with clinical mastitis. J. Dairy Sci. 2019;102(2):1571–1583. doi: 10.3168/jds.2018-15136. [DOI] [PubMed] [Google Scholar]
- 89.Ibrahim H.S. Bacteriological studies on pathogens in Egyptian pigeons. J. Vet. Med. Res. 2008;18(1):187–197. doi: 10.21608/jvmr.2008.77870. [DOI] [Google Scholar]
- 90.Stenzel T., Bancerz-Kisiel A., Tykałowski B., Śmiałek M., Pestka D., Koncicki A. Antimicrobial resistance in bacteria isolated from pigeons in Poland. Pol. J. Vet. Sci. 2014;17:169–171. doi: 10.2478/pjvs-2014-0023. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data are available upon reasonable request.






