Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Apr 4;103(6):103724. doi: 10.1016/j.psj.2024.103724

The effect of LINC9137 targeting miR-140-3p-NKAIN3 signal axis on the development of goose testis sertoli cells

Wu Yingping *, Lu Lizhi †, Li Haiying *,1, Chen Li †, Gu Tiantian †, Zhao Xiaoyu *, Yao Yingying *, Li Jiahui *
PMCID: PMC11087709  PMID: 38701630

Abstract

Sertoli cells (SC) are a type of important cells in the testes, which can provide transport proteins, regulatory proteins, growth factors, and other cytokines for the spermatogenic process. They participate in the regulation of the maturation and differentiation of spermatogenic cells and play an important supporting role in the migration, proliferation, and differentiation of germ cells at all levels in the testes. Previous studies found differential expression of LINC9137, miR-140-3p, and Sodium/Potassium Transporting ATPase Interacting 3 (NKAIN3) genesin high and low sperm motility goose testicular tissues. This study investigated the effects of the LINC9137-miR-140-3p-NKAIN3 signal axis on the proliferation and apoptosis of goose testicular sertoli cells at the cellular level, respectively. The results showed that through acridine orange staining, oil red O staining, Alkaline phosphatase (AKP) staining, and RT qPCR assay, it was comprehensively identified that the cultured testicular sertoli cells were purified in vitro. Through the dual luciferase activity detection test, it was found that LINC9137 has a targeted binding site with miR-140-3p and NKAIN3. In addition, this study found that overexpression of miR-140-3p significantly inhibited the expression of LINC9137 and NKAIN3 in sertoli cells, and their expression was significantly increased when miR-140-3p was interfered with. By measuring cell proliferation activity and apoptosis related gene expression, it was found that overexpression of LINC9137 decreased cell proliferation activity (P > 0.05), while the expression level of apoptosis factor Bcl2 Associated X Protein (Bax)/B-cell lymphoma-2 (Bcl2) increased (P > 0.05). On the contrary, when interfering with LINC9137, the cell proliferation activity of sertoli cells was significantly increased (P < 0.01), and the expression level of apoptosis factor Bax/Bcl2 was significantly reduced (P < 0.05); The effect of miR-140-3p on the proliferation and apoptosis of sertoli cells is opposite to that of LINC9137. Meanwhile, this study co transfected overexpressed LINC9137 and miR-140-3p plasmids into sertoli cells, and found that the effect of LINC9137 overexpression on supporting cell proliferation was weakened by miR-140-3p. This study elucidates the role and function of the LINC9137 miR-140-3p-NKAIN3 signaling axis in the development of goose testes and spermatogenesis, establishes a regulatory network related to spermatogenesis, and provides a theoretical basis for studying the genetic regulation of goose spermatogenesis.

Key words: goose, testicular development, sperm motility, noncoding RNA, CeRNA

INTRODUCTION

The testicles are the foundation for male reproductive offspring, and a series of processes such as sperm generation, differentiation, and maturation are carried out in testicular tissue (Koskenniemi et al., 2017). The development of testes is closely related to semen quality (sperm activity, sperm density, semen volume, etc.) (Mäkelä et al., 2019). The excellent quality of semen mainly depends on 2 indicators: sperm motility and sperm morphology. In semen quality measurement, these 2 indicators are significantly correlated with fertilization rate (Gil et al., 2009). Sertoli cells are an important type of cell in the testes, which play a crucial role in both testicular development and spermatogenesis (Griswold, 2018). Supportive cells come into contact with various types of germ cells in the seminiferous duct, providing physical support to germ cells and providing growth factors (Heinrich et al., 2020). In summary, the research on the role of sertoli cells in male poultry reproduction has good scientific significance, and revealing the impact of sertoli cells on testicular function has become one of the key issues in genetic improvement of livestock and poultry. Based on the transcriptome sequencing data and analysis of the research group in the early stage, this study constructed a differential circRNAs lncRNAs miRNAs mRNAs action network related to the testicles of Yili geese with high and low sperm motility. Through binding site prediction and bioinformatics analysis, it was found that LINC9137-miR-140-3p-NKAIN3 may be related to the regulation of sperm motility in Yili geese. Therefore, this chapter aims to analyze the regulatory effect of LINC9137-miR-140-3p-NKAIN3 axis on goose testicular sertoli cells by constructing overexpression and knockdown vectors of LINC9137 and miR-140-3p, and reveal the function and regulatory mechanism of this axis in goose testicular sertoli cells.

MATERIALS AND METHODS

Ethics Statement

Our study was carried out in compliance with the ARRIVE guidelines (AVMA Guidelines for the Euthanasia of Animals: 2020 Edition). All experimental animal procedures complied with the laboratory animal management and welfare regulations approved by the Ethics Committee of Xinjiang Agricultural University, Urumqi, Xinjiang, China. This study was approved by the Ethics Committee of Xinjiang Agricultural University, Urumqi, Xinjiang, China (Permit No. 2020035, date of approval: 22 March, 2019).

Experimental Animals and Sample Collection

Select seed goose eggs from 27 to 28-days-old, collect their testicular tissues, disinfect them with 75% alcohol, completely immerse them in Dulbecco's Phosphate-Buffered Saline (DPBS)(Procell, Wuhan, China) containing double antibodies, and bring them back to the intercellular ultra clean workbench for the isolation and cultivation of testicular sertoli cells. The 293T cell line was purchased from Guangzhou Ruibo Biotechnology Co., Ltd.

Isolation, Purification, and Identification of Goose Testis Sertoli Cells

Select seed goose eggs aged 27 to 28 embryos, wash and disinfect them with 75% alcohol by volume, break the egg chamber, clip out the goose embryos, and separate the testes. Place them in a 40 mm disposable sterile plate containing 1% DPBS by volume and wash them 2 to 3 times. Subsequently, DPBS containing a volume fraction of 1% double antibody was added to a new disposable sterile plate, and small tweezers were used to transfer the testicles into it, peel off the white membrane, and cut the tissue. Transfer the cut tissue to a 15 mL centrifuge tube using a pipette, add 10 times the volume of the cut tissue with DPBS containing 1% dual antibody, centrifuge at 1,000 r/min for 3 min, and discard the supernatant. Add DPBS and gently blow evenly, centrifuge at 1,000 r/min for 2 min, and discard the supernatant. Add 1 mg/mL collagenase IV (St. Louis, MO), which is 10 times the volume of cut tissue, and then digest it in a 37℃ water bath for 30 min. Manually mix every 5 min. After digestion of collagenase IV, centrifuge at 1,000 r/min for 2 min and discard the supernatant. Add 0.25% trypsin (SERANA, Australia), which is 5 times the volume of cut tissue, and digest in a 37 ℃ water bath for 5 min. Add 10% and 1% Fetal Bovine Serum (-AUS) (FBS) (Serana, WA Pty Ltd., Bunbury, WA, Australia) of equal volume and high sugar Dulbecco's modified eagle medium (DMEM) (Gibco, Carlsbad, CA) medium with dual antibodies to terminate digestion, blow evenly, and then use 70% μ Filter the m cell sieve, collect the filtrate, centrifuge at 1,000 r/min for 5 min, and discard the supernatant. Finally, cells were resuspended in high glucose DMEM medium containing 10% FBS and 1% dual antibody, and cultured in a 37℃, 5% CO2 incubator.

Purification of Goose Testis Sertoli Cells

Based on the faster adhesion of sertoli cells to the wall compared to the original cells and spermatogenic cells, after 1 h of culture, the cell suspension (including nonadherent spermatogenic cells) was sucked out. At the same time, preheated DPBS was added to the culture dish and washed 1 to 2 times. Then, preheated 10% FBS and 1% double antibody high sugar DMEM medium were added to continue cultivation in the incubator, and the cell condition was observed every 2 h. After 48 h of cell culture, discard the original culture medium and wash it 1 to 2 times with preheated DPBS. Purify the separated cells using a low osmotic solution method (DPBS: distilled water = 1:2). Observe the morphological changes of sertoli cells under a microscope. After 2 min, discard the low osmotic solution and wash it once with preheated isotonic DPBS. Continue to culture in the incubator with 10% FBS and 1% dual antibody high sugar DMEM medium (37 ℃ and 5% CO2).

Identification of Sertoli Cells in Goose Testis

This experiment used 4 methods: acridine orange staining, oil red O staining, AKP staining, and RT qPCR test to identify goose testicular sertoli cells.

Cell Transfection

The required mimics miR-140-3p, inhibitor miR-140-3p, OE LINC9137, Si LINC9137, and empty bodies for the experiment were all synthesized by Guangzhou Ruibo Biotechnology Co., Ltd(Guangzhou,China). Divide cells into 2 × Inoculate 105 cells/mL in a 6-well plate and culture under conventional conditions. When the cell growth approaches 50 to 60% fusion, transfect according to the instructions of the Lipofectmine3000 reagent kit (Thermo Fisher Scientific, Waltham, MA), and collect the cells after 48 h of transfection.

Double Luciferase Report Experiment

After constructing pmirGLO-LINC9137-Wt, pmirGLO-LINC9137-Mut, pmirGLO-NKAIN3-Wt, and pmirGLO-NKAIN3-Mut vectors by Guangzhou Ruibo Biotechnology Co., Ltd., 293T cells were inoculated into a 24 well plate (5 × 105 cells/well), using Lip3000 reagent (Thermo Fisher Scientific, Waltham, MA) to co transfect the above vector with NC mimics or miR-140-3p mimics into cells, and 48 hours later using Dual Luciferase The Report analysis system (Promega, Madison, WI) measures luciferase activity and uses a GloMax luminescence detector to detect readings (Promega, Madison, WI).

Real Time Fluorescence Quantitative PCR

Using TRIzol Plus RNA Purification Kit (Thermo Fisher Scientific, Waltham, MA) extracts total RNA from sertoli cells, SuperScript III First Strand Synthesis SuperMix Kit (Thermo Fisher Scientific, Waltham, MA) for reverse transcription. The qPCR reaction was performed using the Power up Synergetic Binding Reagent (SYBR) Green Master Mix kit using the CFX384 multiple real-time fluorescence quantitative PCR instrument (Bio Rad, Hercules, CA). PCR reaction system 20 μL: 1 μL cDNA template, 10 μL Power SYBR Green Master Mix, 0.5 primer for upstream and 0.5 primer for downstream μL. RNase Free water up to 20 μL. Primer Premier 6.0 and Beacon designer 7.8 software were used for quantitative PCR primer design. The expression levels of mRNA and lncRNA were calculated using Glyceraldehyde-3-phosphate Dehydrogenase (GAPDH) as the internal reference gene, while the expression levels of miRNA were calculated using U6 as the internal reference gene. The primer sequence information is shown in Tables 1 and 2, and the primers were synthesized by Biotechnology (Shanghai, China) Co., Ltd. The relative expression level of the target gene was calculated using 2−∆∆Ctvalue calculation method.

Table 1.

Primer sequence information.

Gene Amplicon Size
(bp)		 Forward primer
(5′→3′)		 Reverse primer
(5′→3′)
GAPDH 137 CTGCCCAGAACATTATCCCAGCAT GCAGGTCAGGTCCACGACAGA
Bax 185 GGGACGAGCTGGACAGCAA CTGCGAGAACAGAGCCTTGATG
Bcl2 113 GGAGTTGTATGGCAACAGTATGAG CGAGATAAGCGCCAAGAGTGA
NKALN3 151 GAGTGCAATGAGTAGGATGAGAAGA GATAGGAGCCCATTGGAAACCA
LINC9137 86 CCTAGCCTGAACTTGGAGGAA CAGGTGGGACACCATGCAT
1-si-LINC9137 GGAUAAUAAAUGAGCUCAAUATT UAUUGAGCUCAUUUAUUAUCCTT
2-si-LINC9137 GUUGGAUCUUCUCAUGUAACUTT AGUUACAUGAGAAGAUCCAACTT
3-si-LINC9137 AGGACUGACUAGUGUCAUAAGTT CUUAUGACACUAGUCAGUCCUTT
si-NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
Open in a new tab

F, for upstream primer R, for downstream primer.

Table 2.

miRNA primer sequence information.

Gene Forward primer and universal primer (5′→3′) Annealing (℃)
gga-miR-140-3p-F GCGCCACAGGGTAGAACC 60
U6-F CGCTTCGGCAGCACATATACTAA 60
micro-R AGTGCAGGGTCCGAGGTATT 60
Open in a new tab

CCK-8 Detection

Inoculate isolated goose testicular sertoli cells into 96 well plates, with 100 cells per well μL (containing 5,000 cells), 5 re wells were established in each group and cultured for 48 hours. According to the instructions of the Cell Counting Kit-8 (CCK-8) (Bimake, Houston, TX), the proliferation activity of goose testicular sertoli cells was tested. Subsequently, the absorbance values of each well were measured at 450 nm using an enzyme-linked immunosorbent assay, and blank wells were set to calculate cell proliferation activity.

Statistical Analysis

Use Statistical Package for the Social Science 19.0 (SPSS) (IBM Corporation, Armonk, NY) and GraphPad Prism 8.0 software (GraphPad Software, La Jolla, CA) for statistics and plotting. The comparison of multiple data was conducted using one-way ANOVA (Analysis of Variance) analysis, and the comparison of the 2 sets of data was conducted using independent sample t-test. The data results were expressed as mean ± standard deviation (Mean ± SD), with P < 0.05 indicating significant differences and P < 0.01 indicating extremely significant differences.

RESULTS

Interaction Network Analysis of CircRNAs-lncRNAs-miRNAs-mRNAs

Based on previous research (Wu et al., 2023), as shown in Figure 1, the ceRNA network involves a total of 20 circRNAs, 13 lncRNAs, 26 miRNAs, and 6 mRNAs. Among them, aca-miR-212-5p has a total of 11 nodes connected to it, while cfa-miR-140, gga-miR-140-3p, and ola-miR-140-3p all have 6 nodes connected to it. The key circRNAs are novel_Circle_0017590, the key lncRNAs are LINC4993, LINC6211, etc., the key miRNAs are miR-140-3p or miRNA140, and the key mRNA is NKAIN3, etc. This study selected gga-miR-140-3p-LINC9137-NKAIN3 for subsequent functional verification.

Figure 1.

Figure 1

Open in a new tab

Interaction diagram of circRNAs-lncRNAs-miRNAs-mRNAs network. Square nodes represent circRNAs, v-shaped represent lncRNAs, triangular nodes represent miRNAs, and circular nodes represent mRNAs. Red indicates up-regulation, green indicates down-regulation.

Culture of Sertoli Cells in Goose Testis

The sertoli cells of the goose testes are irregularly high columnar, conical, or spindle shaped, with multiple cell bodies (Figures 2A–2D), which serve as scaffolds for spermatogenic cells during the development of the testicular seminiferous tubules. The growth of sertoli cells after 12, 24, and 48 h of cultivation can be observed from Figures 2A–2C: at 12 h of cultivation, most cells are elongated, relatively small, and tightly adhere to the wall. When cultured for 24 h, it can be seen that the cell body begins to fully extend, and the number of cells increases, accompanied by an increase in volume. At 48 h of cultivation, the cells showed spindle or dendritic shapes, and the volume and number of sertoli cells further increased, with a cell density exceeding 90%.

Figure 2.

Figure 2

Open in a new tab

Culture of sertoli cells in goose testis. (A) to (C): The morphology and density of sertoli cells cultured for 12, 24, and 48 h at a magnification of 100 X. (D): The morphology of sertoli cells cultured for 48 h at a magnification of 200 X.

Identification of Sertoli Cells in Goose Testis

In order to further determine whether the cultured cells are sertoli cells, acridine orange staining, oil red O staining, AKP staining, and qRT-PCR assay were used to identify the cultured sertoli cells after in vitro purification (Figures 3A–3D). Acridine orange staining (Figure 3A) revealed green fluorescence in the nucleus and orange fluorescence in the cytoplasm. Oil red O staining (Figure 3B) revealed that lipid droplets were stained orange red, and after re staining with hematoxylin, the nucleus was stained blue, with a bipolar structure visible within the nucleus. AKP staining (Figure 3C) showed that sertoli cells were not stained and were AKP negative, while the mixed peritubular cells were stained dark brown and were AKP positive. The qRT-PCR results (Figure 3D) showed that both SRY-box transcription factor 9 (SOX9) and GATA binding protein 4 (GATA4), the marker genes of sertoli cells, were expressed.

Figure 3.

Figure 3

Open in a new tab

Identification of sertoli cells in goose testis. (A): Acridine orange staining. The DNA rich nuclei in sertoli cells are stained yellow green (indicated by the long arrow), and their shape is oval. The RNA rich cytoplasm is stained orange red (indicated by the short arrow). (B): Oil red O staining, with many small particles stained orange red in the sertoli cells, which are small lipid droplets (indicated by the long arrow). The nucleus contains extremely dark colored bipolar bodies (indicated by the short arrow). (C): AKP staining, with sertoli cells being AKP negative and not stained (indicated by the long arrow), and peritubular cells being AKP positive and stained dark brown (indicated by the short arrow). (D): The qRT-PCR detection results.

LINC9137 and miR-140-3p Targeting Verification

The RNAhybrid prediction results show that LINC9137 has binding sites with miR-140-3p (Figure 4A). To verify the targeting relationship between LINC9137 and miR-140-3p, this study constructed LINC9137-wt and LINC9137-mut plasmids containing miR-140-3p binding sites (Figure 4B). Subsequently, wild-type or mutant plasmids were co transfected with miR-NC or miR-140-3p into 293T cells. The results of dual luciferase activity showed that the co transfection group of miR-140-3p and LINC9137-wt significantly reduced the fluorescence activity of wild-type plasmids (P < 0.05), but the co transfection group had no significant effect on the fluorescence activity of mutant plasmids (P > 0.05) (Figure 4C).

Figure 4.

Figure 4

Open in a new tab

LINC9137 and miR-140-3p targeting verification. (A): Predicted binding information of LINC9137 to miR-140-3p. (B): LINC9137 and miR-140-3p binding site prediction and vector construction. (C): Dual luciferase activity assay of LINC9137 related to miR-140-3p targeting. (D): miR-140-3p overexpression and interference efficiency assay. (E): Expression changes of LINC9137 after overexpression expression of miR-140-3p. *P < 0.05, **P < 0.01.

To further verify whether miR-140-3p directly regulates the expression of LINC9137, this study constructed an overexpression vector mimics-miR-140-3p and an inhibitor miR-140-3p for miR-140-3p, and transfected them into goose testicular sertoli cells. Compared with the NC group, the expression of miR-140-3p in the mimics miR-140-3p group was significantly increased (P < 0.01), while the expression of miR-140-3p in the inhibitor miR-140-3p group was significantly reduced (P < 0.05), indicating that miR-140-3p overexpression and interference with plasmid construction were successful (Figure 4D). When overexpressing miR-140-3p, the expression of LINC9137 was significantly reduced (P < 0.05) (Figure 4E).

LINC9137 Regulates Proliferation and Apoptosis of Goose Testicular Sertoli Cells Through miR-140-3p

The qPCR detection results after transfection with si-NC and 3 types of si-LINC9137 showed that compared with the si-NC group, the 1-si-LINC9137, 2-si-LINC9137, and 3-si-LINC9137 groups were significantly reduced after interference (P < 0.01), with downregulation of 9.3, 4.9, and 2.6 times, respectively. Therefore, 1-si-LINC9137 was selected as the effective siRNA for subsequent LINC9137 gene interference. Compared with the NC group, the expression of LINC9137 in the OE LINC9137 group was significantly increased (P < 0.01). The above results indicate that LINC9137 overexpression and interference plasmid construction were successful (Figures 5A–5B).

Figure 5.

Figure 5

Open in a new tab

LINC9137 regulates proliferation and apoptosis of goose testicular sertoli cells through miR-140-3p. (A): The detection of overexpression efficiency of LINC9137; (B): LINC9137 interference efficiency detection; (C-D): The effects of overexpression/inhibition of LINC9137 on the proliferation and apoptosis of sertoli cells, respectively; (E-F): The effects of overexpression/inhibition of miR-140-3p on the proliferation and apoptosis of sertoli cells, respectively; (G): The effect of overexpression of LINC9137 and miR-140-3p on the proliferation of sertoli cells.* P < 0.05, * * P < 0.01.

Subsequently, this study analyzed the effect of LINC9137 on the proliferation and apoptosis of sertoli cells. The results showed that compared with the NC group, the OE-LINC9137 group had a decrease in cell proliferation activity (P > 0.05), an increase in the expression level of apoptosis factor Bax/Bcl2 (P > 0.05), a very significant increase in cell proliferation activity (P < 0.01), and significant decrease in the expression level of apoptosis factor Bax/Bcl2 (P < 0.05) in the Si-LINC9137 group (Figures 5C–5D). By analyzing the effect of miR-140-3p on the proliferation and apoptosis of sertoli cells, it was found that compared with NC, the mimics-miR-140-3p group showed a significant increase in cell proliferation activity (P < 0.01) and a significant decrease in the expression level of apoptotic factor Bax/Bcl2 (P < 0.05); The inhibitor miR-140-3p group significantly reduced cell proliferation activity (P < 0.01), and the expression level of apoptosis factor Bax/Bcl2 was significantly increased (P < 0.01) (Figures 5E–5F).

To further analyze the effect of LINC9137 on the function of goose sertoli cells through miR-140-3p, this study transfected overexpressed LINC9137 and miR-140-3p plasmids into sertoli cells. The results showed that compared with the NC group, the mimics-miR-140-3P group showed a significant increase in cell proliferation activity (P < 0.01), while the OE-LINC9137 group showed a significant decrease in cell proliferation activity (P < 0.05); The co transfection of mimics miR-140-3P+OE LINC9137 group reduced the inhibitory effect of LINC9137 overexpression on sertoli cell proliferation (Figure 5G).

miR-140-3p and NKAIN3 Targeting Verification

RNAhybrid prediction shows that there is a binding site between miR-140-3p and NKAIN3 (Figure 6A). To verify the targeting relationship between miR-140-3p and NKAIN3, this study constructed NKAIN3-wt and NKAIN3-mut plasmids containing miR-140-3p binding sites (Figure 6B). Subsequently, wild-type or mutant plasmids were co transfected with NC mimics or miR-140-3p mimics into 293T cells. The results of dual luciferase activity showed that the co transfection group of miR-140-3p and NKAIN3-wt significantly reduced the fluorescence activity of wild-type plasmids (P < 0.05), but the co transfection group had no significant effect on the fluorescence activity of mutant plasmids (P > 0.05) (Figure 6C). To further verify whether NKAIN3 is a functional target of miR-140-3p, this study transfected the overexpression vector mimics miR-140-3p or inhibitory vector inhibitor miR-140-3p of miR-140-3p into goose sertoli cells. Compared with the NC group, the mRNA expression level of NKAIN3 in the mimics miR-140-3p group was significantly reduced (P < 0.01), while the mRNA expression level of NKAIN3 in the inhibitor miR-140-3p group was significantly increased (P < 0.01) (Figure 6D).

Figure 6.

Figure 6

Open in a new tab

Validation of miR-140-3p targeting with NKAIN3. (A): Combination information of miR-140-3p and NKAIN3 prediction; (B): Prediction of binding sites between miR-140-3p and NKAIN3 and construction of vector; (C): Detection of dual luciferase activity in the targeting relationship between miR-140-3p and NKAIN3; (D): Changes in mRNA expression of NKAIN3 after overexpression/inhibition of miR-140-3p. * P < 0.05, * * P < 0.01.

LINC9137 Regulates NKAIN3 Expression Through ceRNA as miR-140-3p

To further analyze the regulation of NKAIN3 expression by LINC9137 as a ceRNA of miR-140-3p, this study co transfected LINC9137 with an overexpression plasmid of miR-140-3p into sertoli cells. The results showed that there was no significant difference in the mRNA expression of NKAIN3 among the OE-NC, mimics-NC, and mimics-NC+OE-NC groups (P > 0.05). Compared with the mimics-NC+OE-NC group, the mRNA expression level of NKAIN3 was significantly higher in the co transfected mimics-miR-140-3p+LNC9137 group than in the mimics-NC+OE-NC group (P < 0.05) (Figure 7).

Figure 7.

Figure 7

Open in a new tab

LINC9137 regulates NKAIN3 expression by acting as a ceRNA for miR-140-3p. Changes in mRNA expression of NKAIN3 after co transfection of LINC9137 and miR-140-3p overexpression plasmids.

DISCUSSION

Isolation and Culture of Sertoli Cells From Goose Testis

Sertoli Cells (SCs), also known as podocytes, are known somatic cells that support, coordinate, nourish, and protect the germ cell population from the beginning to the end of meiosis. The transmission of genetic and epigenetic information to the next generation is achieved through gametes called “sperm” in males. SCs are one of the key somatic cells involved in testicular spermatogenesis, playing an important role in spermatogenesis. They extend from the base of the spermatogenic epithelium to the top and come into direct contact with all types of germ cells (Griswold, 2015).They provide support for a limited number of differentiated germ cells in the seminiferous tubules and provide them with energy in the form of growth factors, binding proteins, and lactate, thereby promoting germ cell growth and differentiation into sperm (Smith et al., 2012; Grimaldi et al., 2013). The number of sertoli cells determines the number of spermatogenic cells, testicular size, and sperm production. Lack of sertoli cells can lead to apoptosis, degeneration, and even male infertility of spermatogenic cells. Previous research reports have shown that co culture of SCs with sperm in vitro can increase sperm motility and prolong sperm survival time (Menegazzo et al., 2011; Wang et al., 2021). Therefore, the separation and purification of high-purity sertoli cells has always been a focus of attention.

This experiment refers to the isolation and cultivation methods for avian sertoli cells that have been established both domestically and internationally (Zhang et al., 2018; Lin et al., 2019; Xu et al., 2020). Goose embryos with strong cell division ability were selected as the experimental material. When embryos were taken, the gonads of 28 swan embryos were identified with the naked eye and testicular tissue was quickly separated. The 2-step enzyme digestion method is currently the mainstream technology for the convenient and efficient separation of avian sertoli cells. This study selected 2 digestive enzymes, collagenase IV and trypsin, for 2-step enzymatic digestion. Collagenase IV mainly removes some fibrous connective tissue from testicular tissue, while trypsin mainly disrupts cell adhesion to better facilitate and obtain cell suspension. This study used 2 methods for purifying sertoli cells, namely differential adhesion and low osmotic solution treatment, to obtain high purity of sertoli cells, which can be used for the next step of experiments. The main morphology of the goose embryo sertoli cells isolated in this experiment is similar to that of chicken embryo sertoli cells, showing irregular high columnar, spindle shaped, or dendritic shapes, while extending multiple cell bodies. After 24 h of cultivation, the cells have basically adhered to the wall.

According to the characteristics of avian testicular sertoli cells, the mainstream identification methods for sertoli cells include the following: H.E. staining, oil red O staining, acridine orange staining, Rhodamine 123 staining, immunofluorescence, immunohistochemistry, and qPCR testing (Majumdar et al., 1998; Wang et al., 2017). This experiment used 4 methods: acridine orange staining, oil red O staining, AKP staining, and qRT-PCR test to identify sertoli cells. acridine orange staining found that the nucleus showed green fluorescence and the cytoplasm showed orange fluorescence, which is consistent with the characteristic of SCs with DNA rich nuclei and RNA rich cytoplasm, indicating that the isolated and cultured cells are SCs; The oil red O results showed that there were lipid droplets around the nucleus of the testis sertoli cells, and there were unique bipolar bodies (satellite bodies) within the nucleus of the sertoli cells; AKP staining showed that the peritubular cells were AKP positive, while the sertoli cells were AKP negative, which can clearly distinguish the 2. The qRT-PCR results showed that both the marker genes SOX9 and GATA4 were expressed in sertoli cells, which is consistent with the research results of XU et al (Kyrönlahti et al., 2011; Xu et al., 2020) further proving that the purified cell culture is mainly composed of sertoli cells. Based on the above identification results, it can be preliminarily proven that the cells obtained in the experiment are sertoli cells.

LINC9137 May Serve as a ceRNA for miR-140-3p to Regulate the Expression of NKAIN3

This study found through preliminary sequencing data analysis (Figure 1) that LINC9137 in the testicular tissue of Yili geese may act as a ceRNA of miR-140-3p to regulate the expression of NKAIN3, thereby affecting the development of the testicles of Yili geese. Due to the potential role of lncRNA LINC9137 in regulating testicular development and sperm motility in geese, this study validated the interaction between LINC9137 and miR-140-3p through in vitro functional experiments such as knockdown and overexpression, as well as its impact on the function of sertoli cells.

Research has shown that the miRNA with the highest expression level in mouse testes is miR-140-3p, and its opposite chain miR-140-5p is also enriched and expressed in the testes, although the expression level is lower than miR-140-3p (Rakoczy et al., 2013). Luo et al. found that miR-140-3p showed a significant decrease during the transition period from type B spermatogonia cells (BSc) to primary spermatocytes (PSc) in mice, indicating that miR-140-3p may be a key regulatory factor in the transition from BSc to PSc (Luo et al., 2015). Based on the research findings in Figure 1, LINC9137 may be one of the targets for miR-140-3p. In order to verify the targeting relationship between LINC9137 and miR-140-3p, this study found the presence of a targeted binding site for miR-140-3p in LINC9137 through a dual luciferase activity assay. In addition, when overexpressing miR-140-3p, there was a significant change in the expression of LINC9137, further indicating that LINC9137 is one of the targets of miR-140-3p.

Subsequently, through cell proliferation and apoptosis experiments, this study found that overexpression of LINC9137 can inhibit the proliferation of sertoli cells and promote their apoptosis. On the contrary, when interfering with LINC9137, the proliferation ability of sertoli cells was significantly increased and the apoptosis rate was significantly reduced. It is speculated that LINC9137 has a certain inhibitory effect on the development of sertoli cells. When miR-140-3p is overexpressed or interfered with, its effect on the proliferation and apoptosis of sertoli cells is opposite to that of LINC9137.

The results of this study confirm that miR-140-3p is also involved in regulating the proliferation and apoptosis of sertoli cells. Meanwhile, this study found that the proliferation and apoptosis of sertoli cells induced by overexpression of LINC9137 were weakened by miR-140-3p. The above research results suggest that LINC9137 can bind with miR-140-3p to affect the proliferation and apoptosis process of sertoli cells.

Na+/K+transporting ATPase interacting 3 (NKAIN3) is a gene encoding membrane proteins associated with sodium/potassium ATPase (Na+/K+ATPase). Na+/K+-ATPase is a key enzyme that maintains a balance of intracellular and extracellular sodium and potassium ions, and is an important foundation for neuronal excitation and muscle movement. Na+/K+-ATPase (NKA), as a transmembrane carrier protein, mainly exists on the cell membrane of eukaryotic cells and participates in regulating ion transport and energy metabolism within cells. It is an indispensable energy consumption pump for ion and osmotic balance inside and outside cells, regulating a series of biological processes in the body, such as temperature regulation and various physiological activities (Vague et al., 2004; Fedosova et al., 2021). In addition, Na+/K+- ATPase is also associated with cell death and various important diseases (Alevizopoulos et al., 2014; Obradovic et al., 2017; Shrivastava et al., 2020).

Gorokhova et al., 2007 identified the evolutionarily conserved transmembrane protein (NKAIN) family (NKAIN1, NKAIN2, NKAIN3, and NKAIN4), which is localized in neurons and associated with Na, K-ATPase β 1 subunit interaction. Among them, NKAIN3 contains a predicted cleavable signal peptide and 3 putative transmembrane domains. RT-qPCR analysis showed that NKAIN3 expression was only detected in the mouse brain and testes. The Na+/K+- ATPase (ATP1A4) specifically expressed in sperm has been shown to be associated with sperm capacitation and motility (Jimenez et al., 2012; Syeda et al., 2020). At present, there is still a lack of research on the regulation of NKAIN3 gene in testicular development and sperm motility.

In the previous research on the development of testicles in Yili geese conducted by our research group, it was found that the NKAIN3 gene in testicular tissue was significantly upregulated in the high sperm motility group compared to the low sperm motility group, and was negatively correlated with the expression of miR-140-3p. This experiment found through dual luciferase activity detection that NKAIN3 has a targeted binding site with miR-140-3p. When miR-140-3p is overexpressed, the mRNA expression of NKAIN3 in sertoli cells is significantly reduced; When interfering with miR-140-3p, the mRNA expression of NKAIN3 in sertoli cells was significantly increased, indicating that NKAIN3 expression can be negatively regulated by miR-140-3p in sertoli cells.

Research has shown that lncRNA, like a “molecular sponge,” competitively binds to other sequences or structures (miRNAs, transcription factors, or RNA binding proteins) and regulates its function (Sadeghi et al., 2022). In this study, considering that miR-140-3p can directly interact with LINC9137 and NKAIN3, overexpressing LINC9137 and miR-140-3p plasmids were co transfected into sertoli cells. It was found that LINC9137 can competitively bind to miR-140-3p as a ceRNA of miR-140-3p, thereby weakening the inhibitory effect of miR-140-3p on NKAIN3. As mentioned above, LINC9137 and miR-140-3p may be key regulatory factors regulating the proliferation and apoptosis of sertoli cells. Supportive cells activate and support spermatogenesis, while germ cells are surrounded by specific microenvironments (niches) established by supportive cells. Without supportive cells providing care and support for germ cells undergoing meiosis, germ cell differentiation, meiosis, and sperm formation will not occur.

As is well known, the appropriate number of sertoli cells in the testes directly determines the number of sperm produced per day, with each sertoli cell cultivating 30 to 50 germ cells in the seminiferous epithelium (Weber et al., 1983; Wong and Russell, 1983). Research has shown that the development level of immature supporting cell populations will determine the spermatogenic ability and reproductive performance of male animals in adulthood. Damage during supporting cell development or proliferation may lead to a decrease in sperm count and semen quality (Aranha et al., 2006). Therefore, in vitro isolation and culture of SCs are indispensable in the study of germ cells. Based on this, this study focuses on the regulatory relationships between LINC9137, miR-140-3p, and NKAIN3, which is of great significance for further elucidating the sperm motility traits and testicular development in male animals.

CONCLUSIONS

The results of this study indicate that through acridine orange staining, oil red O staining, AKP staining, and qRT-PCR assay, it can be comprehensively identified that the cultured cells after in vitro isolation and purification are support cells; LINC9137 can inhibit the proliferation of supporting cells and promote cell apoptosis; The effect of miR-140-3p is opposite to that of LINC9137; Moreover, LINC9137 can bind with miR-140-3p to affect the proliferation and apoptosis processes of supporting cells. LINC9137 can competitively bind miR-140-3p as a ceRNA of miR-140-3p, thereby weakening the inhibitory effect of miR-140-3p on NKAIN3.

ACKNOWLEDGMENTS

This research was funded by the National Natural Science Foundation of China (32160785).

Availability of Data and Materials: The data presented in the study are deposited in the BioProjectin NCBI repository (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA856143), accession number is PRJNA856143.

Authors Contributions: YPW and HYL designed the project. YPW, XYZ, LC and TTG managed the experimental ganders. YPW, XYZ, LC and LZL collected the samples. YPW and XYZ performed bioinformatic analysis. YPW and XYZ participated in data analysis and experimental validation. HYL and LZL supervised this study. The manuscript was prepared by YPW and substantially revised by HYL and LZL. All authors read and approved the final manuscript for publication. All authors read and approved the final manuscript for publication.

Availability of Data: The data presented in the study are deposited in the BioProjectin NCBI repository (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA856143) and (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA914617), accession number is PRJNA856143 and PRJNA914617.

DISCLOSURES

The authors declare that they have no competing interests.

REFERENCES

  1. Alevizopoulos K., Calogeropoulou T., Lang F., Stournaras C. Na+/K+ ATPase inhibitors in cancer. Curr. Drug Targets. 2014;15:988–1000. [PubMed] [Google Scholar]
  2. Aranha I., Bhagya M., Yajurvedi H.N. Testis of the lizard Mabuya carinata: a light microscopic and ultrastructural seasonal study. J. Submicrosc. Cytol. Pathol. 2006;38:93–102. [PubMed] [Google Scholar]
  3. Gil M.C., García-Herreros M., Barón F.J., Aparicio I.M., Santos A.J., García-Marín L.J. Morphometry of porcine spermatozoa and its functional significance in relation with the motility parameters in fresh semen. Theriogenology. 2009;71:254–263. doi: 10.1016/j.theriogenology.2008.07.007. [DOI] [PubMed] [Google Scholar]
  4. Gorokhova S., Bibert S., Geering K., Heintz N. A novel family of transmembrane proteins interacting with beta subunits of the Na,K-ATPase. Hum. Mol. Genet. 2007;16:2394–2410. doi: 10.1093/hmg/ddm167. [DOI] [PubMed] [Google Scholar]
  5. Grimaldi P., Di Giacomo D., Geremia R. The endocannabinoid system and spermatogenesis. Front. Endocrinol. (Lausanne) 2013;4:192. doi: 10.3389/fendo.2013.00192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Griswold, M. D. 2015. Sertoli Cell Biology. Second Edition, The Netherlands: Elsevier. 10.1016/C2013-0-01369-2. [DOI]
  7. Griswold M.D. 50 years of spermatogenesis: Sertoli cells and their interactions with germ cells. Biol. Reprod. 2018;99:87–100. doi: 10.1093/biolre/ioy027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Heinrich A., Potter S.J., Guo L., Ratner N., DeFalco T. Distinct roles for Rac1 in sertoli cell function during testicular development and spermatogenesis. Cell Rep. 2020;31 doi: 10.1016/j.celrep.2020.03.077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Jimenez T., Sánchez G., Blanco G. Activity of the Na,K-ATPase α4 isoform is regulated during sperm capacitation to support sperm motility. J. Androl. 2012;33:1047–1057. doi: 10.2164/jandrol.111.015545. [DOI] [PubMed] [Google Scholar]
  10. Koskenniemi J.J., Virtanen H.E., Toppari J. Testicular growth and development in puberty. Curr. Opin. Endocrinol. Diabetes. Obes. 2017;24:215–224. doi: 10.1097/MED.0000000000000339. [DOI] [PubMed] [Google Scholar]
  11. Kyrönlahti A., Euler R., Bielinska M., Schoeller E.L., Moley K.H., Toppari J., Heikinheimo M., Wilson D.B. GATA4 regulates Sertoli cell function and fertility in adult male mice. Mol. Cell Endocrinol. 2011;333:85–95. doi: 10.1016/j.mce.2010.12.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lin X.B., Lao Y.C., Zhang J., Ouyang H.J., Tian Y.B., Huang Y.M. Isolation, culture and identification of testis sertoli cells from duck embryo. J. Zhongkai Univ. Agric. Eng. 2019;32:23–27. (Chinese) [Google Scholar]
  13. Luo M., Hao L., Hu F., Dong Y., Gou L., Zhang W., Wang X., Zhao Y., Jia M., Hu S., Zhang X. MicroRNA profiles and potential regulatory pattern during the early stage of spermatogenesis in mice. Sci. China Life Sci. 2015;58:442–450. doi: 10.1007/s11427-014-4737-8. [DOI] [PubMed] [Google Scholar]
  14. Majumdar S.S., Winters S.J., Plant T.M. Procedures for the isolation and culture of Sertoli cells from the testes of infant, juvenile, and adult rhesus monkeys (Macaca mulatta) Biol. Reprod. 1998;58:633–640. doi: 10.1095/biolreprod58.3.633. [DOI] [PubMed] [Google Scholar]
  15. Mäkelä J.A., Koskenniemi J.J., Virtanen H.E., Toppari J. Testis development. Endocr. Rev. 2019;40:857–905. doi: 10.1210/er.2018-00140. [DOI] [PubMed] [Google Scholar]
  16. Menegazzo M., Zuccarello D., Luca G., Ferlin A., Calvitti M., Mancuso F., Calafiore R., Foresta C. Improvements in human sperm quality by long-term in vitro co-culture with isolated porcine Sertoli cells. Hum. Reprod. 2011;26:2598–2605. doi: 10.1093/humrep/der248. [DOI] [PubMed] [Google Scholar]
  17. Obradovic M., Stanimirovic J., Panic A., Bogdanovic N., Sudar-Milovanovic E., Cenic-Milosevic D., Isenovic E.R. Regulation of Na+/K+-ATPase by estradiol and IGF-1 in cardio-metabolic diseases. Curr. Pharm. Des. 2017;23:1551–1561. doi: 10.2174/1381612823666170203113455. [DOI] [PubMed] [Google Scholar]
  18. Rakoczy J., Fernandez-Valverde S.L., Glazov E.A., Wainwright E.N., Sato T., Takada S., Combes A.N., Korbie D.J., Miller D., Grimmond S.M., Little M.H., Asahara H., Mattick J.S., Taft R.J., Wilhelm D. MicroRNAs-140-5p/140-3p modulate Leydig cell numbers in the developing mouse testis. Biol. Reprod. 2013;88:143. doi: 10.1095/biolreprod.113.107607. [DOI] [PubMed] [Google Scholar]
  19. Sadeghi M., Bahrami A., Hasankhani A., Kioumarsi H., Nouralizadeh R., Abdulkareem S.A., Ghafouri F., Barkema H.W. lncRNA-miRNA-mRNA ceRNA network involved in sheep prolificacy: an integrated approach. Genes. (Basel) 2022;13:1295. doi: 10.3390/genes13081295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Shrivastava A.N., Triller A., Melki R. Cell biology and dynamics of Neuronal Na+/K+-ATPase in health and diseases. Neuropharmacology. 2020;169 doi: 10.1016/j.neuropharm.2018.12.008. [DOI] [PubMed] [Google Scholar]
  21. Smith B.E., Braun R.E. Germ cell migration across Sertoli cell tight junctions. Science (1979) 2012;338:798–802. doi: 10.1126/science.1219969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Syeda S.S., Sánchez G., McDermott J.P., Hong K.H., Blanco G., Georg G.I. The Na+ and K+ transport system of sperm (ATP1A4) is essential for male fertility and an attractive target for male contraception†. Biol. Reprod. 2020;103:343–356. doi: 10.1093/biolre/ioaa093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Vague P., Coste T.C., Jannot M.F., Raccah D., Tsimaratos M. C-peptide, Na+,K(+)-ATPase, and diabetes. Exp. Diabesity. Res. 2004;5:37–50. doi: 10.1080/15438600490424514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Wang M., Chen Y., Pan Q., Du M., Li Z., Dong H. Co-culture of sperm with sertoli cells can improve IVF outcomes by increasing sperm motility in mice. Theriogenology. 2021;172:20–26. doi: 10.1016/j.theriogenology.2021.05.028. [DOI] [PubMed] [Google Scholar]
  25. Wang S., Jia Q.Z., Zhang L., Wang L.Q., Chen G.Y. Culture and identification of testis Sertoli cells in Hetian sheep in vitro. Southwest China J. Agric. Sci. 2017;30:1918–1922. (Chinese) [Google Scholar]
  26. Weber J.E., Russell L.D., Wong V., Peterson R.N. Three-dimensional reconstruction of a rat stage V Sertoli cell: II. Morphometry of Sertoli–Sertoli and Sertoli–germ-cell relationships. Am. J. Anat. 1983;167:163–179. doi: 10.1002/aja.1001670203. [DOI] [PubMed] [Google Scholar]
  27. Wong V., Russell L.D. Three-dimensional reconstruction of a rat stage V Sertoli cell: I. Methods, basic configuration, and dimensions. Am. J. Anat. 1983;167:143–161. doi: 10.1002/aja.1001670202. [DOI] [PubMed] [Google Scholar]
  28. Wu Y., Zhang L., Li H., Zhao X., Ding Y., Yao Y., Wang L. Association between Yili goose sperm motility and expression profiles of mRNA and miRNA in testis. BMC. Genomics. 2023;24:640. doi: 10.1186/s12864-023-09727-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Xu K., Wang J., Liu H., Zhao J., Lu W. Melatonin promotes the proliferation of chicken Sertoli cells by activating the ERK/Inhibin alpha subunit signaling pathway. Molecules. 2020;25:1230. doi: 10.3390/molecules25051230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zhang J.J., Wang X.Z., Luong Do H., Chandimali N., Kang T.Y., Kim N., Ghosh M., Lee S.B., Mok Y.S., Kim S.B., Kwon T., Jeong D.K. MicroRNA-7450 regulates non-thermal plasma-induced chicken Sertoli cell apoptosis via adenosine monophosphate-activated protein kinase activation. Sci. Rep. 2018;8:8761. doi: 10.1038/s41598-018-27123-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES