Abstract
HAND2 is a basic helix-loop-helix transcription factor with diverse functions during development. To facilitate investigation of genetic and functional diversity among Hand2-expressing cells in the mouse, we have generated Hand2Dre, a knock-in allele expressing Dre recombinase. To avoid disrupting Hand2 function, the Dre cDNA is inserted at the 3’ end of the Hand2 coding sequence following a viral 2A peptide. Hand2Dre homozygotes can therefore be used in complex crosses to increase the proportion of useful genotypes among offspring. Dre expression in mid-gestation Hand2Dre embryos is indistinguishable from wild-type Hand2 expression, and HandDre efficiently recombines rox target sites in vivo. In combination with existing Cre and Flp mouse lines, Hand2Dre will therefore extend the ability to perform genetic intersectional labeling, fate mapping, and functional manipulation of subpopulations of cells characterized by developmental expression of Hand2.
Keywords: Dre/rox, mouse, heart, limb bud, sympathetic neurons, neural crest
1. INTRODUCTION
The basic helix-loop-helix transcription factor HAND2 (heart and neural crest derivatives 2, dHAND) has a dynamic pattern of expression during embryonic development, beginning in maternal deciduum at embryonic day (E) 7.5 in the mouse and in lateral mesoderm shortly thereafter (Srivastava et al., 1995). Subsequently, HAND2 plays important roles in the development of a variety of tissues and structures, including the heart, limbs, craniofacial anatomy, and much of the peripheral nervous system. During heart development, the Hand2 gene is expressed uniformly in the linear heart tube at about E8.0, but later is expressed predominantly in the right ventricle and outflow tract while the paralogous Hand1 is expressed in left ventricle (Srivastava et al., 1997). In developing limbs, Hand2 expression helps to establish anterior and posterior mesenchymal compartments which lead to appropriate asymmetry and pentadactyly (Osterwalder et al., 2014). During craniofacial development, Hand2 is expressed in the first branchial arch, specifically in the mandibular process, and ectopic expression in the maxillary process is sufficient to convert the maxilla to a duplicated mandible (Funato et al., 2016). Hand2 is expressed in the sympathetic, parasympathetic, and enteric subsets of the autonomic nervous system (Morikawa et al., 2005), and plays a critical role in acquisition and maintenance of noradrenergic properties in developing sympathetic neurons (Doxakis et al., 2008; Hendershot et al., 2008; Schmidt et al., 2009; Stanzel et al., 2016). Notably, noradrenergic neurons in the brain do not have this requirement; Hand2 expression therefore establishes an important difference between central and peripheral noradrenergic neurons.
Although the various Hand2 expression domains offer the possibility of experimental access to important cell types and tissues using recombinase-based transgenic or viral tools, only one recombinase driver, a Cre transgene utilizing a 7.4 kb fragment of the Hand2 promoter region, has been described (Ruest et al., 2003). To leverage the power of intersectional genetics (Awatramani et al., 2003; Jensen & Dymecki, 2014), for investigation of developmental and functional heterogeneity among Hand2-expressing cells, and to allow the use of pre-existing Cre and Flp driver alleles of other genes, we report here the generation and characterization of a Hand2 knock-in allele expressing Dre recombinase. Dre expression from the new Hand2em1(dre)Pjen allele (Hand2Dre) copies endogenous Hand2 expression in embryos, and expression levels in heterozygotes are sufficient to recombine rox target sites in a Dre-responsive reporter allele. Hand2Dre homozygotes are viable, allowing their use in complex crosses to increase the number of experimentally useful offspring. Thus, Hand2Dre will be a useful tool in combination with Dre/Cre- or Dre/Flp/Cre-responsive reporters (He et al., 2017; Madisen et al., 2015; Plummer et al., 2015), actuators (Sciolino et al., 2016; Wang et al., 2022), and viral constructs (Madisen et al., 2015) for precise manipulation of Hand2-derived cell types.
2. RESULTS AND DISCUSSION
To generate an allele expressing Dre recombinase without compromising HAND2 function, we targeted a 2A peptide (Donnelly et al., 2001; Trichas et al., 2008), mammalian codon-optimized Dre cDNA (Anastassiadis et al., 2009), and polyadenylation cassette to exon 2 of the Hand2 gene. The targeting construct replaces the stop codon and 76 base-pairs (bp) of the 3’ untranslated region (UTR) without affecting the coding sequence of Hand2 (Figure 1). Mice homozygous for the new Hand2Dre allele are born at Mendelian ratios and are fertile, with no gross morphological defects and no evidence of the early lethality associated with loss of function mutations. This result indicates that insertion of the Dre cDNA has not disrupted any critical regulatory elements of the modified Hand2 allele.
Figure 1: Structure of the Hand2Dre allele.

A schematic diagram of the Hand2 locus (a) shows the insertion site of the 2A-Dre-poly(A) cassette. Black rectangles represent Hand2 coding sequence. Unfilled rectangles represent 5’ and 3’ UTR extending beyond the limits of the diagram. Partial sequence of wild-type Hand2 exon 2 (b) shows the binding site of the sgRNA on the reverse strand (italicized blue text) and 76 nucleotides deleted in the Hand2Dre allele (underlined). Upper case text indicates coding sequence, and lower case indicates 3’ UTR. Sequence from the Hand2Dre allele (c) shows the junction between Hand2, 2A peptide, and Dre cDNA. An exogenous BamHI restriction site (underlined) links Hand2 exon 2 to the 2A peptide. The black arrowhead indicates the cleavage site in the 2A peptide.
In situ hybridization of E10.5 mouse embryos demonstrated identical hybridization patterns using Hand2 and Dre riboprobes (Figure 2a–b). Labeling from both riboprobes was observed in developing heart, limb bud, and a variety of neural crest-derived tissues, including the mandibular component of the first branchial arch and the sympathetic chain. As expected, no expression was observed in the brain. At E14.5, labeling with the Hand2 and Dre riboprobes was also widespread; Dre was present in all tissues and structures where Hand2 expression was observed, including tongue and mandible (Figure 2c–d), sympathetic ganglia (Figure 2c–f), heart (Figure 2e–f), enteric neurons lining the gut (Figure 2g–j), developing skeleton (e.g. in the paw of the hindlimb, Figure 2g–h), and adrenal gland (Figure 2k–l). Staining with the Dre riboprobe was consistently less dense than the Hand2 probe, likely because a Hand2Dre heterozygote has two functional alleles expressing Hand2 and only one expressing Dre.
Figure 2: Identical expression patterns of Dre and Hand2 at E10.5 and E14.5.

Labeled riboprobes hybridized to sequential sagittal sections from an E10.5 mouse embryo demonstrate identical Hand2 (a) and Dre (b) expression patterns. Atr, common atrial chamber of heart; BC, bulbus cordis; 1Br, mandibular component of the first branchial arch; hLB, hindlimb bud (see insets); SyC, sympathetic chain. The posterior end of the limb bud, exhibiting higher concentration of Hand2 and Dre mRNA, is uppermost because the embryo was curled. At E14.5 (c-l), spatial expression of the two probes remains identical. To, tongue; Mn, mandible; SCG, superior cervical ganglion; Ht, heart; Vt, wall of ventricle; SyG, sympathetic ganglia; MiG, loops of midgut in the physiological umbilical hernia; LuG, lumen of gut in abdomen; Li, liver; Ki; kidney; Adr, adrenal gland. Scalebar: 1000 μm a-b, 500 μm a-b inset, 2000 μm c-d, 1200 μm e-f, 1000 μm g-h, 680 μm i-j, 685 μm k-l.
To confirm that Dre expression levels are sufficient for recombination, we generated mice heterozygous for Hand2Dre and a Dre-responsive reporter encoding enhanced green fluorescent protein (EGFP) (Plummer et al., 2015). Dre-mediated recombination resulted in EGFP expression throughout the Hand2 expression domain at E9.5 and E10.5 (Figure 3). Although the overall pattern of fluorescence in the Dre reporter cross closely matched the results of in situ hybridization, we observed one clear difference: fluorescence extended throughout both anterior and posterior domains of the limb buds at E10.5 (Figure 3e). In contrast, Hand2 and Dre mRNA were concentrated at the posterior end of the bud (Figure 2, insets). Similar labeling throughout the limb bud at E10.5 was observed when the Hand2-Cre transgene was crossed to a Cre-reporter (Ruest et al., 2003). That labeling was attributed to ectopic Cre expression driven by the transgene, because Hand2 mRNA was detected by in situ hybridization only in the posterior domain during E9.75–10.75, spreading weakly to an anterior domain only at E11.5 and later (Charité et al., 2000; Fernandez-Teran et al., 2000; Galli et al., 2010). The highly sensitive RNAscope in situ hybridization (Wang et al., 2012) used here, however, confirms that Hand2 is expressed in the anterior limb bud at E10.5, albeit at lower levels than in the posterior domain (Figure 2a, inset). The similarly low level of Dre expression (Figure 2b, inset) is clearly sufficient to drive fluorophore expression throughout the limb bud (Figure 3e), reflecting the efficiency with which Hand2Dre recombines the reporter allele.
Figure 3: Hand2Dre recombines a Dre-responsive reporter allele in mouse embryos.

A schematic diagram (a) shows recombination of the RC::RG allele by Hand2Dre, resulting in expression of enhanced green fluorescent protein (EGFP). Brightfield (b, d) and fluorescence images (c, e) show whole-mount Hand2Dre; RC::RG double heterozygous embryos at E9.5 and E10.5. EGFP fluorescence indicates tissue with a history of Hand2Dre expression. Faint fluorescence in the E9.5 head appears to be background autofluorescence because it is absent from the E10.5 tissue. fLB; forelimb bud; hLB, hindlimb bud. Scalebar: 550 μm (b, c); 1000 μm (d, e).
These results confirm that Dre expression from Hand2Dre faithfully copies wild-type Hand2 expression and recombines Dre-responsive genetic constructs. Dre recombinase has been used extensively for intersectional genetic analysis and exhibits no cross-reactivity with the Flp/FRT recombinase system (Fenno et al., 2014). Cross-reactivity with the Cre/loxP system is either negligible or absent in experiments involving knock-in alleles (Madisen et al., 2015; Plummer et al., 2016; Plummer et al., 2015), with low levels of cross-reactivity only associated with viral overexpression of recombinase and/or target (Fenno et al., 2014). Hand2Dre will therefore be useful for genetic intersectional labeling and functional manipulation of subsets of cells that express Hand2. For example, Hand2Dre could be used in conjunction with existing DbhCre (Roman et al., 2016; Tillage et al., 2020) or DbhFlpo (Robertson et al., 2013) knock-in alleles to distinguish noradrenergic neurons in the central nervous system (Dbh+, Hand2-negative) and periphery (Dbh+, Hand2+). More generally, cell types that have been targeted using Cre-responsive conditional knockout alleles of Hand2 (Galli et al., 2010; Hendershot et al., 2007; Morikawa et al., 2007; Tsuchihashi et al., 2011) can also be targeted using the same Cre driver and Hand2Dre, together with Cre/Dre-responsive reporters or actuators. Hand2Dre can also be used with appropriately targeted Dre-responsive viruses in the absence of a second recombinase. We therefore anticipate that Hand2Dre will be useful to investigators studying the autonomic nervous system and a wide variety of other tissues that express Hand2 developmentally or in the adult mouse.
3. METHODS
3.1. Generation of Hand2Dre mice
To generate a repair template for Crispr/Cas9 editing of the Hand2 locus, homology arms were amplified by polymerase chain reaction (PCR) from genomic DNA of G4 embryonic stem (ES) cells (George et al., 2007). The 5’ homology arm, flanked by an exogenous Sal I site at its 5’ end, and BamHI and HindIII sites at its 3’ end, was amplified with primers 5’-TAGATCGTCGACTTCCAAAACCGAGGCTGCCTCTGAC and 5’- TAGATCAAGCTTGGATCCCTGCTTGAGCTCCAGGGCCCAGAC. The 3’ homology arm, flanked by HindIII and EcoRI at its 5’ end, and SphI at its 3’ end was amplified with primers 5’- TAGATCAAGCTTGAATTCCCGTTCTGAGGACTTCTTGCAGTTG and 5’- TAGATCGCATGCGCTCCCCAAACACAAAACGAAGCAC. The 5’ arm was digested with SalI and HindIII, the 3’ arm with HindIII and SphI, and they were subcloned simultaneously into pGem-5Z (Promega, Madison, WI) digested with SalI and SphI to generate plasmid pGEM-Hand2. A DNA fragment consisting of 2A peptide, mammalian codon-optimized Dre cDNA, and SV40 polyadenylation cassette was amplified from genomic DNA of an En1Dre mouse (Plummer et al., 2016) with primers 5’- TAGATCGGATCCGGCAGTGGAGAGGGCAGAGGAAGTC and 5’- TAGATCGAATTCGATCCAGACATGATAAGATACATTG. The PCR product was digested with BamHI and EcoRI and subcloned between the BamHI and EcoRI sites of pGEM-Hand2 to generate the repair template pGEM-Hand2Dre which has 2A-Dre-poly(A) flanked by ~1 KB homology arms.
G4 ES cells (B6129F1 genetic background; (George et al., 2007) were transfected with a 6:1 molar ratio of pGEM-Hand2Dre and plasmid PX457 (Addgene #62988; (Ran et al., 2013) encoding Cas9, a puromycin resistance gene, and sgRNA (GTCCTCAGAACGGAGCCCGA). After transfection, cells were subjected to 48 hours of selection with 0.9 μg/ml puromycin followed by standard clonal expansion and screening. Homologous recombination results in replacement of the Hand2 stop codon and 73 bp of 3’ untranslated region, including the sgRNA binding site, preventing recutting of the recombinant allele by Cas9. Homologous recombinants were identified by PCR using primers 5’- GGTTCCAGTGACTCCACTATTGGTC (external to 5’ arm, forward) with 5’- TCCTTGCCGATGTTCCTCAGGAATC (Dre, reverse) and 5’- TAATCAGCCATACCACATTTGTAGAGG (SV40 polyA, forward) with 5’- ACTATTTCCTATGCCTGTAATAAGGC (external to 3’ arm, reverse). Targeted ES cells were microinjected into blastocysts of B6(Cg)-Tyrc−2J/J mice (Jackson Laboratory stock 000058) to produce chimeric mice. Male chimeras were bred to female C57BL/6J mice (Jackson Laboratory stock 000664) to establish the Hand2em1(dre)Pjen (Hand2Dre) mouse line, and the line was maintained by continued backcrossing to C57BL/6J for >10 generations. B6(Cg)-HandDre mice will be available to the research community upon publication of this manuscript. It is recommended that researchers confirm basic characterization if using this or any genetically modified mouse line on a genetic background other than the one on which it was first characterized.
3.2. Experimental crosses and tissue collection
All procedures related to animal use were approved by the Animal Care and Use Committee of the National Institute of Environmental Health Sciences. Mice were group-housed and maintained on a 12-hour light/dark cycle at 72±2 °F with constant access to food and water. For assessment of in vivo recombination, HandDre heterozygotes at generation N10 of the C57BL/6J backcross were crossed to Gt(ROSA)26Sortm1.5(CAG-EGFP)Pjen (RC::RG) mice (Plummer et al., 2015). For timed matings, noon of the day on which plugs were observed was considered E0.5. Pregnant dams were euthanized by CO2 inhalation before embryo dissection, and embryos were fixed by immersion in 4% paraformaldehyde (PFA) diluted in 0.01 M phosphate buffered saline (PBS) overnight at 4 °C. After fixation, embryos were equilibrated sequentially in 10%, 20%, and 30% sucrose diluted in PBS. The cryoprotected embryos were embedded in Tissue Freezing Medium (General Data Company, Cincinnati, OH). After cutting on a CM3050 S cryostat (Leica Biosystems, Buffalo Grove, IL), 14-μm-thick sections were mounted on Superfrost Plus slides (Thermo Scientific, Waltham, MA), air dried, and stored at −80 °C.
3.3. In situ hybridization
RNAscope in situ hybridization (Wang et al., 2012) was performed on sections from Hand2Dre embryos at E10.5 (generation N10 of C57BL/6J backcross) and E14.5 (generation N3) using RNAscope 2.5 HD Reagent Kit-Red (Advanced Cell Diagnostics, Hayward, CA). Probes for Hand2 (cat# 499821, Advanced Cell Diagnostics) and Dre (Cat# 442641, Advanced Cell Diagnostics) were hybridized to tissue sections according to manufacturer’s instructions. After probe hybridization, tissue was counterstained with hematoxylin.
3.4. Imaging
Whole-mount embryos were imaged on a SterREO Lumar.V12 stereomicroscope (Carl Zeiss Microscopy, Thornwood, NY), and embryo sections were imaged on an Observer.Z1 inverted microscope (Carl Zeiss) with EC-Plan Neofluar 10x/0.3 objective. Brightfield tile images of the entire section were digitally stitched using Zen 3.0 Blue software (Carl Zeiss). To make figures, images were imported into Photoshop software (Adobe Systems, San Jose, CA) and modified only by adjusting the brightness and contrast of the entire image.
ACKNOWLEDGEMENTS
We thank the NIEHS Comparative Medicine Branch and Fluorescence Microscopy and Imaging Center for valuable support. The NIEHS Gene Editing and Mouse Model Core Facility performed CRISPR/Cas9-mediated gene targeting and generated chimeric mice. This research was supported by the Intramural Research Program of the US National Institutes of Health, National Institute of Environmental Health Sciences (ZIA ES102805 to PJ).
Footnotes
Conflict of Interest Statement: The authors report no biomedical financial interests or potential conflicts of interest.
REFERENCES
- Anastassiadis K, Fu J, Patsch C, Hu S, Weidlich S, Duerschke K, . . . Stewart AF (2009). Dre recombinase, like Cre, is a highly efficient site-specific recombinase in E. coli, mammalian cells and mice. Dis Model Mech, 2(9–10), 508–515. 10.1242/dmm.003087 [DOI] [PubMed] [Google Scholar]
- Awatramani R, Soriano P, Rodriguez C, Mai JJ, & Dymecki SM (2003). Cryptic boundaries in roof plate and choroid plexus identified by intersectional gene activation. Nat Genet, 35(1), 70–75. 10.1038/ng1228 [DOI] [PubMed] [Google Scholar]
- Charité J, McFadden DG, & Olson EN (2000). The bHLH transcription factor dHAND controls Sonic hedgehog expression and establishment of the zone of polarizing activity during limb development. Development, 127(11), 2461–2470. 10.1242/dev.127.11.2461 [DOI] [PubMed] [Google Scholar]
- Donnelly MLL, Hughes LE, Luke G, Mendoza H, Ten Dam E, Gani D, & Ryan MD (2001). The ‘cleavage’ activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring ‘2A-like’ sequences. J Gen Virol, 82(Pt 5), 1027–1041. 10.1099/0022-1317-82-5-1027 [DOI] [PubMed] [Google Scholar]
- Doxakis E, Howard L, Rohrer H, & Davies AM (2008). HAND transcription factors are required for neonatal sympathetic neuron survival. EMBO Rep, 9(10), 1041–1047. 10.1038/embor.2008.161 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, . . . Deisseroth K (2014). Targeting cells with single vectors using multiple-feature Boolean logic. Nat Methods, 11(7), 763–772. 10.1038/nmeth.2996 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fernandez-Teran M, Piedra ME, Kathiriya IS, Srivastava D, Rodriguez-Rey JC, & Ros MA (2000). Role of dHAND in the anterior-posterior polarization of the limb bud: implications for the Sonic hedgehog pathway. Development, 127(10), 2133–2142. 10.1242/dev.127.10.2133 [DOI] [PubMed] [Google Scholar]
- Funato N, Kokubo H, Nakamura M, Yanagisawa H, & Saga Y (2016). Specification of jaw identity by the Hand2 transcription factor. Sci Rep, 6, 28405. 10.1038/srep28405 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Galli A, Robay D, Osterwalder M, Bao X, Bénazet JD, Tariq M, . . . Zeller R (2010). Distinct roles of Hand2 in initiating polarity and posterior Shh expression during the onset of mouse limb bud development. PLoS Genet, 6(4), e1000901. 10.1371/journal.pgen.1000901 [DOI] [PMC free article] [PubMed] [Google Scholar]
- George SH, Gertsenstein M, Vintersten K, Korets-Smith E, Murphy J, Stevens ME, . . . Nagy A (2007). Developmental and adult phenotyping directly from mutant embryonic stem cells. Proc Natl Acad Sci U S A, 104(11), 4455–4460. 10.1073/pnas.0609277104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- He L, Li Y, Li Y, Pu W, Huang X, Tian X, . . . Zhou B (2017). Enhancing the precision of genetic lineage tracing using dual recombinases. Nat Med, 23(12), 1488–1498. 10.1038/nm.4437 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hendershot TJ, Liu H, Clouthier DE, Shepherd IT, Coppola E, Studer M, . . . Howard MJ (2008). Conditional deletion of Hand2 reveals critical functions in neurogenesis and cell type-specific gene expression for development of neural crest-derived noradrenergic sympathetic ganglion neurons. Dev Biol, 319(2), 179–191. 10.1016/j.ydbio.2008.03.036 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hendershot TJ, Liu H, Sarkar AA, Giovannucci DR, Clouthier DE, Abe M, & Howard MJ (2007). Expression of Hand2 is sufficient for neurogenesis and cell type-specific gene expression in the enteric nervous system. Dev Dyn, 236(1), 93–105. 10.1002/dvdy.20989 [DOI] [PubMed] [Google Scholar]
- Jensen P, & Dymecki SM (2014). Essentials of recombinase-based genetic fate mapping in mice. Methods Mol Biol, 1092, 437–454. 10.1007/978-1-60327-292-6_26 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, . . . Zeng H (2015). Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Neuron, 85(5), 942–958. 10.1016/j.neuron.2015.02.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morikawa Y, D’Autréaux F, Gershon MD, & Cserjesi P (2007). Hand2 determines the noradrenergic phenotype in the mouse sympathetic nervous system. Dev Biol, 307(1), 114–126. 10.1016/j.ydbio.2007.04.027 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Morikawa Y, Dai YS, Hao J, Bonin C, Hwang S, & Cserjesi P (2005). The basic helix-loop-helix factor Hand 2 regulates autonomic nervous system development. Dev Dyn, 234(3), 613–621. 10.1002/dvdy.20544 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Osterwalder M, Speziale D, Shoukry M, Mohan R, Ivanek R, Kohler M, . . . Zeller R (2014). HAND2 targets define a network of transcriptional regulators that compartmentalize the early limb bud mesenchyme. Dev Cell, 31(3), 345–357. 10.1016/j.devcel.2014.09.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Plummer NW, de Marchena J, & Jensen P (2016). A knock-in allele of En1 expressing dre recombinase. Genesis, 54(8), 447–454. 10.1002/dvg.22954 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Plummer NW, Evsyukova IY, Robertson SD, de Marchena J, Tucker CJ, & Jensen P (2015). Expanding the power of recombinase-based labeling to uncover cellular diversity. Development, 142(24), 4385–4393. 10.1242/dev.129981 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, & Zhang F (2013). Genome engineering using the CRISPR-Cas9 system. Nat Protoc, 8(11), 2281–2308. 10.1038/nprot.2013.143 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Robertson SD, Plummer NW, de Marchena J, & Jensen P (2013). Developmental origins of central norepinephrine neuron diversity. Nat Neurosci, 16(8), 1016–1023. 10.1038/nn.3458 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Roman CW, Derkach VA, & Palmiter RD (2016). Genetically and functionally defined NTS to PBN brain circuits mediating anorexia. Nat Commun, 7, 11905. 10.1038/ncomms11905 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ruest LB, Dager M, Yanagisawa H, Charité J, Hammer RE, Olson EN, . . . Clouthier DE (2003). dHAND-Cre transgenic mice reveal specific potential functions of dHAND during craniofacial development. Dev Biol, 257(2), 263–277. 10.1016/s0012-1606(03)00068-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schmidt M, Lin S, Pape M, Ernsberger U, Stanke M, Kobayashi K, . . . Rohrer H (2009). The bHLH transcription factor Hand2 is essential for the maintenance of noradrenergic properties in differentiated sympathetic neurons. Dev Biol, 329(2), 191–200. 10.1016/j.ydbio.2009.02.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sciolino NR, Plummer NW, Chen YW, Alexander GM, Robertson SD, Dudek SM, . . . Jensen P (2016). Recombinase-Dependent Mouse Lines for Chemogenetic Activation of Genetically Defined Cell Types. Cell Rep, 15(11), 2563–2573. 10.1016/j.celrep.2016.05.034 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Srivastava D, Cserjesi P, & Olson EN (1995). A subclass of bHLH proteins required for cardiac morphogenesis. Science, 270(5244), 1995–1999. 10.1126/science.270.5244.1995 [DOI] [PubMed] [Google Scholar]
- Srivastava D, Thomas T, Lin Q, Kirby ML, Brown D, & Olson EN (1997). Regulation of cardiac mesodermal and neural crest development by the bHLH transcription factor, dHAND. Nat Genet, 16(2), 154–160. 10.1038/ng0697-154 [DOI] [PubMed] [Google Scholar]
- Stanzel S, Stubbusch J, Pataskar A, Howard MJ, Deller T, Ernsberger U, . . . Tsarovina K (2016). Distinct roles of hand2 in developing and adult autonomic neurons. Dev Neurobiol, 76(10), 1111–1124. 10.1002/dneu.22378 [DOI] [PubMed] [Google Scholar]
- Tillage RP, Sciolino NR, Plummer NW, Lustberg D, Liles LC, Hsiang M, . . . Weinshenker D (2020). Elimination of galanin synthesis in noradrenergic neurons reduces galanin in select brain areas and promotes active coping behaviors. Brain Struct Funct, 225(2), 785–803. 10.1007/s00429-020-02035-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Trichas G, Begbie J, & Srinivas S (2008). Use of the viral 2A peptide for bicistronic expression in transgenic mice. BMC Biol, 6, 40. 10.1186/1741-7007-6-40 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tsuchihashi T, Maeda J, Shin CH, Ivey KN, Black BL, Olson EN, . . . Srivastava D (2011). Hand2 function in second heart field progenitors is essential for cardiogenesis. Dev Biol, 351(1), 62–69. 10.1016/j.ydbio.2010.12.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang F, Flanagan J, Su N, Wang LC, Bui S, Nielson A, . . . Luo Y (2012). RNAscope: a novel in situ RNA analysis platform for formalin-fixed, paraffin-embedded tissues. J Mol Diagn, 14(1), 22–29. 10.1016/j.jmoldx.2011.08.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H, He L, Li Y, Pu W, Zhang S, Han X, . . . Zhou B (2022). Dual Cre and Dre recombinases mediate synchronized lineage tracing and cell subset ablation in vivo. J Biol Chem, 298(6), 101965. 10.1016/j.jbc.2022.101965 [DOI] [PMC free article] [PubMed] [Google Scholar]
