Skip to main content
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2024 May 13;10(3):e1475. doi: 10.1002/vms3.1475

Prevalence and antimicrobial susceptibility of Salmonella enteritidis and Salmonella typhimurium isolated from hen eggs and quail eggs in Karaj, Iran

Asghar Yousefi Amin 1, Mojgan Oshaghi 1,, Sina Habibi 2, Mohsen Bashashati 3, Mohammad Hossein Fallah Mehrabadi 3, Sedigheh Sadat Safavieh 4
PMCID: PMC11090146  PMID: 38739101

Abstract

Background and aim

Different Salmonella serotypes are considered one of the most important food pathogens in the world. Poultry meat and eggs are the primary carriers of Salmonella in human populations. This study aimed to estimate the Salmonella enteritidis and Salmonella typhimurium contamination rates of retail hen and quail eggs in Karaj, Iran. Moreover, the antimicrobial resistance patterns of the strains were evaluated, and the efficiency of the standard culture method and multiplex polymerase chain reaction (m‐PCR) were compared.

Materials and methods

In this descriptive cross‐sectional study over 1 year (Jan–Dec 2022), 150 commercial and 150 backyard hen eggs and 300 commercial quail eggs, without cracks and fractures, were collected randomly from best selling groceries in Karaj city. All samples were examined for Salmonella contamination independently by standard culture and m‐PCR approaches. A standard disc diffusion method was employed to assess the antimicrobial susceptibility of the strains against 18 antimicrobial agents.

Results

Out of 300 examined eggs, 2 S. enteritidis strains were isolated from the shell of backyard hen eggs. The same serotype was also detected in the contents of one of these two eggs. One S. typhimurium was isolated from the shell of a commercial hen egg. Overall, the Salmonella contamination of the shell and contents was 1% and 0.3%, respectively. Salmonella was not isolated from the eggshells or the contents of the quail eggs. There was complete agreement between the results of m‐PCR and the standard culture methods. Among the 18 tested antibiotics, the highest resistance was recorded for colistin (100%), followed by nalidixic acid (75%).

Conclusion

As most Salmonella spp. are associated with human food poisoning, continuous surveillance is required to effectively reduce the risk posed by contaminated poultry eggs. Furthermore, mandatory monitoring of antimicrobial use on Iranian poultry farms is recommended.

Keywords: antibiogram, chicken, eggshell, Galliformes, multiplex PCR, quail, Salmonella enteritidis, Salmonella typhimurium


This study in Karaj, Iran, assessed Salmonella contamination in retail hen and quail eggs, focusing on Salmonella enteritidis and Salmonella typhimurium. The eggs were examined using standard culture and multiplex PCR methods. Results showed a 1% contamination rate on the shell and 0.3% in the contents of hen eggs, with the highest resistance recorded for colistin (100%). No Salmonella was found in quail eggs. The findings underscore the need for continuous surveillance and regulation of antimicrobials on poultry farms.

graphic file with name VMS3-10-e1475-g001.jpg

1. INTRODUCTION

Salmonella is a common gastrointestinal bacterial pathogen that frequently causes isolated cases or widespread outbreaks of gastrointestinal diseases. Up to 80% of Salmonella infections in humans are not associated with any recognized outbreak and are thus classified as sporadic (Teklemariam et al., 2023). This bacterium is found mainly in poultry, eggs, and dairy products, and in general, animals such as pigs, poultry and cattle are the primary sources of Salmonella infection (Popa & Papa, 2021). More than 2500 Salmonella serotypes have been identified (Jajere, 2019). In 2010, the World Health Organization (WHO) documented approximately 153 million global cases of non‐typhoidal Salmonella (NTS) infection, with 56,969 being fatal and almost half originating from food. Additionally, in 2019, 23 European countries reported 926 Salmonella foodborne outbreaks, resulting in 9169 cases, 1915 hospitalizations and 7 deaths. The most common form of NTS infection is gastroenteritis, an inflammatory disease of the gastrointestinal tract accompanied by diarrhoea and abdominal pain that is usually self‐limiting (Sodagari et al., 2020). The severity of a Salmonella infection varies according to its serotype and the host's health status. Children, the elderly and patients with weak immune systems are more susceptible to Salmonella infection than healthy people (Uche et al., 2017). According to the studies, the predominant serotypes of NTS infections reported worldwide include Salmonella enteritidis (65%), Salmonella typhimurium (12%) and Salmonella Newport (4%) (Doulat et al., 2018).

Infections caused by S. enteritidis and S. typhimurium require treatment and, in some cases, lead to the hospitalization of the patient (Rogers et al., 2021). Therefore, the spread of drug resistance in Salmonella is a sign of the spread of resistance genes in this bacterium, and the rapid emergence of these antimicrobial resistances by microbial pathogens is a threat to public health (Wang et al., 2020; Xie et al., 2019). This has led to more severe systemic illnesses, increased treatment failures and a rise in hospitalizations (Di Marcantonio et al., 2022; Ramatla et al., 2021).

Salmonella contamination can be found in foods of animal or plant origin, such as vegetables, tomatoes, mangoes, fruit or fruit pulp, cereals, poultry, eggs, pork and fish (O'Bryan et al., 2022). Salmonella reservoirs animals include farm animals, reptiles, amphibians and birds (Igbinosa et al., 2023; Kowalska, 2023). Additionally, Salmonella‐infected lymph nodes in meats intended for consumption may cause foodborne disease (Harvey et al., 2020). Among food products of animal origin, bird eggs are a cheap and accessible food source in terms of their high nutritional value (presence of essential amino acids and vitamins) (García et al., 2011). Because eggs are used in food products such as sauces, seasonings, and other types of food, they can be used raw or half‐cooked and can always be the source of Salmonella contamination (Doulat et al., 2018). Although hen eggs are widely consumed, other poultry eggs are also prevalent. The consumption of quail eggs has received attention due to the expansion of quail breeding farms in different countries (Askari Badouei et al., 2012). Due to the valuable properties of quail eggs and the increase in market demand, the production of the product has grown significantly in recent years (Thomas et al., 2016).

Between 2013 and 2019 in Iran, Salmonella caused 350 (16.7%) of the 2098 reported foodborne outbreaks (Manzari et al., 2022). Several Iranian studies have examined the prevalence and characteristics of Salmonella. In broiler chicken farms in Shiraz, Southern Iran, the Salmonella prevalence was 36.4% at the farm level and 34.3% at the flock level (Ansari‐Lari et al., 2022). Furthermore, a study in Shiraz, Iran, examined the prevalence and features of Salmonella strains from food‐producing animals and human diarrhoea cases. Of the 105 Salmonella isolates obtained, most (70%) originated from chicken meat, followed by beef (19%), lamb (11%) and human stool (1.7%). The predominant serotypes detected were Salmonella infantis (40.9%), S. enteritidis (29.5%) and Salmonella paratyphi B (8.6%) (Manzari et al., 2022). In a study across 6 provinces in Iran (Tehran, Qazvin, Mazandaran, West‐Azerbaijan, Khuzestan and Sistan‐Baluchestan), a total of 3125 samples were examined for Salmonella contamination, including 2250 poultry samples and 875 poultry egg samples. The prevalence of Salmonella was 8.7% in poultry samples and 6.3% in egg samples overall, with 1.3% specifically positive for S. enteritidis. Additionally, 27.0% of S. enteritidis isolates were multidrug‐resistant (Bahramianfard et al., 2021). Another study in Iran found S. enteritidis to be the predominant serotype contaminating eggs (Hosseininezhad et al., 2020). The prevalence of Salmonella contamination was 3% in locally supplied eggs in Tabriz, whereas industrial and breeder eggs appeared safer (Danesh Ghohar et al., 2017). Antibiotic resistance is also an issue, as a high proportion of Salmonella isolates displayed multidrug resistance (Moosavy et al., 2015). These results underscore the necessity for appropriate surveillance and control interventions on poultry farms and retail outlets to prevent Salmonella transmission. The current study has investigated the level of contamination of backyard and commercial eggs and quail eggs sold on the Karaj city market in Iran with common Salmonella serotypes by culture and the multiplex polymerase chain reaction (m‐PCR) method and their resistance to antibiotics.

2. MATERIALS AND METHODS

2.1. Samples collection

We randomly collected 300 hen eggs (including 150 commercial and 150 backyard hen eggs) and 300 commercial quail egg samples from 60 different best‐seller groceries in 4 assumed Karaj areas from January to December 2022. The samples were transferred to the laboratory in sterile bags to examine Salmonella contamination by culture and m‐PCR methods.

2.2. Isolation and identification of Salmonella spp. from hen and quail eggs

2.2.1. Isolation from the shell

Each sample was removed from its single bag under sterile conditions and placed in a Whirl‐Pak sample bag (Nasco) containing 20 mL of tryptic soy broth pre‐enrichment medium (TSB; BD, LOT no. 211825). The shell was rinsed in the TSB by massaging it for 1 min. After saving 1 mL of the medium in a freezer at −70°C for the subsequent molecular test, the remainder was transferred to a flask and incubated at 37°C for 18–24 h (Doulat et al., 2018; Gorski & Noriega, 2023).

2.2.2. Isolation from the contents

Following disinfecting each sample by immersing it in 70% ethanol for 3 min, the shell was broken under sterile conditions, and its contents were poured into a 50‐mL wide‐mouth bottle. The mixture was shaken vigorously after the cap was closed until the contents were as homogenized as possible. After preserving 4 mL of homogenized contents for future molecular tests, the rest was transferred to a 250‐mL wide‐mouth bottle containing 150‐mL of pre‐warmed TSB. After closing the cap and shaking, the bottle was incubated at 37°C for 18–24 h (Doulat et al., 2018).

2.2.3. Culture process

The samples for Salmonella isolation and identification were tested using the ISO 6579 protocol. After incubation, the pre‐enriched media (TSB) were cultured in a ratio of 1:10 on tetrathionate broth (HiMedia, LOT no. M032) and in a ratio of 1:100 on Rappaport Vassiliadis medium (HiMedia, LOT no. M880), followed by incubation at 37 and 42°C, respectively. After the incubation period, the cultures were streaked on xylose–lysine–deoxycholate agar (Merck, LOT no. 105287) and Salmonella‐Shigella agar (BD, LOT no. 274500) media. Suspected colonies for Salmonella spp. (H2S‐producing and non‐lactose fermenter colonies) were selected for confirmatory biochemical tests. Isolates were cultured on Triple Sugar–Iron agar (HiMedia, LOT no. 211825), SIM medium (BD, LOT no. 211578), urea agar (Merck, LOT no. 108492), lysine iron agar (BD, LOT no. 211363), Simmons citrate agar (HiMedia, LOT no. M099) and Methyl Red‐Voges Proskauer broth (HiMedia, LOT no. GM070) for further confirmation of Salmonella spp. ONPG disks (HiMedia, LOT no. DD008) were used to detect the beta‐galactosidase activity of late lactose fermenters (Bahramianfard et al., 2021).

2.2.4. Serotyping test

The Salmonella isolates were serotyped using the Kauffman–White scheme (Besharati et al., 2020; Li et al., 2020). Salmonella spp. were subjected to serological tests by the agglutination method using polyvalent antisera against serogroups A, B, C and D (Baharafshan). S. typhimurium ATCC 14028 was used as the positive control.

2.3. Detection of Salmonella spp. from the shell and contents of the samples using the m‐PCR method

2.3.1. DNA extraction

DNA extraction was performed independently for each sample originating from the shell and contents using the High Pure PCR Template Preparation Kit (Roche), according to the manufacturer's instructions. Because of the high viscosity, the samples' contents were completely homogenized before extraction using a vortex.

2.3.2. The m‐PCR assay

All samples were subjected to m‐PCR analysis to identify Salmonella spp., S. enteritidis and S. typhimurium. The sequences of the primer sets are shown in Table 1. The m‐PCR was performed with the addition of 2 μL of DNA extracted to the PCR mix containing 1× PCR buffer (Sinaclon), 0.4 mM of the dNTP mix (Bio Basic), 0.5 μM of each primer, 2.0 mM MgCl2, 12.25 μL of nuclease‐free water, and 1.25 U of Taq DNA polymerase (Sinaclon) to a final reaction of 25 μL. The thermo‐profile was 94°C/2 min for initial denaturation, followed by 35 cycles of 94°C/15 s, 58°C/30 s and 72°C/1 min, and a final extension at 72°C/5 min. Finally, 10‐μL aliquots of PCR products were electrophoresed on a 1% agarose gel and stained with SYBR Safe DNA Gel‐Stain (Thermo Fisher Scientific). S. typhimurium ATCC 14028, S. enteritidis ATCC 13076, Salmonella heidelberg ATCC 8326, Salmonella typhi ATCC 27870, and Escherichia coli ATCC 25922 were used as quality control strains.

TABLE 1.

The sequences of primers for multiplex polymerase chain reaction (m‐PCR).

Amplification target Target gene The nucleotide sequence (5′–3′) Amplicon length (bp) References
Salmonella spp. ompC F: ATCGCTGACTTATGCAATCG 204 Garcia et al. (2021)
R: CGGGTTGCGTTATAGGTCTG
Salmonella enteritidis sdf1 F: TGTGTTTTATCTGATGCAAGAGG 304 Hur et al. (2011)
R: TGAACTACGTTCGTTCTTCTGG
Salmonella typhimurium Spy F: TTGTTCACTTTTTACCCCTGAA 401 Anbazhagan et al. (2019)
R: CCCTGACAGCCGTTAGATATT

2.4. Antibiotic susceptibility

The Kirby‐Bauer disk diffusion method was used to perform an antibiotic susceptibility test for Salmonella strains (Hudzicki, 2009). Briefly, the strains were cultured on blood agar for 16–18 h at 37°C. Colonies were suspended in normal saline, adjusted to a 0.5 McFarland standard, and spread on the surface of Mueller–Hinton Agar plates (Merck, LOT no. 103872). Then, antibiotic disks (PadtanTeb) were placed on the agar surface. After 24 h of incubation at 37°C, the diameter of inhibition zones was measured and compared according to the Clinical Laboratory Standards Institute (CLSI) guidelines (Humphries et al., 2021).

Antibiotic resistance to streptomycin (10 μg), sulfamethoxazole/trimethoprim (23.75 μg/1.25 μg), azithromycin (15 μg), trimethoprim (5 μg), nalidixic acid (30 μg), amoxicillin (10 μg), amikacin (30 μg), ceftriaxone (30 μg), tetracycline (30 μg), florfenicol (30 μg), colistin (10 μg), fosfomycin (20 μg), enrofloxacin (5 μg), ceftiofur (30 μg), doxycycline (30 μg), gentamicin (10 μg), ciprofloxacin (32 μg) and amoxicillin/clavulanic acid (20 μg/10 μg) was investigated.

The colistin broth disk elution method was performed according to the CLSI recommendations to determine the minimum inhibitory concentrations (MICs) for the Salmonella strains. Four tubes containing 10 mL cation‐adjusted Mueller–Hinton broth (HiMedia, LOT no. M1657) for each isolate with 0, 1, 2 or 4 colistin disks (10 μg, PadtanTeb) with final concentrations of 0, 1, 2 and 4 μg/mL were prepared. After incubating the tubes at room temperature for 30 min to allow colistin to elute from the disks, 50 μL of standardized inoculum was added to each tube, vortexed, and incubated at 35°C in ambient air for 16–20 h. MICs were determined visually and interpreted using the CLSI breakpoints (MIC ≤ 2 μg/mL = intermediate, MIC ≥ 4 μg/mL = resistant). Pseudomonas aeruginosa ATCC 27853 was used for quality control (Simner et al., 2019).

Out of the 18 antibiotics that were tested, 8 antibiotics are used in the veterinary field, including sulfamethoxazole/trimethoprim, tetracycline, florfenicol, colistin, ceftiofur, fosfomycin, enrofloxacin and doxycycline.

2.5. Statistical analysis

Regarding descriptive data, the results are reported in frequency and percentage tables. The chi‐square test was also used to compare the groups. All analyses were performed using IBM SPSS software for Windows (version 22, SPSS Inc.). p‐Values less than 0.05 were considered significant.

3. RESULTS

3.1. Salmonella isolated from samples by the culture method

In total, Salmonella was isolated from three samples (0.5%), of which two isolates (1.3%) were isolated from backyard hen eggs, and one isolate (0.7%) was isolated from commercial hen eggs. Based on Salmonella contamination, there is no statistically significant difference between backyard and commercial hen eggs (p‐value = 1.000). Salmonella was not isolated from the eggshells or the contents of the quail eggs (Table 2).

TABLE 2.

Total containment of samples.

Sample type N Contamination (%) p‐Value
Hen eggs Backyard 150 2 (1.3) 1.000 *
Commercial 150 1 (0.7)
Quail eggs Commercial 300 0
Total 600 3 (0.5)
*

Fisher's exact test.

Of the 300 Hen eggs tested, 3 Salmonella spp. were isolated from the shell (1%), and a Salmonella was isolated from the content of the samples tested (0.3%). Regarding the shell test, two strains of Salmonella serogroup D were isolated from two separate backyard hen eggs, and one Salmonella serogroup B was also isolated from a commercial hen egg. Regarding the content tested, one Salmonella serogroup D was isolated from the backyard hen egg content. Moreover, Salmonella was not isolated from the contents of any commercial hen eggs. It should be noted that the isolated serogroup from the content was isolated from the same egg from which Salmonella serogroup D was also isolated from its shell. Based on Salmonella contamination, there is a statistically significant difference between the shells and the contents of the eggs examined (p‐value = 0.010) (Table 3).

TABLE 3.

The number and percentage of Salmonella isolated from the investigated samples based on the isolation location, the serogroup and the serotype.

Sample type Hen eggs (n = 300) Serogroup Serotype p‐Value
Backyard Commercial
Hen eggs Shell 2 (0.7) 1 (0.3) B and D S. enteritidis, S. typhimurium 0.010 *
Content 1 (0.3) 0 D S. enteritidis

Abbreviations: S. enteritidis, Salmonella enteritidis; S. typhimurium: Salmonella typhimurium.

*

Fisher's exact test.

3.2. Salmonella detected in samples by the m‐PCR method

For all Salmonella‐positive samples, these bacteria were detected independently by both traditional culture and m‐PCR methods, and the results of both methods were identical. However, due to the limitations of biochemical and serological tests, only Salmonella serogroups B and D were diagnosed, and S. enteritidis and S. typhimurium serotypes could only be analysed by m‐PCR (Table 3). Furthermore, the control strains of other B and D groups were tested, and no cross‐reactivity was observed (Figure 1).

FIGURE 1.

FIGURE 1

Multiplex polymerase chain reaction (PCR) of Salmonella typhimurium ATCC 14028 (PC), Salmonella enteritidis ATCC 13076 (PC), Salmonella heidelberg ATCC 8326 (1), Salmonella typhi ATCC 27870 (2 and 3), and Escherichia coli ATCC 25922 (NC) as control strains.

3.3. Investigating antibiotic resistance in Salmonella strains isolated from samples

The four Salmonella strains were assessed for their antimicrobial resistance. All four strains were resistant to colistin (100%); however, only three strains were resistant to nalidixic acid (75%), and one strain was resistant to ciprofloxacin (25%) (Table 4). Furthermore, the four Salmonella strains were susceptible to antibiotics (100%): sulfamethoxazole/trimethoprim, trimethoprim, amoxicillin, gentamicin, amoxicillin/clavulanic acid, tetracycline, florfenicol, ceftriaxone, ceftiofur, fosfomycin, amikacin, azithromycin and doxycycline. All four strains had intermediate resistance to the veterinary antibiotic enrofloxacin, and only one strain showed intermediate resistance to streptomycin and ciprofloxacin (Table 5).

TABLE 4.

Frequencies of Salmonella strains (n = 4) obtained from commercial and backyard hen eggs with resistance to different antibiotics.

Antibiotic Resistance (%) Strain no.
Colistin 4 (100) 1, 2, 3 and 4
Nalidixic acid 3 (75) 1, 2 and 3
Ciprofloxacin 1 (25) 1

TABLE 5.

Bacterial susceptibility patterns of the 4 strains to 18 tested antibiotics according to the 2021 Clinical Laboratory Standards Institute (CLSI) table.

Strain no. Bacterial strain Sample type
1 Salmonella enteritidis Backyard shell
2 S. enteritidis Backyard shell
3 Salmonella typhimurium Commercial shell
4 S. enteritidis Backyard content
Strains no.
Antibiogroups Antibiotics Resistance Intermediate
Aminoglycoside S, AN, GM 4 (S)
Sulfonamide + dihydrofolate reductase inhibitor SXT, TMP
Macrolide AZM
Quinolone NA 1, 2, 3
Fluoroquinolone NFX, CP 1 (CP)
  1. (NFX),

  2. (NFX),

  3. (NFX),

  4. (NFX, CP)

Penicillin + beta‐lactamase Inhibitor AM, AMC
Cephalosporin (3rd generation) CRO, CEF
Tetracycline TE, D
Amphenicol FF
Polymyxin CL 1, 2, 3, 4
Phosphonic acid FOS

Abbreviations: AM, amoxicillin; AMC, amoxicillin/clavulanic acid; AN, amikacin; AZM, azithromycin; CEF, ceftiofur; CL, colistin; CP, ciprofloxacin; CRO, ceftriaxone; D, doxycycline; FF, florfenicol; FOS, fosfomycin; GM, gentamicin; NA, nalidixic acid; NFX, enrofloxacin; S, streptomycin; SXT, sulfamethoxazole/trimethoprim; TE, tetracycline; TMP, trimethoprim.

4. DISCUSSION

Salmonellosis is one of the most common foodborne diseases. Containment of eggs and bird eggs with S. enteritidis and S. typhimurium leads to human salmonellosis (Ferrari et al., 2019). These two serotypes are widespread in Asia and Europe (Hosseininezhad et al., 2020). Therefore, screening and investigating the contamination of this widely consumed product to control and optimize the production, distribution, storage and sale of this food seems necessary from the point of view of public health.

The findings of this study indicated that the total isolation rate of Salmonella in commercial and backyard hen eggs (shells and contents) was 1%, which is higher than the study conducted in Egypt (0%) (Abdel‐Maksoud et al., 2015) and much lower compared to the amount reported in China (5.4%), Spain (34%) and Nigeria (67%) (García et al., 2011; Michael et al., 2018; Xie et al., 2019). Different reports range from 0% to 29% in other regions of Iran (Hosseininezhad et al., 2020). This difference in the isolation rate of Salmonella can be related to the differences in health management programs in different countries, including the level of compliance with health orders, the poultry‐keeping environment, how to keep eggs and the method employed in isolating and identifying bacteria.

Another popular food among Iranians in recent years is quail eggs. In this study, Salmonella contamination was not observed in the shells or contents of the quail eggs. Due to the lack of backyard‐type quail eggs in Iran, only commercial quail eggs were examined in this study. Previous studies in Iran have reported a prevalence range of 0%–0.7% for this pathogen (Javan et al., 2012; Rahimi et al., 2022). In contrast to the present findings, there are different reports of quail egg contamination in other countries. This rate ranges from 3% in Nigeria, 12.5% in Serbia and 13.3% in Bangladesh (Bata et al., 2016; Jahan et al., 2018; Tasić, 2022). The influence of environmental factors, the health of quail egg production centres and the endemicity of Salmonella in some areas can cause this difference. Fortunately, there was no Salmonella contamination in any of the 300 quail eggs tested in this study, indicating proper hygiene in the production and storage of quail eggs in the investigated areas.

In our study, the percentage of Salmonella contamination of commercial and backyard eggshells was 0.3% and 0.07%, respectively. Previous studies from various cities in Iran have reported higher Salmonella contamination rates in commercial and backyard eggshells compared to our findings; for example, in Khorramabad city, 0%; in Talash city, 19% and 4%; and in Mashhad city, 22.5% and 39%, respectively (Hosseininezhad et al., 2020). However, one study in Zanjan, Iran, found no Salmonella contamination in commercial eggs (Karimiazar et al., 2019). Similarly, in a study in Egypt, commercial egg contamination was 0% (Eid et al., 2015). These findings are much lower than a similar survey in India, which reported 20.66% in commercial and 4% in backyard eggshells (Harsha et al., 2011).

In the present study, the percentage of Salmonella contamination of the egg content of commercial and backyard was 0% and 0.3%, respectively, which is a significant difference compared to a similar study in South India, where the isolation rate in the egg content of commercial and backyard was 1.33% and 2%, respectively (Harsha et al., 2011). In many studies, such as ours, Salmonella has not been isolated from commercial egg contents (Doulat et al., 2018; Hosseininezhad et al., 2020), but in similar studies in Iran, there are different reports of contamination of backyard egg contents with Salmonella (from 0% to 10%) (Hosseininezhad et al., 2020). The difference in the pathogen isolation rate is justified based on the hygiene level, the poultry coop environment, the way eggs are kept, sample size and the difference in the geographical area.

The results of the present study demonstrated that, as in most other studies, Salmonella contamination in the shell of the eggs tested was more significant than its contents (1% vs. 0.3%) (p‐value = 0.010). This result is not far from expected because the contamination of the shell can happen as a result of direct contamination with the faeces of infected hens during laying, contaminated bedding, or contamination during transportation, handling or storage (Abdel‐Maksoud et al., 2015; Hosseininezhad et al., 2020; Merati & Boudra, 2023). Furthermore, like other studies, the amount of Salmonella contamination in backyard eggs was higher than in commercial eggs (1.3% and 0.7%, respectively). Rigorous health control measures implemented across the commercial egg supply chain, from breeder farms to packaging, significantly reduce contamination levels compared to backyard eggs. Backyard egg production lacks controls to prevent microbial contamination from the beginning of the supply chain and does not involve separating visibly dirty eggs. Therefore, backyard eggs have a higher probability of bacterial contamination and transfer.

This research observed simultaneous Salmonella contamination in a backyard egg sample in the shell and contents, similar to the Ferreira et al. (2020) study. It is possible to contaminate the shell and contents horizontally and vertically simultaneously. In horizontal transmission, Salmonella penetration occurs through the shell due to contamination of the shell in the path leading to the cloaca during or after laying eggs and contamination with Salmonella in different ways, including contaminated poultry faeces. This shell contamination can also penetrate the egg's contents (Gast et al., 2020). In vertical transmission, the egg contents are contaminated through the ovary and before the formation of the shell. In other words, the contamination of the yolk, white, shell and different membranes of the egg before laying occurs due to infection of the poultry reproductive system with Salmonella (Liu et al., 2022).

Based on the results of m‐PCR studies on the detection of Salmonella serotypes isolated from the eggshells and egg contents, it was found that of the four strains: Three were S. enteritidis (two strains from the shell and one strain from the contents of the backyard eggs), and a strain is S. typhimurium (from commercial eggshell). As no reactions were observed with control strains from other serovars of groups B and D, the reaction for identifying S. enteritidis and S. typhimurium is entirely specific.

Based on studies carried out in Iran and other countries on contaminated eggs, the most common isolated serotypes of hen eggs include S. enteritidis and S. typhimurium (Hosseininezhad et al., 2020; Merati & Boudra, 2023; Sabeer & Abeer, 2019), which is consistent with the results of our study. The prevalence of S. enteritidis is due to its vertical transmission and colonization in the hen reproductive system, which can contaminate the contents and the shell. Therefore, raw eggs are considered a vital transmission factor (Liu et al., 2023).

Regarding comparing the culture method and the m‐PCR method to identify Salmonella in the investigated samples, in this study, there was a complete agreement between the processes of identifying Salmonella bacteria using the culture method and the m‐PCR method, and selective genes successfully distinguished these serovars of S. enteritidis and S. typhimurium from their homologous bacteria. In the research carried out in Brazil by Moraes et al. (2016) on commercial eggs using culture and qPCR methods, the Salmonella isolation rate of eggs was 5.4% in the culture method and 16% in the qPCR method, which shows that the results are inconsistent with the results of our study. Moreover, using the m‐PCR method has resulted in faster identification of Salmonella in samples.

Our results showed that isolated Salmonella strains were susceptible to most human and animal antibiotics tested (14 agents). Moreover, multi‐drug resistance was not observed, which was inconsistent with several similar studies (Eid et al., 2015; Farahani et al., 2018; Hossain et al., 2019; Merati & Boudra, 2023). However, all the strains in both serotypes were resistant to colistin. These results contrast with similar studies that reported either sensitivity or very low resistance to colistin (Bahramianfard et al., 2021; Merati & Boudra, 2023). The high resistance to colistin among the Salmonella strains isolated in this study and the risk of horizontal gene transfer indicates that the indiscriminate use of colistin in poultry may threaten public health. Moreover, our results showed reduced sensitivity to enrofloxacin, the latter being among the antibiotics used in poultry. In a study in Bangladesh, a resistance rate of 31.3% to enrofloxacin was reported in Salmonella strains isolated from eggs (Mahmud et al., 2013). However, all isolated strains of S. enteritidis showed resistance to nalidixic acid, and one strain of S. enteritidis and one strain of S. typhimurium showed resistance or reduced sensitivity to the antibiotic ciprofloxacin. These results aligned with the Kapena et al. (2020).

The high prevalence of resistance to nalidixic acid among S. enteritidis strains is quite noticeable. Furthermore, the simultaneous observation of decreased ciprofloxacin sensitivity and resistance to nalidixic acid indicates a change in resistance pattern. Due to the use of fluoroquinolones in veterinary medicine (Sodhi & Singh, 2021), the emergence and spread of resistant strains among animals used to prepare human food are significant. Therefore, the frequent and indiscriminate use of antibiotics in food products should be limited so that these products do not become a reservoir for drug‐resistant strains and do not endanger human health.

Due to the durability of Salmonella in the eggshell, for food safety and the reduction of foodborne diseases, control measures and continuous health inspections should be increased at the level of chicken farms and poultry product sales and storage centres. The unrestricted and widespread use of antibiotics on poultry farms should be reduced to limit the emergence of antibiotic‐resistant strains in foodborne bacteria.

Although the prevalence of Salmonella in the samples examined in this study is small, more studies with a larger sample size are needed for a more detailed investigation of the issue.

5. CONCLUSIONS

The results of the present study show a low level of contamination in the shell and contents of eggs with Salmonella in Karaj, Iran. Meanwhile, the level of contamination in backyard eggs was higher than in commercial eggs. In addition, no Salmonella was isolated from the shell or contents of the quail eggs. Among the Salmonella bacteria, two strains of S. enteritidis and S. typhimurium were isolated from the eggs. Due to the time‐consuming culture‐based methods, the m‐PCR techniques can be used for faster diagnosis of Salmonella spp. All four strains in this study resisted colistin, a last‐resort antibiotic. Most strains also showed resistance to a first‐line antibiotic, nalidixic acid, and intermediate resistance to the veterinary antibiotic ciprofloxacin. Nonetheless, the strains largely remained susceptible to 14 other antibiotics. These findings show Salmonella antibiotic resistance in livestock, underscoring the importance of reasonable antibiotic use in animal agriculture. Although other antibiotics remain useful against these strains, ongoing monitoring and conservation practices are vital to maintaining antimicrobial effectiveness in food animals over time.

AUTHOR CONTRIBUTIONS

Formal analysis; investigation: Asghar Yousefi Amin and Sedigheh Sadat Safavieh. Conceptualization; data curation; formal analysis; investigation; methodology; project administration; supervision; validation; visualization; writing – original draft; writing – review and editing: Mojgan Oshaghi. Software; validation; visualization; writing – original draft; writing – review and editing: Sina Habibi. Formal analysis; investigation; methodology; supervision: Mohsen Bashashati and Mohammad Hossein Fallah Mehrabadi.

CONFLICT OF INTEREST STATEMENT

There are no conflicts of interest.

FUNDING INFORMATION

Research Council of Iran University of Medical Sciences in 2021

PEER REVIEW

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.1475

ETHICS STATEMENT

This experimental research study was approved with an ethical code of ‘IR.IUMS.REC.1399.032’ at the Iran University of Medical Sciences, Tehran, Iran.

Yousefi Amin, A. , Oshaghi, M. , Habibi, S. , Bashashati, M. , Fallah Mehrabadi, M. H. , & Safavieh, S. S. (2024). Prevalence and antimicrobial susceptibility of Salmonella enteritidis and Salmonella typhimurium isolated from hen eggs and quail eggs in Karaj, Iran. Veterinary Medicine and Science, 10, e1475. 10.1002/vms3.1475

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.

REFERENCES

  1. Abdel‐Maksoud, M. , Abdel‐Khalek, R. , El‐Gendy, A. , House, B. L. , Gamal, R. F. , & Abdelhady, H. M. (2015). Genetic characterisation of multidrug‐resistant Salmonella enterica serotypes isolated from poultry in Cairo, Egypt. African Journal of Laboratory Medicine, 4(1), 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anbazhagan, P. V. , Thavitiki, P. R. , Varra, M. , Annamalai, L. , Putturu, R. , Lakkineni, V. R. , & Pesingi, P. K. (2019). Evaluation of efflux pump activity of multidrug‐resistant Salmonella typhimurium isolated from poultry wet markets in India. Infection and Drug Resistance, 12, 1081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ansari‐Lari, M. , Hosseinzadeh, S. , Manzari, M. , & Khaledian, S. (2022). Survey of Salmonella in commercial broiler farms in Shiraz, southern Iran. Preventive Veterinary Medicine, 198, 105550. [DOI] [PubMed] [Google Scholar]
  4. Askari Badouei, M. , Mohammadian Ghalejooghi, B. , & Madadgar, O. (2012). Study on Salmonella contamination of traditionally produced edible poultry eggs. Comparative Clinical Pathology, 21, 1093–1097. [Google Scholar]
  5. Bahramianfard, H. , Derakhshandeh, A. , Naziri, Z. , & Khaltabadi Farahani, R. (2021). Prevalence, virulence factor and antimicrobial resistance analysis of Salmonella enteritidis from poultry and egg samples in Iran. BMC Veterinary Research, 17(1), 196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bata, S. , Karshima, N. , Yohanna, J. , Dashe, M. , Pam, V. , & Ogbu, K. (2016). Isolation and antibiotic sensitivity patterns of Salmonella species from raw beef and quail eggs from farms and retail outlets in Jos, Plateau State, Nigeria. Journal of Veterinary Medicine and Animal Health, 8, 29–34. [Google Scholar]
  7. Besharati, S. , Sadeghi, A. , Ahmadi, F. , Tajeddin, E. , Salehi, R. M. , Fani, F. , Pouladfar, G. , Nikmanesh, B. , Majidpour, A. , & Moghadam, S. S. (2020). Serogroups, and drug resistance of nontyphoidal Salmonella in symptomatic patients with community‐acquired diarrhea and chicken meat samples in Tehran. Iranian Journal of Veterinary Research, 21(4), 269. [PMC free article] [PubMed] [Google Scholar]
  8. Danesh Ghohar, S. , Javadi, A. , & Dehnad, A. (2017). Molecular analysis, serotyping and antibiogram pattern of Salmonella in marketed local, industrial and breeder poultry eggs in Tabriz City, Iran. Journal of Food Biosciences and Technology, 7(2), 75–82. [Google Scholar]
  9. Di Marcantonio, L. , Romantini, R. , Marotta, F. , Chiaverini, A. , Zilli, K. , Abass, A. , Di Giannatale, E. , Garofolo, G. , & Janowicz, A. (2022). The current landscape of antibiotic resistance of Salmonella infantis in Italy: The expansion of extended‐spectrum beta‐lactamase producers on a local scale. Frontiers in Microbiology, 13, 812481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Doulat, A. , Mahzounieh, M. R. , Shams, N. , & Etemdfar, L. (2018). Prevalence and comparison of Salmonella serotypes in indigenous and industrial chicken eggs collected from Khorramabad using culture and PCR methods. Iranian Journal of Medical Microbiology, 12(2), 88–95. [Google Scholar]
  11. Eid, S. , Nasef, S. A. , & Erfan, A. M. (2015). Multidrug resistant bacterial pathogens in eggs collected from backyard chickens. Assiut Veterinary Medical Journal, 61(144), 87–103. [Google Scholar]
  12. Farahani, R. K. , Ehsani, P. , Ebrahimi‐Rad, M. , & Khaledi, A. (2018). Molecular detection, virulence genes, biofilm formation, and antibiotic resistance of Salmonella enterica serotype enteritidis isolated from poultry and clinical samples. Jundishapur Journal of Microbiology, 11(10), e69504. [Google Scholar]
  13. Ferrari, R. G. , Rosario, D. K. , Cunha‐Neto, A. , Mano, S. B. , Figueiredo, E. E. , & Conte‐Junior, C. A. (2019). Worldwide epidemiology of Salmonella serovars in animal‐based foods: A meta‐analysis. Applied and Environmental Microbiology, 85(14), e00519–00591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ferreira, V. , Cardoso, M. , Magalhães, R. , Maia, R. , Neagu, C. , Dumitraşcu, L. , Nicolau, A. , & Teixeira, P. (2020). Occurrence of Salmonella spp. in eggs from backyard chicken flocks in Portugal and Romania‐results of a preliminary study. Food Control, 113, 107180. [Google Scholar]
  15. García, C. , Soriano, J. , Benítez, V. , & Catalá‐Gregori, P. (2011). Assessment of Salmonella spp. in feces, cloacal swabs, and eggs (eggshell and content separately) from a laying hen farm. Poultry Science, 90(7), 1581–1585. [DOI] [PubMed] [Google Scholar]
  16. Garcia, D. T. , Nascimento, Y. F. , de Cunha Dias, S. , Moura, A. O. , Costa, P. C. , do Amaral, A. B. , Peres, P. A. B. M. , de Fátima Carrijo, K. , & Cossi, M. V. (2021). Microbiological assessment at slaughter of chicken carcasses from commercial, backyard and semi‐backyard production systems. The Journal of Infection in Developing Countries, 15(12), 1891–1898. [DOI] [PubMed] [Google Scholar]
  17. Gast, R. K. , Jones, D. R. , Guraya, R. , Anderson, K. E. , & Karcher, D. M. (2020). Research note: Horizontal transmission and internal organ colonization by Salmonella enteritidis and Salmonella Kentucky in experimentally infected laying hens in indoor cage‐free housing. Poultry Science, 99(11), 6071–6074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gorski, L. , & Noriega, A. A. (2023). Comparison of phenotype nutritional profiles and phosphate metabolism genes in four serovars of Salmonella enterica from water sources. Microorganisms, 11(8), 2109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Harsha, H. , Reshmi, R. , Varghese, R. , Divya, P. S. , Rahiman, K. M. , & Hatha, A. M. (2011). Prevalence and antibiotic resistance of Salmonella from the eggs of commercial samples. Journal of Microbiology and Infectious Diseases, 1(03), 93–100. [Google Scholar]
  20. Harvey, R. B. , Norman, K. N. , Anderson, R. C. , & Nisbet, D. J. (2020). A preliminary study on the presence of Salmonella in lymph nodes of sows at processing plants in the United States. Microorganisms, 8(10), 1602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hossain, M. S. , Hossain, K. , Sarker, M. M. A. , & Hamid, S. A. (2019). Prevalence and antibiotic susceptibility of Salmonella from chicken eggs in Naogaon District of Bangladesh. Journal of Advances in Microbiology, 19, 1–6. [Google Scholar]
  22. Hosseininezhad, B. , Berizi, E. , Nader, M. , Mazloomi, S. M. , Hosseinzadeh, S. , Ebrahimi, L. , & Zare, M. (2020). Prevalence of Salmonella contamination in consumed eggs in Iran: A systematic review and meta‐analysis study on published studies from 1996 to 2018. Veterinary World, 13(12), 2743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hudzicki, J. (2009). Kirby‐Bauer disk diffusion susceptibility test protocol. American Society for Microbiology, 15, 55–63. [Google Scholar]
  24. Humphries, R. , Bobenchik, A. M. , Hindler, J. A. , & Schuetz, A. N. (2021). Overview of changes to the clinical and laboratory standards institute performance standards for antimicrobial susceptibility testing, M100. Journal of Clinical Microbiology, 59(12), e00213–e00221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hur, J. , Kim, J. H. , Park, J. H. , Lee, Y.‐J. , & Lee, J. H. (2011). Molecular and virulence characteristics of multi‐drug resistant Salmonella enteritidis strains isolated from poultry. The Veterinary Journal, 189(3), 306–311. [DOI] [PubMed] [Google Scholar]
  26. Igbinosa, I. H. , Amolo, C. N. , Beshiru, A. , Akinnibosun, O. , Ogofure, A. G. , El‐Ashker, M. , Gwida, M. , Okoh, A. I. , & Igbinosa, E. O. (2023). Identification and characterization of MDR virulent Salmonella spp isolated from smallholder poultry production environment in Edo and Delta States, Nigeria. PloS ONE, 18(2), e0281329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Jahan, S. , Zihadi, M. A. H. , Nazir, K. N. H. , Islam, M. S. , Rahman, M. B. , & Rahman, M. (2018). Molecular detection and antibiogram of Salmonella spp. from apparently healthy Japanese quails of three different quail farms in Mymensingh. Journal of Advanced Veterinary and Animal Research, 5(1), 60–66. [Google Scholar]
  28. Jajere, S. (2019). A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors, host specificity and antimicrobial resistance including multidrug resistance. Veterinary World, 12, 504–521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Javan, A. , Staji, H. , Ghazvinian, K. , Vayeghan, A. , Salimi, M. , & Mahdavi, A. (2012). Prevalence of Salmonella spp. in the quail egg interior contents: A provincial study. Iranian Journal of Veterinary Medicine, 6(3), 191–196. [Google Scholar]
  30. Kapena, M. S. , Muma, J. B. , Mubita, C. M. , & Munyeme, M. (2020). Antimicrobial resistance of Escherichia coli and Salmonella in raw retail table eggs in Lusaka, Zambia. Veterinary World, 13(11), 2528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Karimiazar, F. , Soltanpour, M. S. , Aminzare, M. , & Hassanzadazar, H. (2019). Prevalence, genotyping, serotyping, and antibiotic resistance of isolated Salmonella strains from industrial and local eggs in Iran. Journal of Food Safety, 39(1), e12585. [Google Scholar]
  32. Kowalska, B. (2023). Fresh vegetables and fruit as a source of Salmonella bacteria. Annals of Agricultural and Environmental Medicine, 30(1), 9–14. [DOI] [PubMed] [Google Scholar]
  33. Li, W. , Li, H. , Zheng, S. , Wang, Z. , Sheng, H. , Shi, C. , Shi, X. , Niu, Q. , & Yang, B. (2020). Prevalence, serotype, antibiotic susceptibility, and genotype of Salmonella in eggs from poultry farms and marketplaces in Yangling, Shaanxi province, China. Frontiers in Microbiology, 11, 1482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Liu, B. , Zhang, X. , Ding, X. , Bin, P. , & Zhu, G. (2022). The vertical transmission of Salmonella enteritidis in a one‐health context. One Health, 16, 100469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Liu, B. , Zhang, X. , Ding, X. , Bin, P. , & Zhu, G. (2023). The vertical transmission of Salmonella enteritidis in a one‐health context. One Health, 16, 100469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Mahmud, T. , Hassan, M. M. , Alam, M. , Khan, M. M. , Bari, M. S. , & Islam, A. (2013). Prevalence and multidrug‐resistant pattern of Salmonella from the eggs and egg‐storing trays of retail markets of Bangladesh. International Journal of One Health, 2, 7–11. [Google Scholar]
  37. Manzari, M. , Fani, F. , Alebouyeh, M. , Moaddeli, A. , Farzami, M. R. , Shahidi, M. A. , & Shekarforoush, S. S. (2022). Multidrug‐resistant Salmonella strains from food animals as a potential source for human infection in Iran. Comparative Immunology, Microbiology and Infectious Diseases, 90, 101898. [DOI] [PubMed] [Google Scholar]
  38. Merati, R. , & Boudra, A. (2023). Detection and antimicrobial susceptibility of Salmonella spp. Isolated from commercial eggs in Tiaret Province, Algeria. World's Veterinary Journal, 13(1), 200–204. [Google Scholar]
  39. Michael, A. O. , Afolabi, O. O. , Friday, A. D. , & Saliu, A. (2018). Evaluation of prevalence and antimicrobial resistance of Salmonella spp isolated from chicken eggs sold in Ilorin, Nigeria. Archives of Current Research International, 13(2), 1–7. [Google Scholar]
  40. Moosavy, M.‐H. , Esmaeili, S. , Amiri, F. B. , Mostafavi, E. , & Salehi, T. Z. (2015). Detection of Salmonella spp in commercial eggs in Iran. Iranian Journal of Microbiology, 7(1), 50. [PMC free article] [PubMed] [Google Scholar]
  41. Moraes, D. , Duarte, S. , Bastos, T. , Rezende, C. , Leandro, N. , Café, M. , Stringhini, J. , & Andrade, M. (2016). Detection of Salmonella spp. by conventional bacteriology and by quantitative polymerase‐chain reaction in commercial egg structures. Brazilian Journal of Poultry Science, 18, 117–124. [Google Scholar]
  42. O'Bryan, C. A. , Ricke, S. C. , & Marcy, J. A. (2022). Public health impact of Salmonella spp. on raw poultry: Current concepts and future prospects in the United States. Food Control, 132, 108539. [Google Scholar]
  43. Popa, G. L. , & Papa, M. I. (2021). Salmonella spp. infection‐a continuous threat worldwide. GERMS, 11(1), 88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rahimi, Z. , Ghajarbeygi, P. , Mahmoudi, R. , Mosavi, S. , & Mehrabi, A. (2022). Prevalence of Salmonella strains isolated from industrial quail eggs and local duck eggs, Iran. Carpathian Journal of Food Science & Technology, 14(2), 165–174. [Google Scholar]
  45. Ramatla, T. , Tawana, M. , Onyiche, T. E. , Lekota, K. E. , & Thekisoe, O. (2021). Prevalence of antibiotic resistance in Salmonella serotypes concurrently isolated from the environment, animals, and humans in South Africa: A systematic review and meta‐analysis. Antibiotics, 10(12), 1435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Rogers, A. W. , Tsolis, R. M. , & Bäumler, A. J. (2021). Salmonella versus the microbiome. Microbiology and Molecular Biology Reviews, 85(1), e00019–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Saber, A. S. , & Abeer, H. A. (2019). Molecular characterization of Salmonella species isolated from chicken table egg content. Assiut Veterinary Medical Journal, 65(162), 83–92. [Google Scholar]
  48. Simner, P. J. , Bergman, Y. , Trejo, M. , Roberts, A. A. , Marayan, R. , Tekle, T. , Campeau, S. , Kazmi, A. Q. , Bell, D. T. , & Lewis, S. (2019). Two‐site evaluation of the colistin broth disk elution test to determine colistin in vitro activity against gram‐negative bacilli. Journal of Clinical Microbiology, 57(2), e01118–1163. 10.1128/jcm [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sodagari, H. R. , Wang, P. , Robertson, I. , Habib, I. , & Sahibzada, S. (2020). Non‐typhoidal Salmonella at the human‐food‐of‐animal‐origin interface in Australia. Animals, 10(7), 1192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Sodhi, K. K. , & Singh, D. K. (2021). Insight into the fluoroquinolone resistance, sources, ecotoxicity, and degradation with special emphasis on ciprofloxacin. Journal of Water Process Engineering, 43, 102218. [Google Scholar]
  51. Tasić, S. (2022). Salmonella spp. contamination in Japanese quail (Coturnix japonica) eggs. Knowledge‐International Journal, 50(3), 343–346. [Google Scholar]
  52. Teklemariam, A. D. , Al‐Hindi, R. R. , Albiheyri, R. S. , Alharbi, M. G. , Alghamdi, M. A. , Filimban, A. A. R. , Mutiri, A. S. A. , Al‐Alyani, A. M. , Alseghayer, M. S. , & Almaneea, A. M. (2023). Human salmonellosis: A continuous global threat in the farm‐to‐fork food safety continuum. Foods, 12(9), 1756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Thomas, K. S. , Jagatheesan, P. R. , Reetha, T. L. , & Rajendran, D. (2016). Nutrient composition of Japanese quail eggs. International Journal of Science, Environment and Technology, 5(3), 1293–1295. [Google Scholar]
  54. Uche, I. V. , MacLennan, C. A. , & Saul, A. (2017). A systematic review of the incidence, risk factors and case fatality rates of invasive nontyphoidal Salmonella (iNTS) disease in Africa (1966 to 2014). PLoS Neglected Tropical Diseases, 11(1), e0005118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wang, M. , Qazi, I. H. , Wang, L. , Zhou, G. , & Han, H. (2020). Salmonella virulence and immune escape. Microorganisms, 8(3), 407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Xie, T. , Wu, G. , He, X. , Lai, Z. , Zhang, H. , & Zhao, J. (2019). Antimicrobial resistance and genetic diversity of Salmonella enterica from eggs. Food Science & Nutrition, 7(9), 2847–2853. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.


Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES