Effect of Goji Berry extract on cell viability of Lactiplantibacillus plantarum M5 microcapsules during in vitro gastrointestinal digestion

Abstract

Lactiplantibacillus plantarum M5 and Goji Berry extract were co-microencapsulated to maintain the activity of cells during gastrointestinal digestion, and the mechanism by which they could maintain high activity was investigated. The results showed that the microcapsules with 3% Goji Berry extract(A-GE-3) had the largest encapsulation efficiency(EE) of 92.41 ± 0.58%. SEM showed that the structure of A-GE-3 microcapsules were smoother and denser. Cell viability in A-GE-3 microcapsules remained at 7.17 log₁₀ CFU/g after gastrointestinal digestion. Meanwhile, during the gastrointestinal digestion with 3% Goji Berry extract, cell membrane damage detected by fluorescent probes propidium iodide(PI) and 1.1-N-phenylnaphthylamine(NPN) was significantly reduced; the contents of arginine, glutamic acid and oleic acid in cell membrane were increased, which helped to maintain the dynamic balance of intracellular pH and regulated cell membrane fluidity in response to gastrointestinal environment. This study demonstrated the potential of Goji Berry extract as a probiotic protector in gastrointestinal digestion.

Introduction

According to the FAO/WHO definition, probiotics are living microorganisms that, when given in sufficient quantities, bring health benefits to the host (Liu et al., 2019). Studies have shown that probiotics can only play a beneficial role in promoting human health when the number of probiotics in the intestine reaches 10⁶–10⁷ CFU/mL (Li et al., 2023). However, the presence of stomach acid, bile, and digestive enzymes in the human body can make probiotics less active as they travel to their target sites in the gastrointestinal tract, making it difficult for them to colonize the gut efficiently (Chen et al., 2017). Microencapsulation is considered as one of the effective methods to solve the above problems because of its mild conditions. The probiotic Lactiplantibacillus bulgaricus was microencapsulated in whey protein isolates and the microencapsulation gave more significant protection in simulated gastric juice and bile digestion experiments (Chen et al., 2017). Gao et al. (2022) encapsulated probiotics in oil-in-water high internal phase emulsions (HIPEs) prepared from whey protein (WPI) and pectin, and the relative increase in viability of the encapsulated probiotics was about 50% after simulated gastrointestinal digestion experiments.

Plant extracts, as a potential prebiotic, can be converted into metabolites by probiotics to enhance their own viability. Some studies of co-encapsulating plant extracts and probiotics in particles have been reported (Neuenfeldt et al., 2022; Raddatz et al., 2022; Silva et al., 2022; Tasch Holkem and Favaro-Trindade, 2020). All these results suggested that plant extracts could enhance the protective effect of probiotics under stress conditions.

Goji Berry contain many bioactive compounds, including polysaccharides, phenolic compounds, fatty acids, carotenoids and tocopherols (Wang et al., 2023). They were considered to be the main phytochemicals of Goji Berry with major biological activities including antioxidant activity, anti-inflammatory activity, anti-fatigue, and anti-cancer activity (Ma et al., 2022). Some studies had shown that Goji Berry polysaccharide could promote the proliferation of lactic acid bacteria (Zhou et al., 2018), and the addition of Goji Berry capsule powder could improve the growth performance and survival of probiotics in simulating the gastrointestinal digestion(Skenderidis et al., 2019). However, there were no studies on co-microencapsulation of Goji Berry extracts and probiotics.

In this study, we aimed to evaluate the effect of co-microencapsulating Lactiplantibacillus plantarum M5 and Goji Berry extracts and to verify the stability of cell viability in each microcapsule in an in vitro simulated gastrointestinal environment. At the same time, the mechanism of maintaining high activity of gastrointestinal digestion was investigated, which in turn will provide a reference for future studies.

Materials and methods

Materials

Hydrochloric acid, sodium hydroxide, sodium chloride, potassium dihydrogen phosphate, sodium citrate, ox bile salt, glucose, beef extract, yeast extract, tryptone, sodium acetate, dipotassium hydrogen phosphate, diammonium citrate, magnesium sulfate heptahydrate, manganese sulfate, Tween 80 and other chemicals were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China).

Sodium alginate, calcium chloride, food grade, purchased from Henan Sugar Cabinet Food Ltd.; Goji Berry, purchased from Ningxia Qili Xiang Modern Ecological Agriculture Technology Development Ltd.; Pepsin (the enzyme activity is 30,000 U/mL), trypsin (the enzyme activity is 4000 U/g), purchased from Henan Wanbang Chemical Science and Technology Ltd; Lactiplantibacillus plantarum M5, conserved by our research laboratory (Preservation code No. B0016).

Preparation of cell suspension

First, L. plantarum M5 frozen in the refrigerator at − 80 °C was inoculated with an inoculating loop, scribed in MRS solid medium, and incubated in an anaerobic incubator at 37 °C for 36 h. Then, a single colony was picked and inoculated in 10 mL MRS liquid medium and incubated in an anaerobic incubator at 37 °C for 18 h for activation to prepare the seed solution. 1 mL of seed solution was added to 99 mL of MRS broth and incubated at 37 °C for 12 h to obtain fresh cultures. Cells were harvested at 6000×g for 7 min at 4 °C and washed twice with sterile saline under the same centrifugation conditions (Yuan et al., 2021). Cells were resuspended in sterile saline to obtain cell suspensions with a final cell concentration of 10–11 log₁₀ CFU/mL.

Goji Berry extraction

The extracts were prepared according to the method described by Lončarević et al. (2022). The Goji Berry seeds were de-stemmed, de-mixed and washed with sterile water. They were baked in an oven at 50 ± 2 °C to a constant weight (the difference in mass between the first and second batches did not exceed 0.3 mg). After thorough grinding in a mortar, the samples were mixed with deionized water in different ratios (1–5:100, w/v) and extracted at 25 ± 2 °C for 20 min. Then the extracts were centrifuged at 8000×g for 5 min, and the supernatant was taken and stored at 4 °C. The extracts were named as GE-1, GE-2, GE-3, GE-4 and GE-5, respectively.

Microencapsulation

Probiotics were microencapsulated according to the extrusion method described by Zhang et al. (2021) with some modifications. Sodium alginate, L. plantarum M5 cell suspension and different carrier solutions were mixed thoroughly and stirred well, then the mixed solutions were dropped into 0.6%(w/v) sterile calcium chloride solution with a sterile syringe and cured for 40 min. The filtrate was removed and washed twice with sterile deionized water to obtain probiotic microcapsules. They were named as A, A-GE-1, A-GE-2, A-GE-3, A-GE-4, A-GE-5, respectively(A: Microcapsule prepared without extract; A-GE-1: Microcapsule prepared with 1% extract; A-GE-2: Microcapsule prepared with 2% extract; A-GE-3: Microcapsule prepared with 3% extract; A-GE-4: Microcapsule prepared with 4% extract; A-GE-5: Microcapsule prepared with 5% extract). The detailed formula was shown in Table 1.

Table 1.

Composition of carrier solution containing L. plantarum M5

Element	A	A-GE-1	A-GE-2	A-GE-3	A-GE-4	A-GE-5
Sodium alginate (g)	1	1	1	1	1	1
Sterile water (mL)	100	–	–	–	–	–
GE-1 (mL)	–	100	–	–	–	–
GE-2 (mL)	–	–	100	–	–	–
GE-3 (mL)	–	–	–	100	–	–
GE-4 (mL)	–	–	–	–	100	–
GE-5 (mL)	–	–	–	–	–	100
L. plantarum M5 (1010–1011 CFU/mL) (mL)	2	2	2	2	2	2

A, A-GE-1, A-GE-2, A-GE-3, A-GE-4 and A-GE-5 represent the type of microcapsules. A: Microcapsule prepared without extract; A-GE-1: Microcapsule prepared with 1% extract; A-GE-2: Microcapsule prepared with 2% extract; A-GE-3: Microcapsule prepared with 3% extract; A-GE-4: Microcapsule prepared with 4% extract; A-GE-5: Microcapsule prepared with 5% extract

Encapsulation efficiency(EE) and particle size

EE showed the number of viable cells in the microcapsules and was calculated according to the following equation (Maleki et al., 2020):

$$\text{EE}\left(\%\right)=\text{N}/{\text{N}}_0\times 100$$

where EE was the entrapped percentage of microcapsules; N represented the number of viable cells released from the microcapsules (log₁₀ CFU/g), and N₀ represented the number of viable cells before entrapment (log₁₀ CFU/mL).

The particle sizes of 10 random microcapsules were measured with vernier calipers and recorded, and the results were expressed as $\overline{\text{d}}$ (mm).

Morphology

The microcapsules were fixed and then coated with a thin layer of gold using a sputtering coater. The morphology of the microcapsules was characterized at room temperature using a scanning electron microscope (FEI Quanta 200, Netherlands).

Survival of cells in gastrointestinal conditions

To simulate the condition of the human gastrointestinal tract (GIT), a two-stage gastrointestinal model was employed with some modifications according to previously reported methods (Yao et al., 2018). Simulated gastric fluid (SGF): 0.1 g NaCl, 350 μL 0.1 mol/L HCl dissolved in 50 mL water, pH adjusted to 2.0, containing 2% (v/v) pepsin; Simulated intestinal fluid (SIF): 0.34 g KH₂PO₄, 9.5 mL 0.1 mol/L NaOH was dissolved in 50 mL of water, pH adjusted to 7.4, containing 0.2% (v/v) trypsin and 1.2% (v/v) ox bile salts. Simulated gastric and intestinal fluids were filtered and de-bacterized with 0.22 μm aqueous filters. Each sample was added to 9 mL of SGF or SIF and then stored in an incubator shaker operated at a temperature of 37 °C and a shaking rate of 100 rpm or 150 rpm. The viability of the bacteria was evaluated at different times. Free bacteria were used as a control.

Integrity and permeability of membrane

Membrane integrity was performed according to the method of described by Wu et al. (2012) with some modifications. The experiment was divided into three groups. Details were shown in Table 2.

Table 2.

Grouping of gastrointestinal digestion

Component	F	H	H-GE
Cell suspensions (mL)	1	1	1
Sodium alginate solution (mL)	–	1	–
Sodium alginate solution containing GE-3 (mL)	–	–	1
SGF (mL)	9	9	9

After gastrointestinal digestion, the cells were washed with PBS (0.01 M, pH 7.4) and resuspended in it, the cell concentration was adjusted (OD₆₀₀ = 0.5–1.0), and propidium iodide (PI) staining solution was added. Stained in the dark at 4 °C for 10 min with repeated rinses with PBS to remove excess dye. Fluorescence intensity was detected at excitation light 530 nm and emission light 620 nm with a gain of 80.

Membrane permeability was performed according to the method of described by Ning et al. (2017). The same treatment as in the previous paragraph was carried out, except that: after adjusting the bacterial concentration (OD₆₀₀ = 0.5–1.0), 1.1-N-phenylnaphthylamine (NPN) at a final concentration of 10^–4 mol/L was added. The change in fluorescence intensity with time was measured using a fluorescence spectrophotometer(F-7000, Japan).

Amino acid content and transcription levels of related genes

Refer to the method of Stepanov and Zolotareva (2015) with some modifications. 20 mL of cells that had been digested in the simulated stomach for 2 h were collected, washed twice with sterile phosphate buffer (pH 7.0), and then resuspended in 1 mL of the same buffer. The solution was treated in a boiling water bath for 15 min and then centrifuged at 12,000×g for 10 min at 4 °C, and the supernatant was taken. 1 mL of 10% TCA was added to the supernatant and left to stand for 10 min at 25 °C, followed by centrifugation at 4 °C, 12,000×g, for 10 min. Filtration was performed with a 0.22 μm microporous filter membrane. The intracellular glutamate and arginine contents were analyzed using a high-performance liquid chromatograph (Agilent 1100, USA) dedicated to free amino acid analysis.

The extraction of total RNA from the samples was performed according to the product instructions, and the quality of total RNA was assessed based on the results of agarose gel electrophoresis, Nanodrop, Qubit, and Agilent 2100 assays.

Synthesize cDNA according to the Reverse Transcription Reagent (HiScript II Q RT SuperMix for qPCR) Reverse Transcription Kit instructions. Use cDNA as a template, use Novozymes' ΜLtraSYBR SYBR Green (AceQ® Universal SYBR® qPCR Master Mix) and prepare the RT-qPCR system. The 16S rDNA was used as an internal reference, and the relative transcript levels were detected using a Bio-Rad CFX96 Real-Time PCR amplifier(StepOnePlus, USA) and calculated using the 2^−ΔΔCt method (Sa et al., 2021). The RT-qPCR primers for the relevant genes were shown in Table 3.

Table 3.

Primer sequence for RT-qPCR

Primer name	Sequence(5′-3′)
gadA-F	CACGAAATGCGCGATGATGT
gadA-R	AGGCCTCGGAAGAACCAATG
gadB-F	GTGGTCCCAATGGATGAGCA
gadB-R	TGCGGCTCAATAAATGGGGT
arcD-F	TCTACATGCTGATCGCGTCC
arcD-R	AGTGTAGTGTCGGAAAGCGG
argG-F	TATCTGGGGTGACGGTAGCA
argG-R	ACTGTGACTTCTTCTGCCGG
argH-F	CATAGCTGGGTGGAAGGCAA
argH-R	TGCAAACGGCTTTCATCACG
16 s-F	GCATTAAGCATTCCGCCTGG
16 s-R	CCCAACATCTCACGACACGA

Fatty acid composition of membrane

Referring to the method of Pizzuti et al. (2022), the content of fatty acids was determined by gas chromatography-mass spectrometry (GC–MS). The samples after the simulated gastric digestion were collected by centrifugation, washed twice with sterile water, added with 3.0 mL of 0.5 M KOH–methanol solution, incubated at 70 °C for 10 min for saponification. Then 3.0 mL of 14% BF₃-methanol solution was added and incubated at 70℃ for 30 min for methylation, 2 mL of n-hexane and 2 mL of saturated NaCl solution were added, mixed well, and centrifuged at 4000×g for 5 min, and the upper organic layer (containing fatty acid methyl ester) was taken, anhydrous sodium sulfate was added, and the membrane filtered filtrate was determined by GC–MS(TSQ8000, USA).

Statistical analysis

All experiments were repeated three times. Unless otherwise stated, all values were expressed as mean ± standard deviation. The results were analyzed using one-way ANOVA. The Tukey test was used for determination of the significant difference between samples (p < 0.05). All data were analyzed using Origin 2022b and IBM SPSS statistics 26.

Results and discussion

Encapsulation efficiency(EE) and particle size

The EE and particle size of the microcapsules are shown in Table 4. The EE of each microcapsule was more than 83%, and the number of viable cells in A, A-GE-1, A-GE-2, A-GE-3, A-GE-4, and A-GE-5 was 8.71, 9.13, 9.41, 9.66, 9.42, and 9.43 log₁₀ CFU/g, respectively, which were higher than the recommended values for probiotics to exert probiotic effects (10⁶–10⁷ CFU/mL), indicating that this microencapsulation method could effectively capture probiotic cells. The addition of Goji Berry extract significantly increased the encapsulation rate of microcapsules (p < 0.05), and the A-GE-3 exhibited the largest encapsulation rate of 92.41 ± 0.58%. Meanwhile, the inclusion of Goji Berry extract increased the particle size of microcapsules. However, with the further increase of extract concentration, some active substances would occupy the position of probiotics in the microcapsules, which in turn led to the decrease of encapsulation rate(Gaudreau et al., 2016).

Table 4.

EE, particle size of microcapsules

Treatment	log10CFU/g in the solution	log10CFU/g after encapsulation	EE/%	Particle size/mm
A	10.45 ± 0.15a	8.71 ± 0.43d	83.28 ± 0.40d	3.85 ± 0.10b
A-GE-1	10.45 ± 0.15a	9.13 ± 0.08c	87.38 ± 0.53c	4.05 ± 0.04a
A-GE-2	10.45 ± 0.15a	9.41 ± 0.17b	90.03 ± 0.04b	4.05 ± 0.07a
A-GE-3	10.45 ± 0.15a	9.66 ± 0.30a	92.41 ± 0.58a	4.05 ± 0.07a
A-GE-4	10.45 ± 0.15a	9.42 ± 0.07b	90.12 ± 0.17b	4.05 ± 0.01a
A-GE-5	10.45 ± 0.15a	9.43 ± 0.20b	90.17 ± 0.23b	4.05 ± 0.10a

All readings are averages of three readings ± standard deviation

*Values with the same letter in the columns showed no statistically significant difference (p ˃ 0.05, Tukey’s test)

Microstructure

The images were obtained at 40×, 2400× magnification (Fig. 1). The morphology of the microcapsules changed after freeze-drying, with the microcapsules becoming folded and largely spherical in shape. Compared with the microcapsules with only sodium alginate added, the microcapsules became smooth and more compact in texture with the addition of Goji Berry extract, indicating that sodium alginate and Goji Berry extracts were compatible and thus exhibited better encapsulation. At the same time, the figure showed that A-GE-3 had a more compact structure and a more uniform and tight texture, which was consistent with the result that it had the highest encapsulation rate. Pop et al. (2017) produced gel beads with denser structure and higher cell density after adding sea buckthorn extract during immobilization of Lactiplantibacillus casei.

Fig. 1.

SEM images of microcapsules containing L. plantarum M5 at different magnifications. Each row of images shows A, A-GE-1, A-GE-2, A-GE-3, A-GE-4 and A-GE-5 microcapsules, respectively. Each column of images is magnified by 40×, 2400×, respectively

Viability of probiotics in gastrointestinal digestion

The survival of probiotics during gastrointestinal digestion is crucial for their probiotic effects. As shown in Fig. 2, the survival of free cells and microcapsules under gastrointestinal conditions was simulated. After 2 h of simulated gastric digestion, the viability of free cells decreased significantly, from the initial value of 10.45 log₁₀ CFU/mL to 5.68 log₁₀ CFU/mL, a decrease of 4.77 log₁₀ CFU/mL. However, compared with free cells, the cell viability was higher in the microcapsules, and the number of viable cells in A, A-GE-1, A-GE-2, A-GE-3, A-GE-4 and A-GE-5 were 6.05, 6.86, 7.42, 8.31, 7.42, 7.63 log₁₀ CFU/g, respectively. In this case, the A-GE-3 had the best protection effect (p < 0.05). Likewise, cell viability of free cells and microcapsules under simulated intestinal conditions was determined. After 2.5 h of simulated intestinal digestion, the viability of free cells could not be detected, while the cell viability in the microcapsules was still higher, which were 3.40, 6.09, 6.29, 7.17, 5.55 and 5.35 log₁₀ CFU/g in the A, A-GE-1, A-GE-2, A-GE-3, A-GE-4 and A-GE-5 groups, respectively. A-GE-3 microcapsules appeared to give L. plantarum M5 the most effective protection from the harsh gastrointestinal environment, the cell survival rate at the end of simulated gastrointestinal digestion was 74.22% (p < 0.05). It might be that the structure of the microcapsules gave protection to the cells and the addition of Goji Berry extract made the capsule structure denser. Under simulated gastric conditions, the dense structure prevented the erosion of cells by gastric acid, and the cells survived well in the capsule. Under intestinal conditions, the near-neutral pH environment and the presence of enzymes allowed the dissolution of the encapsulated material and the release of cells and bioactive components, which interacted with each other to promote the maintenance and colonization of cell viability. Gaudreau et al. (2016) co-microencapsulated Lactiplantibacillus swiss R0052 with green tea extract to protect the oxygen-sensitive probiotic cells through the antioxidant-rich green tea extract, and the viability of the probiotics in the microcapsules remained at 8.0 log₁₀ CFU/g after gastrointestinal digestion, thus enhancing their beneficial effects on the host. Raddatz et al. (2022) microencapsulated Lactiplantibacillus casei LC03 with different concentrations of red onion peel extract, and the probiotics in the microcapsules remained stable as they passed through the stomach and could be fully released when they reached the intestine.

Fig. 2.

Survival of free cells and microcapsules under simulated gastrointestinal conditions. The different small letters above the columns represent significant differences(p < 0.05)

Membrane integrity and permeability

As a nucleic acid fluorescent probe, PI cannot pass through the membrane of living cells and is excluded from the membrane, but it can penetrate cells with damaged membranes, and bind to DNA to stain the nucleus in red, resulting in enhanced fluorescence intensity (Liu et al., 2015). As shown in Fig. 3A, during the simulated gastric digestion, the H-GE group showed the lowest fluorescence intensity, indicating that the cell membrane was more complete at this time, and the ability of PI to penetrate was less, which was favorable for cell survival.

Fig. 3.

Cell membrane integrity (A), permeability (B), amino acid content (C), transcript levels of different genes (D), and membrane fatty acid composition (E) of L. plantarum M5 under different conditions. The different small letters above the columns represent significant differences (p < 0.05)

Likewise, cell membrane permeability showed similar results (Fig. 3B). The fluorescence intensity of the H-GE group was the lowest, the permeability barrier was enhanced, which improved the ability of cells to cope with the external hypertonic environment. In conclusion, the H-GE group had the best effect and could better maintain the survival of cells in the simulated gastric environment(p < 0.05).

Several studies found that the presence of metabolizable sugars such as soluble starch in the extract greatly increased the tolerance of Lactiplantibacillus to simulated gastric juice and bile (Blaiotta et al., 2013; Mohd Nor et al., 2017). Wu et al. (2012) also reported that the acid-tolerant mutant Lbz-2 of Lactiplantibacillus decreased the fluidity of the cell membrane and changed the composition of fatty acids, which reduced the damage caused by lactic acid.

Amino acid content and gene transcription level

Amino acid metabolism plays an important role in regulating intracellular pH and enhancing cellular resistance to environmental stress. (Cotter and Hill, 2003; Higuchi et al., 1997) Therefore, we compared the transcript levels of the genes gadA, gadB of the GAD pathway and arcD, argG, argH of the ADI pathway under different conditions during simulated gastric digestion. At the same time, the intracellular amino acid content was determined. The results were shown in Fig. 3D. Compared with other groups, the transcription levels of each gene in the H-GE group were significantly up-regulated(p < 0.05), and the argG gene was up-regulated by about 40 times (The relative transcript levels in group F were all recorded as 1). H-GE group accumulated higher concentrations of glutamate and arginine in cells (Fig. 3C). The accumulation of intracellular arginine and glutamate effectively enhanced cell survival under acid stress conditions. Gong et al. (2019) investigated the key role of the deciphered transcriptional regulator GadR on γ-aminobutyric acid production and acid tolerance in Lactiplantibacillus, and found that GadR is a positive transcriptional regulator that controls GABA conversion and acid tolerance in Lactiplantibacillus short. Similarly, Senouci-Rezkallah et al. (2011) reported that in the presence of glutamate, arginine and lysine, Bacillus cereus ATCC14579 was able to induce its acid tolerance system(ATR) at low pH conditions, which in turn regulated intracellular pH homeostasis and enhanced cell viability under acid stress.

Fatty acid composition of membrane

The cell membrane is the first barrier that separates the cell from the external environment. Lactiplantibacillus can reduce the damage caused by the external environment to the cell by changing the composition of the fatty acids of the cell membrane (Aricha et al., 2004). The fatty acid composition of the cell membrane was analyzed by GC–MS under the three conditions, and the results were shown in Fig. 3E. Compared with the other two groups, the content of unsaturated fatty acids in the H-GE group was relatively increased, and the content of oleic acid (C18:1) on the membrane increased most obviously. Oleic acid (C18:1), as the most important long-chain unsaturated fatty acid, the more content it contains, the more it helps to strengthen the cell membrane permeability barrier and improve the tolerance of cells to external stress (Guo et al., 2018). Therefore, under the stress of external conditions, the addition of Goji Berry extracts enhanced the permeability barrier of the cell membrane by regulating lipid metabolism to maintain its survival in an acid environment. Min et al. (2020) screened two strains of Streptococcus thermophilus from Korean kimchi that were able to tolerate high temperatures by heat treatment, and later found that the cells reduced the UFA/SFA ratio by regulating the fatty acid composition on the membrane, which in turn reduced membrane fluidity and facilitated cell survival in heat-resistant environments.

Declarations

Conflict of interest

The authors declare no conflict of interest.

Ethical approval

This article does not contain any studies with human or animal subjects performed by the any of the authors.